ID: 1165071246

View in Genome Browser
Species Human (GRCh38)
Location 19:33256078-33256100
Sequence AACCCAACCCCACTCAGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165071246_1165071249 1 Left 1165071246 19:33256078-33256100 CCGGATCTGAGTGGGGTTGGGTT No data
Right 1165071249 19:33256102-33256124 TGTCTAGCTCCGGTCAACGGAGG No data
1165071246_1165071256 30 Left 1165071246 19:33256078-33256100 CCGGATCTGAGTGGGGTTGGGTT No data
Right 1165071256 19:33256131-33256153 TGGATCTTGAAGTGTGTGGAGGG No data
1165071246_1165071251 10 Left 1165071246 19:33256078-33256100 CCGGATCTGAGTGGGGTTGGGTT No data
Right 1165071251 19:33256111-33256133 CCGGTCAACGGAGGATGCCCTGG No data
1165071246_1165071255 29 Left 1165071246 19:33256078-33256100 CCGGATCTGAGTGGGGTTGGGTT No data
Right 1165071255 19:33256130-33256152 CTGGATCTTGAAGTGTGTGGAGG No data
1165071246_1165071247 -9 Left 1165071246 19:33256078-33256100 CCGGATCTGAGTGGGGTTGGGTT No data
Right 1165071247 19:33256092-33256114 GGTTGGGTTCTGTCTAGCTCCGG No data
1165071246_1165071248 -2 Left 1165071246 19:33256078-33256100 CCGGATCTGAGTGGGGTTGGGTT No data
Right 1165071248 19:33256099-33256121 TTCTGTCTAGCTCCGGTCAACGG No data
1165071246_1165071252 26 Left 1165071246 19:33256078-33256100 CCGGATCTGAGTGGGGTTGGGTT No data
Right 1165071252 19:33256127-33256149 GCCCTGGATCTTGAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165071246 Original CRISPR AACCCAACCCCACTCAGATC CGG (reversed) Intergenic
No off target data available for this crispr