ID: 1165073119

View in Genome Browser
Species Human (GRCh38)
Location 19:33267085-33267107
Sequence AGGCCAGCTGCCAGCGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165073119_1165073128 17 Left 1165073119 19:33267085-33267107 CCCCCGGCGCTGGCAGCTGGCCT No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data
1165073119_1165073127 13 Left 1165073119 19:33267085-33267107 CCCCCGGCGCTGGCAGCTGGCCT No data
Right 1165073127 19:33267121-33267143 TGGAGATGCTGAAGACTCCTCGG No data
1165073119_1165073125 -7 Left 1165073119 19:33267085-33267107 CCCCCGGCGCTGGCAGCTGGCCT No data
Right 1165073125 19:33267101-33267123 CTGGCCTGGCTTCTCTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165073119 Original CRISPR AGGCCAGCTGCCAGCGCCGG GGG (reversed) Intergenic