ID: 1165073123

View in Genome Browser
Species Human (GRCh38)
Location 19:33267088-33267110
Sequence GCCAGGCCAGCTGCCAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165073123_1165073127 10 Left 1165073123 19:33267088-33267110 CCGGCGCTGGCAGCTGGCCTGGC No data
Right 1165073127 19:33267121-33267143 TGGAGATGCTGAAGACTCCTCGG No data
1165073123_1165073125 -10 Left 1165073123 19:33267088-33267110 CCGGCGCTGGCAGCTGGCCTGGC No data
Right 1165073125 19:33267101-33267123 CTGGCCTGGCTTCTCTCGGCTGG No data
1165073123_1165073128 14 Left 1165073123 19:33267088-33267110 CCGGCGCTGGCAGCTGGCCTGGC No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165073123 Original CRISPR GCCAGGCCAGCTGCCAGCGC CGG (reversed) Intergenic