ID: 1165073126

View in Genome Browser
Species Human (GRCh38)
Location 19:33267105-33267127
Sequence ATCTCCAGCCGAGAGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165073126_1165073128 -3 Left 1165073126 19:33267105-33267127 CCTGGCTTCTCTCGGCTGGAGAT No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data
1165073126_1165073127 -7 Left 1165073126 19:33267105-33267127 CCTGGCTTCTCTCGGCTGGAGAT No data
Right 1165073127 19:33267121-33267143 TGGAGATGCTGAAGACTCCTCGG No data
1165073126_1165073130 23 Left 1165073126 19:33267105-33267127 CCTGGCTTCTCTCGGCTGGAGAT No data
Right 1165073130 19:33267151-33267173 GAGAAGCATGAGAACAGAGCTGG No data
1165073126_1165073131 24 Left 1165073126 19:33267105-33267127 CCTGGCTTCTCTCGGCTGGAGAT No data
Right 1165073131 19:33267152-33267174 AGAAGCATGAGAACAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165073126 Original CRISPR ATCTCCAGCCGAGAGAAGCC AGG (reversed) Intergenic