ID: 1165073128

View in Genome Browser
Species Human (GRCh38)
Location 19:33267125-33267147
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165073121_1165073128 15 Left 1165073121 19:33267087-33267109 CCCGGCGCTGGCAGCTGGCCTGG No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data
1165073120_1165073128 16 Left 1165073120 19:33267086-33267108 CCCCGGCGCTGGCAGCTGGCCTG No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data
1165073119_1165073128 17 Left 1165073119 19:33267085-33267107 CCCCCGGCGCTGGCAGCTGGCCT No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data
1165073126_1165073128 -3 Left 1165073126 19:33267105-33267127 CCTGGCTTCTCTCGGCTGGAGAT No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data
1165073123_1165073128 14 Left 1165073123 19:33267088-33267110 CCGGCGCTGGCAGCTGGCCTGGC No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data
1165073117_1165073128 20 Left 1165073117 19:33267082-33267104 CCTCCCCCGGCGCTGGCAGCTGG No data
Right 1165073128 19:33267125-33267147 GATGCTGAAGACTCCTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165073128 Original CRISPR GATGCTGAAGACTCCTCGGC TGG Intergenic
No off target data available for this crispr