ID: 1165074548

View in Genome Browser
Species Human (GRCh38)
Location 19:33273611-33273633
Sequence CACAGGGACGTGCCCACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165074548_1165074556 13 Left 1165074548 19:33273611-33273633 CCGTGTGTGGGCACGTCCCTGTG No data
Right 1165074556 19:33273647-33273669 TGCCCCAGAGACACAGCCATAGG No data
1165074548_1165074561 21 Left 1165074548 19:33273611-33273633 CCGTGTGTGGGCACGTCCCTGTG No data
Right 1165074561 19:33273655-33273677 AGACACAGCCATAGGCAGGCTGG No data
1165074548_1165074563 30 Left 1165074548 19:33273611-33273633 CCGTGTGTGGGCACGTCCCTGTG No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074548_1165074560 17 Left 1165074548 19:33273611-33273633 CCGTGTGTGGGCACGTCCCTGTG No data
Right 1165074560 19:33273651-33273673 CCAGAGACACAGCCATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165074548 Original CRISPR CACAGGGACGTGCCCACACA CGG (reversed) Intergenic
No off target data available for this crispr