ID: 1165074556

View in Genome Browser
Species Human (GRCh38)
Location 19:33273647-33273669
Sequence TGCCCCAGAGACACAGCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165074547_1165074556 24 Left 1165074547 19:33273600-33273622 CCGCGGGGGAGCCGTGTGTGGGC No data
Right 1165074556 19:33273647-33273669 TGCCCCAGAGACACAGCCATAGG No data
1165074548_1165074556 13 Left 1165074548 19:33273611-33273633 CCGTGTGTGGGCACGTCCCTGTG No data
Right 1165074556 19:33273647-33273669 TGCCCCAGAGACACAGCCATAGG No data
1165074549_1165074556 -3 Left 1165074549 19:33273627-33273649 CCCTGTGCTGCCGCCCCCGCTGC No data
Right 1165074556 19:33273647-33273669 TGCCCCAGAGACACAGCCATAGG No data
1165074550_1165074556 -4 Left 1165074550 19:33273628-33273650 CCTGTGCTGCCGCCCCCGCTGCC No data
Right 1165074556 19:33273647-33273669 TGCCCCAGAGACACAGCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165074556 Original CRISPR TGCCCCAGAGACACAGCCAT AGG Intergenic
No off target data available for this crispr