ID: 1165074563

View in Genome Browser
Species Human (GRCh38)
Location 19:33273664-33273686
Sequence CATAGGCAGGCTGGCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165074552_1165074563 1 Left 1165074552 19:33273640-33273662 CCCCCGCTGCCCCAGAGACACAG No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074548_1165074563 30 Left 1165074548 19:33273611-33273633 CCGTGTGTGGGCACGTCCCTGTG No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074557_1165074563 -8 Left 1165074557 19:33273649-33273671 CCCCAGAGACACAGCCATAGGCA No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074559_1165074563 -10 Left 1165074559 19:33273651-33273673 CCAGAGACACAGCCATAGGCAGG No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074558_1165074563 -9 Left 1165074558 19:33273650-33273672 CCCAGAGACACAGCCATAGGCAG No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074551_1165074563 4 Left 1165074551 19:33273637-33273659 CCGCCCCCGCTGCCCCAGAGACA No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074553_1165074563 0 Left 1165074553 19:33273641-33273663 CCCCGCTGCCCCAGAGACACAGC No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074550_1165074563 13 Left 1165074550 19:33273628-33273650 CCTGTGCTGCCGCCCCCGCTGCC No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074549_1165074563 14 Left 1165074549 19:33273627-33273649 CCCTGTGCTGCCGCCCCCGCTGC No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074554_1165074563 -1 Left 1165074554 19:33273642-33273664 CCCGCTGCCCCAGAGACACAGCC No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data
1165074555_1165074563 -2 Left 1165074555 19:33273643-33273665 CCGCTGCCCCAGAGACACAGCCA No data
Right 1165074563 19:33273664-33273686 CATAGGCAGGCTGGCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165074563 Original CRISPR CATAGGCAGGCTGGCTCCCC TGG Intergenic
No off target data available for this crispr