ID: 1165077008

View in Genome Browser
Species Human (GRCh38)
Location 19:33285295-33285317
Sequence CGGTGTGGCCCGTGACTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165077008_1165077015 18 Left 1165077008 19:33285295-33285317 CCTCCGAGTCACGGGCCACACCG No data
Right 1165077015 19:33285336-33285358 GCACTGTCTGTTTCTCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165077008 Original CRISPR CGGTGTGGCCCGTGACTCGG AGG (reversed) Intergenic
No off target data available for this crispr