ID: 1165077514

View in Genome Browser
Species Human (GRCh38)
Location 19:33288405-33288427
Sequence TCTCCTCAATTTTGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165077514_1165077520 25 Left 1165077514 19:33288405-33288427 CCACCAGGCCAAAATTGAGGAGA No data
Right 1165077520 19:33288453-33288475 AGAAGAAGCCACTTTTTCCCTGG No data
1165077514_1165077518 -6 Left 1165077514 19:33288405-33288427 CCACCAGGCCAAAATTGAGGAGA No data
Right 1165077518 19:33288422-33288444 AGGAGAAAAGGAATCCAGACAGG No data
1165077514_1165077521 26 Left 1165077514 19:33288405-33288427 CCACCAGGCCAAAATTGAGGAGA No data
Right 1165077521 19:33288454-33288476 GAAGAAGCCACTTTTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165077514 Original CRISPR TCTCCTCAATTTTGGCCTGG TGG (reversed) Intergenic
No off target data available for this crispr