ID: 1165077518

View in Genome Browser
Species Human (GRCh38)
Location 19:33288422-33288444
Sequence AGGAGAAAAGGAATCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165077514_1165077518 -6 Left 1165077514 19:33288405-33288427 CCACCAGGCCAAAATTGAGGAGA No data
Right 1165077518 19:33288422-33288444 AGGAGAAAAGGAATCCAGACAGG No data
1165077515_1165077518 -9 Left 1165077515 19:33288408-33288430 CCAGGCCAAAATTGAGGAGAAAA No data
Right 1165077518 19:33288422-33288444 AGGAGAAAAGGAATCCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165077518 Original CRISPR AGGAGAAAAGGAATCCAGAC AGG Intergenic
No off target data available for this crispr