ID: 1165077520

View in Genome Browser
Species Human (GRCh38)
Location 19:33288453-33288475
Sequence AGAAGAAGCCACTTTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165077519_1165077520 -6 Left 1165077519 19:33288436-33288458 CCAGACAGGTGAGCAAGAGAAGA No data
Right 1165077520 19:33288453-33288475 AGAAGAAGCCACTTTTTCCCTGG No data
1165077514_1165077520 25 Left 1165077514 19:33288405-33288427 CCACCAGGCCAAAATTGAGGAGA No data
Right 1165077520 19:33288453-33288475 AGAAGAAGCCACTTTTTCCCTGG No data
1165077515_1165077520 22 Left 1165077515 19:33288408-33288430 CCAGGCCAAAATTGAGGAGAAAA No data
Right 1165077520 19:33288453-33288475 AGAAGAAGCCACTTTTTCCCTGG No data
1165077517_1165077520 17 Left 1165077517 19:33288413-33288435 CCAAAATTGAGGAGAAAAGGAAT No data
Right 1165077520 19:33288453-33288475 AGAAGAAGCCACTTTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165077520 Original CRISPR AGAAGAAGCCACTTTTTCCC TGG Intergenic
No off target data available for this crispr