ID: 1165079804

View in Genome Browser
Species Human (GRCh38)
Location 19:33300808-33300830
Sequence GGGTGGAAACATAGGGACTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 168}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165079804_1165079815 0 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079815 19:33300831-33300853 CTTTCTAAGGACAGGCGTGGAGG 0: 1
1: 0
2: 4
3: 96
4: 849
1165079804_1165079820 15 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079820 19:33300846-33300868 CGTGGAGGAGCGGCTGGGGCTGG 0: 1
1: 1
2: 3
3: 61
4: 695
1165079804_1165079818 10 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079818 19:33300841-33300863 ACAGGCGTGGAGGAGCGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 190
1165079804_1165079822 19 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079822 19:33300850-33300872 GAGGAGCGGCTGGGGCTGGCGGG 0: 2
1: 0
2: 10
3: 100
4: 959
1165079804_1165079816 5 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079816 19:33300836-33300858 TAAGGACAGGCGTGGAGGAGCGG 0: 1
1: 0
2: 3
3: 33
4: 341
1165079804_1165079819 11 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079819 19:33300842-33300864 CAGGCGTGGAGGAGCGGCTGGGG 0: 1
1: 0
2: 4
3: 38
4: 399
1165079804_1165079809 -8 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079809 19:33300823-33300845 TTCCACCCCTTTCTAAGGACAGG 0: 1
1: 1
2: 2
3: 10
4: 131
1165079804_1165079823 27 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079823 19:33300858-33300880 GCTGGGGCTGGCGGGCTTGTCGG 0: 1
1: 0
2: 3
3: 32
4: 377
1165079804_1165079817 9 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079817 19:33300840-33300862 GACAGGCGTGGAGGAGCGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 327
1165079804_1165079821 18 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079821 19:33300849-33300871 GGAGGAGCGGCTGGGGCTGGCGG 0: 1
1: 2
2: 16
3: 213
4: 1661
1165079804_1165079812 -3 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079812 19:33300828-33300850 CCCCTTTCTAAGGACAGGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 97
1165079804_1165079824 28 Left 1165079804 19:33300808-33300830 CCCAAGTCCCTATGTTTCCACCC 0: 1
1: 0
2: 1
3: 35
4: 168
Right 1165079824 19:33300859-33300881 CTGGGGCTGGCGGGCTTGTCGGG 0: 1
1: 0
2: 3
3: 36
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165079804 Original CRISPR GGGTGGAAACATAGGGACTT GGG (reversed) Exonic
900926558 1:5709782-5709804 GGCTGGAAACCAAGGCACTTGGG - Intergenic
902464593 1:16608170-16608192 GGGTGGAAACAGAGAGAAATGGG + Intronic
902581134 1:17408356-17408378 TTGTGGAACCATGGGGACTTGGG - Exonic
903156215 1:21445535-21445557 GGGTGGAAACAGAGAGAAATGGG - Intronic
903673563 1:25050838-25050860 GGCTGGACACACAGGGCCTTGGG - Intergenic
909357745 1:74728677-74728699 GGGTGGAATCATAAGTATTTTGG + Intronic
916400968 1:164448306-164448328 GGGTGGACACCTAAGGCCTTGGG + Intergenic
917854794 1:179091465-179091487 TGGTGGAAGAAAAGGGACTTTGG + Intronic
922006846 1:221539869-221539891 TGCAGGATACATAGGGACTTCGG - Intergenic
922009136 1:221563627-221563649 GGCCGGAAGCACAGGGACTTGGG - Intergenic
1066049043 10:31618502-31618524 GGGAGGCAAGATAGGGACATGGG + Intergenic
1067752893 10:48983626-48983648 AGGTGGACACATAGGGACTTGGG + Intergenic
1068682313 10:59833571-59833593 CAGTGGACCCATAGGGACTTGGG + Intronic
1069177597 10:65312832-65312854 GGATGAAATCATAGGGATTTGGG - Intergenic
1070956973 10:80470530-80470552 GCGTGGAAACATAGAGAATGAGG + Intronic
1074419119 10:113293580-113293602 GGGTGCAACTTTAGGGACTTGGG + Intergenic
1077353653 11:2104815-2104837 CGGTGGAAACCTGGGGATTTCGG - Intergenic
1078571483 11:12461777-12461799 GGGTGGAAACTGTAGGACTTGGG + Intronic
1083611332 11:64005819-64005841 GGCTGGAGACAGAGGGCCTTGGG + Intronic
1084815966 11:71646970-71646992 CTGTGGAAGAATAGGGACTTTGG - Intergenic
1087893504 11:103562093-103562115 GGGTGGGAATATTGGGACTGTGG - Intergenic
1087958858 11:104323427-104323449 GGGTGAAAACATGGGGCTTTGGG + Intergenic
1089208665 11:116785990-116786012 GAGTGGAAACAGAGTGACTCAGG + Intronic
1090657484 11:128857069-128857091 GGGTGGGAACATAGTGAGCTAGG - Intronic
1091844824 12:3647800-3647822 GTGAGGAAACAGAAGGACTTTGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093738930 12:22658433-22658455 AGGTGCAAACATAGGGTCCTGGG + Intronic
1093917934 12:24826438-24826460 GGTTGTAAACATGTGGACTTAGG + Intronic
1095940993 12:47726696-47726718 GAGTCCAAACATAGGGACTCAGG + Intergenic
1096577290 12:52560708-52560730 GGGTGGAAACCAGGGGAATTCGG - Intergenic
1096960990 12:55577421-55577443 GGGTGGAATAATATGGGCTTGGG - Intergenic
1101839192 12:108315783-108315805 GGCTGAAACCATAGGGGCTTTGG - Intronic
1103346801 12:120256553-120256575 GGGTAGAAAGATGGGGACGTGGG + Intronic
1106924773 13:34602137-34602159 GGGTGAAATCATAGTGACTTGGG - Intergenic
1111224809 13:85255403-85255425 GGGTTCAAACATATGGATTTTGG - Intergenic
1114712697 14:24794608-24794630 GGGTGGGCACATTGGGGCTTGGG + Intergenic
1115844944 14:37519236-37519258 GGGTTTAGACATAGGGATTTAGG + Intronic
1117901564 14:60539026-60539048 GGGTTTCAACATAGGTACTTGGG + Intergenic
1119716937 14:76866412-76866434 AGGTGGAAATGTTGGGACTTTGG - Intronic
1119784973 14:77306225-77306247 AGGTGCAAATAAAGGGACTTTGG - Intronic
1120943797 14:89975044-89975066 TGGTGGCAACATAAAGACTTAGG - Intronic
1121060813 14:90907986-90908008 GGGTAGAAATATATGCACTTTGG + Intronic
1122022918 14:98854118-98854140 GGATGGATACTTAGGGACTCAGG - Intergenic
1122461415 14:101898671-101898693 GGGTGGGAACATCGGGGCCTAGG - Intronic
1126679981 15:51193100-51193122 GGGTGGAAACAGTGGGGCTTGGG + Intergenic
1128212804 15:65914099-65914121 GGGTAGTCACATAGGGACTCAGG - Intronic
1128367281 15:67013392-67013414 GGCTGGAAAAATGGGGTCTTTGG + Intergenic
1128766311 15:70253199-70253221 GGGAAAGAACATAGGGACTTGGG - Intergenic
1133100338 16:3475632-3475654 GGGCGGAAAGAAAGAGACTTTGG - Intronic
1135615767 16:23909626-23909648 GTGTGGAATGATAGTGACTTGGG - Intronic
1136353104 16:29724715-29724737 GGGAGGAAACGGAGTGACTTTGG - Intergenic
1137797550 16:51234848-51234870 GGGCGGAAAAACAGGGACTTTGG - Intergenic
1140136583 16:72211139-72211161 CTATGGCAACATAGGGACTTAGG + Intergenic
1140965225 16:79959477-79959499 GGGTGGAAACAGTGGGGCTCGGG - Intergenic
1141633021 16:85299134-85299156 CGGTGCAAACATACGGACATGGG - Intergenic
1142983377 17:3684107-3684129 GGGAGGAGACACAGGGACTGAGG - Intronic
1143591833 17:7889616-7889638 GGCTGGAAACCTAGAGGCTTAGG + Intronic
1149927839 17:60719176-60719198 GGGTGGAAAGGTAGTGAGTTTGG + Intronic
1150064120 17:62094557-62094579 GTGTTGAAACATATGCACTTGGG - Intergenic
1150478497 17:65491652-65491674 GGATGGAAAGATAGGAGCTTAGG + Intergenic
1150591761 17:66568869-66568891 GACTGGAAACGTAGGGTCTTTGG + Intronic
1155505801 18:26531649-26531671 GGGTAGAATCATAGGTTCTTAGG + Intronic
1158066370 18:53414382-53414404 GGGAGGAAACTTTGGGAGTTTGG + Intronic
1158558342 18:58493286-58493308 GAGAGGAAACAAAGGGACATTGG - Intronic
1159279305 18:66264840-66264862 AGGTGGAGAGATAGGGCCTTAGG - Intergenic
1160581281 18:79885799-79885821 GGATGGGAACATAGGGACGTGGG + Intronic
1160581301 18:79885856-79885878 GGATGGGAACATAGGGACGTGGG + Intronic
1160581340 18:79885969-79885991 GGATGGGAACATAGGGACGTGGG + Intronic
1160581356 18:79886026-79886048 GGATGGGAACATAGGGACGTGGG + Intronic
1160581376 18:79886083-79886105 GGATGGGAACATAGGGACGTGGG + Intronic
1160581396 18:79886140-79886162 GGATGGGAACATAGGGACGTGGG + Intronic
1160581416 18:79886197-79886219 GGATGGGAACATAGGGACGTGGG + Intronic
1160581436 18:79886254-79886276 GGATGGGAACATAGGGACGTGGG + Intronic
1160581456 18:79886311-79886333 GGATGGGAACATAGGGACGTGGG + Intronic
1160581476 18:79886368-79886390 GGATGGGAACATAGGGACGTGGG + Intronic
1160581496 18:79886425-79886447 GGATGGGAACATAGGGACGTGGG + Intronic
1160581512 18:79886474-79886496 GGATGGGAACATAGGGACGTGGG + Intronic
1160581532 18:79886531-79886553 GGATGGGAACATAGGGACGTGGG + Intronic
1160581552 18:79886588-79886610 GGATGGGAACATAGGGACGTGGG + Intronic
1160581572 18:79886645-79886667 GGATGGGAACATAGGGACGTGGG + Intronic
1160581589 18:79886702-79886724 GGATGGGAACATAGGGACGTGGG + Intronic
1160581605 18:79886751-79886773 GGATGGGAACATAGGGACGTGGG + Intronic
1160581625 18:79886808-79886830 GGATGGGAACATAGGGACGTGGG + Intronic
1160581645 18:79886865-79886887 GGATGGGAACATAGGGACGTGGG + Intronic
1160581665 18:79886922-79886944 GGATGGGAACATAGGGACGTGGG + Intronic
1160581682 18:79886979-79887001 GGATGGGAACATAGGGACGTGGG + Intronic
1160581701 18:79887036-79887058 GGATGGGAACATAGGGACGTGGG + Intronic
1161487053 19:4542161-4542183 GTGTGGAAACATGGAGACTTCGG - Intergenic
1165026772 19:32968187-32968209 GGGTGGAAACATGGAAACTGTGG - Intronic
1165079804 19:33300808-33300830 GGGTGGAAACATAGGGACTTGGG - Exonic
1165410717 19:35659280-35659302 GGTTGCACACATAGGAACTTAGG - Intergenic
1165427626 19:35754736-35754758 GGGTCAAGACAAAGGGACTTAGG + Exonic
1165741967 19:38210101-38210123 GGGTGGAGAGAGAGAGACTTGGG - Intergenic
1165946313 19:39444940-39444962 GGAAAGAAAAATAGGGACTTGGG + Intronic
1166125770 19:40714694-40714716 GGGTGGACACAGAGGAACATGGG - Intronic
1166270334 19:41709610-41709632 GGGTGGAAAAATGGGGTCCTGGG - Intronic
1166276282 19:41756530-41756552 GGGTGGAAAAACAGGGCCCTGGG - Intronic
1166406813 19:42527448-42527470 GGGTAGAAAAATGGGGCCTTGGG + Intronic
1167102929 19:47415123-47415145 GGGGGGAGACAGAGGGAATTGGG + Intronic
1167846604 19:52170395-52170417 GGGAGGAAGCCTAGGGAGTTGGG - Intronic
927157091 2:20226614-20226636 TGGTGGAAAAATAGGAATTTTGG + Intergenic
927399694 2:22696699-22696721 GCGTGTAAACTTAGGGACTTAGG - Intergenic
929036365 2:37695885-37695907 GAGGGGAAACATTGGGAATTTGG + Intronic
934940347 2:98497024-98497046 GGGAGGAAAGAGAGGGAGTTAGG + Intronic
935162875 2:100544321-100544343 GGGTAGAAAAATAGGAACTGTGG - Intergenic
936402274 2:112174436-112174458 GGGTGGAATGGGAGGGACTTAGG - Intronic
938606179 2:132894964-132894986 GAGAGGGAACATAAGGACTTGGG + Intronic
941836084 2:170022294-170022316 GAGTGGAGACATAGGAACTCCGG + Intronic
943612275 2:190047171-190047193 GGCTGGAAAGATAGGGTCTTGGG - Intronic
944689964 2:202149738-202149760 GGGTGGAGACACAGCCACTTGGG + Intronic
946529419 2:220555801-220555823 GGATGGAAACATGGGAACTCTGG + Intergenic
948672252 2:239576032-239576054 GGCTGGAAACAGAGGGAGCTTGG + Intergenic
1169173139 20:3483003-3483025 GGGTGGTAACATGGGGACCTTGG - Intronic
1171949189 20:31405816-31405838 GGGTGTAAAGAGAGAGACTTGGG - Intronic
1173016688 20:39232339-39232361 AGGTGAAAACATGGGGAATTTGG - Intergenic
1174678660 20:52382970-52382992 GGGTGGAAACATAGAGTCTGTGG + Intergenic
1177402254 21:20621025-20621047 GGTTGGAGAGATAGAGACTTGGG - Intergenic
1177806418 21:25879428-25879450 GGGTTTCAACATAGGGATTTGGG - Intergenic
1178608337 21:34058307-34058329 GCGTGGTAAGATAGGGACCTGGG + Intergenic
1178634495 21:34290431-34290453 GGGTGGAACCACAGGCATTTGGG - Intergenic
1180758290 22:18178558-18178580 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1180768578 22:18362350-18362372 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1180777733 22:18500041-18500063 GGGAGTAAAAATAGGGAGTTTGG - Intergenic
1180810458 22:18757352-18757374 GGGAGTAAAAATAGGGAGTTTGG - Intergenic
1180826453 22:18865574-18865596 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1181196602 22:21191607-21191629 GGGAGTAAAAATAGGGAGTTTGG - Intergenic
1181212926 22:21301517-21301539 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1181523579 22:23464529-23464551 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1182688095 22:32136227-32136249 GCGTGTCAACATAGAGACTTAGG - Intergenic
1183707697 22:39484671-39484693 GGGTGGAAAGATAGGAATTTGGG - Intronic
1203230196 22_KI270731v1_random:103238-103260 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
1203276596 22_KI270734v1_random:91480-91502 GGGAGTAAAAATAGGGAGTTTGG + Intergenic
950781690 3:15398000-15398022 GGGTGCAATCATAGGGATGTGGG - Intronic
957823637 3:85411950-85411972 GGGTGTAATCACAGTGACTTGGG - Intronic
960361900 3:116723034-116723056 GGGTGGATACATAGGCAAATGGG - Intronic
960861414 3:122157901-122157923 TGGAGGAAACAGAAGGACTTTGG - Intergenic
961244905 3:125442417-125442439 GGGTGAAAACAGGGGGACTGAGG + Intergenic
961416886 3:126765741-126765763 TGGTGGAACCATGGGGACTTGGG - Intronic
962093792 3:132272673-132272695 GGGTTGAAGCAGAGGGAATTAGG - Intronic
962701344 3:138002668-138002690 GGATGGAAACACAGACACTTAGG + Intronic
962939061 3:140109068-140109090 GGATGGAAACCTAGGCACTGTGG + Intronic
962964146 3:140337990-140338012 GGGGGGAAACAAAGGCACTCTGG + Intronic
963027027 3:140930203-140930225 GGATGGAAACATGGGCAGTTTGG - Intergenic
963557754 3:146814877-146814899 GGTTTAAACCATAGGGACTTAGG + Intergenic
964461202 3:156931466-156931488 GGGTGGAATTTCAGGGACTTCGG - Intronic
964561747 3:158004737-158004759 GAGTGGGAACATATGGAGTTTGG - Intergenic
967625694 3:191681327-191681349 GGGTGGAGACAGAGGTAATTAGG - Intergenic
969687408 4:8683412-8683434 GGGTGGAAAAATAGGTAGATGGG + Intergenic
970048165 4:11879370-11879392 GGGAGGAATCATAGGTAGTTTGG - Intergenic
970447508 4:16136467-16136489 GGGTGGAATCAAAAGGACATTGG - Intergenic
975286599 4:72628705-72628727 AGGTGGAAACATAGGCATATTGG - Intergenic
975689143 4:76948537-76948559 GGGTGGAAGCACAGGGAGTGTGG - Intergenic
976220356 4:82752346-82752368 AGGTGGAAGCACAGGGACGTGGG + Intronic
976577918 4:86697711-86697733 GTGAGGATACATGGGGACTTGGG + Intronic
978277324 4:106967748-106967770 GGGAGGAAAGAAAGGGAATTAGG + Intronic
978446769 4:108787701-108787723 TGGTGGAACCATGGGGACTTGGG - Intergenic
979606566 4:122644841-122644863 GAGTGAAAAGATAGGGAGTTGGG - Intergenic
981495112 4:145382497-145382519 GGGGGGAAAGACAGGAACTTTGG + Intergenic
983770547 4:171543832-171543854 TGTTGGAAACAGAGGGATTTGGG - Intergenic
990987663 5:61655708-61655730 GGGAGGAAACTGAGGGACTGGGG + Intronic
992737946 5:79742607-79742629 GGGAGGAGACACAAGGACTTGGG - Intronic
993809621 5:92459166-92459188 GAGTGTAAACATAGGCAATTGGG - Intergenic
996627570 5:125588156-125588178 TGGTGGAAACATTGAGACATTGG + Intergenic
1001763371 5:174225429-174225451 GGGTGTGGACGTAGGGACTTGGG + Intronic
1002056863 5:176603164-176603186 AAGTAGAAACATAGGGGCTTAGG - Intronic
1003671188 6:8161937-8161959 GGATGGATACATGGGGACATTGG - Intergenic
1008885854 6:56431175-56431197 TGGTAGAACCATGGGGACTTGGG - Intergenic
1011009318 6:82685918-82685940 GGGTGCAATCATAGGGATATAGG + Intergenic
1015086361 6:129297583-129297605 AGGTGGGAACAGAGGAACTTAGG - Intronic
1017986797 6:159450830-159450852 GGGTAAAACCACAGGGACTTGGG + Intergenic
1018746035 6:166762854-166762876 AGGTGGAAACACAGGTACATAGG + Intronic
1019384287 7:745825-745847 TGGTGGAAACACAGGCTCTTTGG + Intronic
1019749696 7:2721220-2721242 GAGTGGAAGCACAGGGACTAAGG + Intronic
1020121283 7:5505161-5505183 GGGAGGGAACCTAGGGCCTTGGG - Intronic
1021697057 7:23286172-23286194 GGGTGGAGAGAGAGGGAGTTGGG - Intergenic
1022098307 7:27154552-27154574 GGCTGGATACATAGGTAGTTTGG + Exonic
1022322390 7:29299163-29299185 GGGTGGAACCATAGGATGTTTGG - Intronic
1022628950 7:32067275-32067297 GGGTGGAAGCGTAGGCACTGGGG + Intronic
1023034190 7:36116443-36116465 GGGTGGAAAAATAAAAACTTTGG - Intergenic
1026883880 7:73925297-73925319 GAGTGGAAACATTGGGTCATAGG + Intergenic
1027352519 7:77326563-77326585 CACTGGAAACAGAGGGACTTGGG + Intronic
1027825083 7:83102494-83102516 TGGTGGAAAAATACAGACTTCGG + Intronic
1032390692 7:131553661-131553683 GGGTGGAAACACTCAGACTTTGG - Intronic
1035861453 8:3032731-3032753 AGGAGAAAACATAGGGAGTTGGG - Intronic
1038779589 8:30558486-30558508 GTGTGGAAACATAGCTGCTTTGG - Intronic
1038992302 8:32881124-32881146 GGAAGGAACCATAGGGACTAAGG - Intergenic
1040056379 8:43061377-43061399 AGGTGGAAACAGAGGCACATAGG - Intronic
1042228326 8:66532537-66532559 GCGTGGGATCTTAGGGACTTGGG + Intergenic
1050715672 9:8522350-8522372 CGATTGAAACACAGGGACTTAGG + Intronic
1053230174 9:36401165-36401187 GGGTGGAAACAAAGGGGGTTCGG - Intronic
1054980996 9:71205852-71205874 GTGTGCAAACACAGGGATTTAGG - Intronic
1055444060 9:76365388-76365410 GGGTTGAAACATAGTTACATAGG - Intergenic
1056618045 9:88185371-88185393 AGGTGGAAGAATAGGGAGTTGGG - Intergenic
1056952581 9:91055298-91055320 GGGTGGGGACATAGGGAGTCAGG - Intergenic
1057898091 9:98925557-98925579 GAGTGGACACATAGTGACTCTGG - Intergenic
1058925506 9:109659414-109659436 GGCTGGAAAGATAGGGTATTGGG - Intronic
1060931164 9:127490364-127490386 TGGTGGTGTCATAGGGACTTAGG + Intronic
1061359277 9:130130983-130131005 GGTTGCAAACACAGAGACTTGGG + Intronic
1062206383 9:135339777-135339799 GGGTGAACACATAGGGACCCGGG - Intergenic
1188807791 X:34613440-34613462 GGGTGGGCTCCTAGGGACTTGGG + Intergenic
1188827540 X:34854454-34854476 TGGTGGAAACGTAGTCACTTTGG - Intergenic
1193971509 X:88060766-88060788 CGGTGGAATCATAAGGATTTGGG + Intergenic
1194935216 X:99939820-99939842 TGGTGGAACCATGGGGACTTGGG - Intergenic
1198369798 X:135979412-135979434 GGATGTCAACATAGGCACTTAGG - Intergenic
1198442758 X:136680102-136680124 GGTTGGAAGAATATGGACTTTGG - Intronic