ID: 1165079927

View in Genome Browser
Species Human (GRCh38)
Location 19:33301298-33301320
Sequence CGCCGGAGGCTGGCCCAGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 2, 2: 1, 3: 22, 4: 309}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165079915_1165079927 -2 Left 1165079915 19:33301277-33301299 CCAAACCACTCCCTGGGTCCCCG 0: 1
1: 0
2: 0
3: 21
4: 201
Right 1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG 0: 1
1: 2
2: 1
3: 22
4: 309
1165079913_1165079927 0 Left 1165079913 19:33301275-33301297 CCCCAAACCACTCCCTGGGTCCC 0: 1
1: 0
2: 0
3: 29
4: 337
Right 1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG 0: 1
1: 2
2: 1
3: 22
4: 309
1165079909_1165079927 16 Left 1165079909 19:33301259-33301281 CCTCGAGATCCGGCGACCCCAAA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG 0: 1
1: 2
2: 1
3: 22
4: 309
1165079914_1165079927 -1 Left 1165079914 19:33301276-33301298 CCCAAACCACTCCCTGGGTCCCC 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG 0: 1
1: 2
2: 1
3: 22
4: 309
1165079917_1165079927 -7 Left 1165079917 19:33301282-33301304 CCACTCCCTGGGTCCCCGCCGGA 0: 1
1: 0
2: 0
3: 20
4: 285
Right 1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG 0: 1
1: 2
2: 1
3: 22
4: 309
1165079910_1165079927 7 Left 1165079910 19:33301268-33301290 CCGGCGACCCCAAACCACTCCCT 0: 1
1: 0
2: 0
3: 19
4: 248
Right 1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG 0: 1
1: 2
2: 1
3: 22
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165079927 Original CRISPR CGCCGGAGGCTGGCCCAGGG CGG Exonic
900146409 1:1160753-1160775 CTCCTGAGGGTGGCCCTGGGAGG - Intergenic
900358935 1:2278734-2278756 TGCTGGAGGCTGCCCCAGGCTGG + Intronic
900360082 1:2284163-2284185 CCCCAGAGGCCGGCCCTGGGGGG + Intronic
900362988 1:2298905-2298927 CCCCGGAGTCTTGCCCTGGGGGG + Intronic
900969249 1:5980370-5980392 TGCAGCAGGCTGGGCCAGGGAGG + Intronic
901061977 1:6475747-6475769 CCCTGGAGGCTGGCCCAGGCTGG + Intronic
901148644 1:7085727-7085749 CGGCAGAGGCTGCCCCATGGGGG - Intronic
901217123 1:7561133-7561155 GGCCAGGGGCTGGCCGAGGGGGG + Intronic
901381776 1:8878992-8879014 CTCCGGGGGATGGCCCGGGGCGG + Intronic
901676466 1:10888733-10888755 CGCCGGGGGGTGGGGCAGGGCGG - Intergenic
902478211 1:16699121-16699143 CGTGGGAGGCAGGCCCAGAGAGG + Intergenic
903361363 1:22779315-22779337 CACTGGGGGCTGGCACAGGGAGG - Intronic
904199765 1:28812200-28812222 CGCCGGGGGCTGGGCCGGTGCGG + Exonic
904246973 1:29194675-29194697 CGCAGGAGGCAGGCCCAGGAAGG - Intronic
905663750 1:39749114-39749136 CGAGGGAGGCTGGGCAAGGGTGG + Intronic
905789915 1:40784264-40784286 AGCCGGAGCCCGGCCCAGGGAGG - Exonic
906719693 1:47996552-47996574 CGCCCGAGGCTGCGCCCGGGGGG + Intronic
906805645 1:48776838-48776860 CGCCGGGGGCGGGCCCCGGTCGG + Exonic
907700320 1:56780294-56780316 TGAGGGAGGCTGGCCTAGGGTGG - Intronic
907857886 1:58321689-58321711 GGCAGCAGCCTGGCCCAGGGAGG + Intronic
908271385 1:62425688-62425710 CTCAGGAGGCTGGGGCAGGGAGG + Intergenic
911707042 1:101025919-101025941 CGCCGGCTGCTGGGGCAGGGCGG + Intronic
913110117 1:115649977-115649999 CAAAGGAGGCTGGCCCTGGGTGG + Intronic
913209507 1:116571067-116571089 CGCCGGCTGCCAGCCCAGGGCGG - Intergenic
914803163 1:150974762-150974784 CGCCGGCGGCTGGCGGAGGAGGG - Exonic
915734723 1:158077539-158077561 AGCCCAAGGCAGGCCCAGGGAGG - Intronic
915972928 1:160366891-160366913 GGGCGGGGGCTGGCCCTGGGTGG - Intergenic
916797342 1:168179213-168179235 GGCCGGTTGCTGGCCCAGGGCGG + Intronic
917456869 1:175193030-175193052 CGAGGTGGGCTGGCCCAGGGTGG - Intergenic
917974942 1:180232529-180232551 CCCCCCAGGGTGGCCCAGGGAGG + Intronic
918066488 1:181105286-181105308 CGCCCGCGGCTGCCCCAGTGAGG + Intergenic
1063291675 10:4756105-4756127 CACCGGAGCCTGTCGCAGGGTGG - Intergenic
1063387466 10:5625047-5625069 CGCCGGAGGGTGGCTGACGGCGG - Intergenic
1065611535 10:27475998-27476020 AGCCTGAGGCAGGCCCAGGTGGG + Intergenic
1067732264 10:48820748-48820770 AGCTGGAGCCTGGCCCAAGGGGG + Intronic
1069635092 10:69920130-69920152 AGCCTGAGGCTGGCCAAGAGGGG - Intronic
1070103896 10:73414061-73414083 AGCCGGGGGCGGGCCCAGGGTGG + Exonic
1070918147 10:80167992-80168014 GGCTGGAGGATGGCACAGGGTGG + Intronic
1072326239 10:94301505-94301527 CTTGGGAGGCTGGCCCTGGGAGG - Intronic
1072591496 10:96832271-96832293 CGGCGGAGGCTGGGCCGGGCGGG + Intronic
1073036169 10:100565485-100565507 TGCCAGAGCCTGGCCCAGGAGGG + Intergenic
1073084580 10:100879981-100880003 GGCCTGAGGCCAGCCCAGGGTGG - Intergenic
1073461593 10:103668750-103668772 CGCCCGCGGCTGGCCGAGCGCGG - Intronic
1075811413 10:125227441-125227463 CTCAGGAGGATGGCCCCGGGGGG + Intergenic
1076055683 10:127370387-127370409 AGCAGGAGGCTGGGCCAGGGTGG - Intronic
1076841894 10:133049947-133049969 CTCGGGAGGCGGGCCCATGGTGG - Intergenic
1077092549 11:786310-786332 CGAGGGAGGCTGTCGCAGGGCGG + Intergenic
1077433548 11:2527566-2527588 GGCTGGTGGCTGCCCCAGGGCGG - Intronic
1077557374 11:3232110-3232132 CGCAGGTGGCTGGATCAGGGTGG - Intronic
1077582046 11:3423002-3423024 CTCAGGAGGCGGGGCCAGGGCGG + Intergenic
1077582090 11:3423153-3423175 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1077635750 11:3840688-3840710 CGGCGGAGGCTCGGCGAGGGTGG - Intronic
1078057591 11:8019804-8019826 GGACCGAGGCTGGCCCCGGGCGG + Intronic
1078089331 11:8254621-8254643 CCACCGAGGCTGGCCCTGGGAGG + Intronic
1078771860 11:14358919-14358941 CCCCGGAGCCGGGCCTAGGGCGG - Exonic
1079294604 11:19221738-19221760 CCCGGGGGGCTGGCCCAGGCTGG + Intergenic
1079350117 11:19685116-19685138 CGCTGGAGGCTGGCCCAGGGTGG - Intronic
1080779878 11:35419841-35419863 CGCCAGGGGCTGCTCCAGGGAGG - Intronic
1081654871 11:44850466-44850488 GGCCGGAGGATGGCACAGAGGGG + Intronic
1083264895 11:61542156-61542178 GGCAGGAGGCTGGGTCAGGGAGG + Intronic
1083782808 11:64926744-64926766 AGCCGGAAGCTGGCCCAGTGTGG + Exonic
1083836626 11:65273290-65273312 AGACGGAGGGTTGCCCAGGGTGG - Intronic
1084190754 11:67497641-67497663 CTCCGGAGTTTGGCCCAGTGCGG - Exonic
1084238964 11:67805819-67805841 CTCAGGAGGCGGGGCCAGGGCGG + Intergenic
1084239008 11:67805970-67805992 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1084412702 11:69013564-69013586 CGGGGCAGGCTGGCCCAGGAGGG + Intergenic
1084572014 11:69965587-69965609 GGCCAGAGGCTTGCCCCGGGTGG - Intergenic
1084833424 11:71786870-71786892 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1084833470 11:71787021-71787043 CTCAGGAGGCGGGGCCAGGGCGG - Intergenic
1088002518 11:104899444-104899466 GGCTGGAGGCTGGCCTAGGTTGG - Intergenic
1088663871 11:112074656-112074678 GGCCGGAGGCTGAGCCGGGGCGG - Exonic
1088866697 11:113854429-113854451 GGCCTGAGGCTTGCCCAGGCTGG + Intronic
1089250517 11:117156890-117156912 CGCCTGAGGCTGAGGCAGGGAGG + Intronic
1089692990 11:120198151-120198173 CGCTGGAGGCAGGCCTGGGGAGG + Intergenic
1089712476 11:120325505-120325527 CGCCGCAGCCTGGCGCAGGAAGG - Intronic
1090186087 11:124740037-124740059 GGACGAAGGCTGGCGCAGGGCGG - Exonic
1090204127 11:124875550-124875572 CACTGGGGGCTGGGCCAGGGTGG - Exonic
1090228355 11:125084930-125084952 CCCATGAGGCTGGCCCACGGGGG + Intronic
1090654363 11:128831657-128831679 CCTCGGAGGCAGGCACAGGGAGG + Intergenic
1092409696 12:8243599-8243621 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1095098249 12:38159220-38159242 CCCCTGAGCCTGGCCCAGGCGGG + Intergenic
1095951144 12:47782605-47782627 TGCCGGAGGAGGGACCAGGGTGG - Exonic
1096675104 12:53221863-53221885 CGGCTGTGGCTGGGCCAGGGCGG + Intronic
1102461354 12:113101753-113101775 CCCGGGGGCCTGGCCCAGGGTGG - Intronic
1103410847 12:120710509-120710531 CGTCGGCGGCTGGGCCCGGGGGG + Exonic
1103944757 12:124519857-124519879 AGCAGGAGGCTGGCCCAGAGAGG + Intronic
1103972769 12:124682395-124682417 GGCCTCAGGCTGGCTCAGGGAGG + Intergenic
1104602407 12:130162510-130162532 CGGCCGAGGCCGGCGCAGGGAGG + Exonic
1104667432 12:130657425-130657447 AGCCGGAAGCAGGCCCCGGGAGG + Intronic
1104686270 12:130787185-130787207 CGCGGGTGGCCGGCCCAGTGTGG - Intergenic
1104930965 12:132339297-132339319 CGCCGGAGGCTGGCCCAGGTGGG - Intergenic
1107603999 13:42040727-42040749 GGCCGGTGGCTGGCCCCGGGCGG + Intronic
1107835951 13:44412729-44412751 CTCCGGCGACTGACCCAGGGCGG + Intergenic
1114065241 14:19054357-19054379 GGCCTGAGGCTGCCCAAGGGTGG + Intergenic
1114097022 14:19345645-19345667 GGCCTGAGGCTGCCCAAGGGTGG - Intergenic
1114181236 14:20369625-20369647 AGCCGGGAGATGGCCCAGGGTGG - Intronic
1115478264 14:33836734-33836756 TGTTGGAGGCAGGCCCAGGGAGG - Intergenic
1116435025 14:44887064-44887086 CGGCAGGGGCCGGCCCAGGGCGG - Intergenic
1121636204 14:95455441-95455463 CTGCAGAGGCTGGCCCAGGAGGG - Exonic
1124410575 15:29433103-29433125 CGTCGGGGGCTGGCCCAGGCAGG - Intronic
1125521030 15:40347908-40347930 TGCGGGAGGCTGGGGCAGGGAGG + Intergenic
1125546154 15:40507194-40507216 CGCCAGAGTCTGGCGGAGGGCGG - Intergenic
1125578247 15:40769232-40769254 TGCAGGAGGCTGGGCCAGGGAGG - Intronic
1125727530 15:41875680-41875702 CGCAGCAGGCTGGACCTGGGTGG + Intronic
1126787245 15:52187167-52187189 CTCCAGAGCCTGGCCCATGGTGG + Intronic
1127867122 15:63042284-63042306 CGCCGGGGGACGGCACAGGGGGG + Intergenic
1128382173 15:67121195-67121217 CGCCGGAGGGTGACTCAGCGGGG - Intronic
1129016649 15:72474598-72474620 CGGCGGACGCTGGCCGAGGCGGG - Exonic
1129155254 15:73713669-73713691 CAGAGGAGGCTGGGCCAGGGGGG - Exonic
1129217240 15:74107375-74107397 CCCAGCAGGCTGGCCCAGTGTGG + Intronic
1129312530 15:74722676-74722698 CGCCGGCGCCTGGCCCAGAATGG - Exonic
1129467585 15:75732492-75732514 CCCCAGAGCCTGGCGCAGGGTGG - Intergenic
1129691719 15:77717680-77717702 CTCGGGAGCCTGGGCCAGGGCGG + Intronic
1129719629 15:77871097-77871119 CCCCAGAGCCTGGCACAGGGTGG + Intergenic
1129848647 15:78779601-78779623 CCCCGGGTGCAGGCCCAGGGAGG - Intronic
1129853730 15:78810453-78810475 CGTCGGAGGCCGGCCCGGCGGGG + Intronic
1130253276 15:82314345-82314367 CCCCGGGTGCAGGCCCAGGGAGG + Intergenic
1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG + Intronic
1132649108 16:1012565-1012587 AGGCAGAGGCTGGCCGAGGGTGG - Intergenic
1132875405 16:2134959-2134981 GGCTGGAGGCTGGCCACGGGAGG - Intronic
1133264600 16:4575665-4575687 TCCCCAAGGCTGGCCCAGGGTGG + Exonic
1133350669 16:5098382-5098404 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1134519579 16:14912401-14912423 GGCTGGAGGCTGGCCACGGGAGG + Intronic
1134554352 16:15153834-15153856 GGCTGGAGGCTGGCCACGGGAGG - Intergenic
1134707251 16:16311057-16311079 GGCTGGAGGCTGGCCACGGGAGG + Intergenic
1134960290 16:18401068-18401090 GGCTGGAGGCTGGCCACGGGAGG - Intergenic
1136316161 16:29455664-29455686 AGCGGGAGGCGAGCCCAGGGCGG - Exonic
1136430738 16:30195006-30195028 AGCGGGAGGCGAGCCCAGGGCGG - Exonic
1136470160 16:30474333-30474355 CCTCGGGGGCTGCCCCAGGGCGG - Intronic
1137608392 16:49802298-49802320 CTCCTGGGGCTGGCACAGGGAGG - Intronic
1137614749 16:49839488-49839510 CACAGCAGGCAGGCCCAGGGAGG + Intronic
1139484605 16:67248659-67248681 CGCTGCGGGCTGCCCCAGGGGGG + Intronic
1140406748 16:74716548-74716570 CCAGGGAGGCTGGCACAGGGGGG + Exonic
1141570082 16:84928918-84928940 GGTCTGAGGCTGGGCCAGGGAGG - Intergenic
1141814822 16:86402427-86402449 CGCTGGAGGCTGGGCTAGCGTGG + Intergenic
1141889934 16:86919699-86919721 CCGCGGAGTCTGGCCCAGGCTGG + Intergenic
1142483341 17:231694-231716 AGCCAGAGGCTGGCCCTTGGGGG + Intronic
1142683263 17:1562399-1562421 TGCCTGAGGCGGGCCCAGCGGGG - Intronic
1142876298 17:2853653-2853675 CGCGGGAGGCGGGGCCGGGGCGG + Intronic
1142962057 17:3557340-3557362 CTCCCGAGGCTGACCCAGGGAGG - Intronic
1143140504 17:4739598-4739620 CGACGGAGCCGGGCCCAGTGCGG - Exonic
1144753035 17:17663182-17663204 GACAGGAGGGTGGCCCAGGGAGG - Intergenic
1145058829 17:19719777-19719799 CACCGGGGACTGGCCCAGGCTGG + Intergenic
1145765553 17:27456392-27456414 CGGCGGGGGCTGGGTCAGGGCGG - Intergenic
1146158799 17:30547953-30547975 TGCCTGAGGCTCTCCCAGGGTGG + Intergenic
1147596696 17:41722625-41722647 AGCTGGAGGCTGGGCCAGGAGGG + Exonic
1147703536 17:42410802-42410824 CTCGGGAGGCTGAACCAGGGAGG + Intronic
1147919712 17:43908228-43908250 AGCCGGAGGCTGGGCGAAGGCGG - Intronic
1148238872 17:45986794-45986816 GGCAGCAGGCTGGCCGAGGGTGG - Intronic
1148913374 17:50955119-50955141 CACAGGAGGCTGGGCAAGGGTGG + Intergenic
1149664764 17:58357900-58357922 GGCCAGGGGCTGGCTCAGGGAGG + Exonic
1150427377 17:65087086-65087108 AGGCGGGGGCTGGCCTAGGGTGG + Intergenic
1151656840 17:75500134-75500156 CGGCGGTGGCTGGCAAAGGGAGG + Intergenic
1151727421 17:75892961-75892983 CTCTGGAGGCTGGCCTGGGGTGG - Intronic
1152082151 17:78194609-78194631 CGCAGGAGGCTGGCAGAGAGGGG + Intronic
1152758231 17:82096022-82096044 GGCCGAGGGCTGGCCCAGGCAGG - Intronic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1158652293 18:59299009-59299031 CTCCGGAGGCTGGCGCGGAGTGG - Intronic
1158807181 18:60987674-60987696 GGCCTGATGCTGGCCCATGGAGG + Intergenic
1160227657 18:77023754-77023776 CTGGGGAGGCTGGCCCTGGGAGG + Intronic
1160500527 18:79399522-79399544 CGGGAGAGGCAGGCCCAGGGCGG + Intronic
1160891374 19:1380510-1380532 GGCGTGAGGCTGGCACAGGGAGG - Intergenic
1161059368 19:2207406-2207428 CCACAGAGGCCGGCCCAGGGAGG - Intronic
1161270765 19:3388080-3388102 AACAGGAGGCTGGCCCATGGCGG - Intronic
1161321972 19:3645528-3645550 CGCAGGAGGCTAGCCCAGCAGGG - Intronic
1161950173 19:7463510-7463532 CGCCAGCCCCTGGCCCAGGGCGG + Intronic
1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG + Intronic
1162398748 19:10432286-10432308 CGCCCGGGGCTGTCCCTGGGGGG + Intronic
1162445611 19:10720619-10720641 CTCAGGAGGCTGGCCCTGGGAGG + Intronic
1162578563 19:11513776-11513798 GCCAGGAGGCTGGCGCAGGGTGG - Intronic
1163844125 19:19628845-19628867 CGCCGCAGGGAGGCCGAGGGAGG - Exonic
1164595208 19:29527446-29527468 CGGCGAAGGCTAACCCAGGGAGG + Intronic
1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG + Exonic
1165089123 19:33373586-33373608 GGCGGGAGGCGGGCCCACGGTGG - Exonic
1165120826 19:33557286-33557308 GGGCGGTGGCTGGCACAGGGAGG - Intergenic
1165681453 19:37779699-37779721 CGCCGGACGCTGGCTCCCGGAGG + Intronic
1166389638 19:42401859-42401881 CGCCGGAGCCGGGCCGAGCGGGG - Exonic
1166667463 19:44689604-44689626 GGCGGGAGGCTGGGGCAGGGAGG - Intergenic
1166875761 19:45896349-45896371 TGCTGGTGGCTGGCCCAGGGAGG - Intronic
1167017527 19:46850724-46850746 CGCCGGGGACTGGCGGAGGGGGG - Intronic
1167455947 19:49596801-49596823 CGCGGGTGGCTGGCTCAAGGAGG - Exonic
1168413948 19:56157123-56157145 AGCTGGAGGGTGGTCCAGGGTGG + Intronic
1202712232 1_KI270714v1_random:24949-24971 CGTGGGAGGCAGGCCCAGAGAGG + Intergenic
931052301 2:58428473-58428495 CGCCGGCCGCGGGCCCGGGGCGG + Intergenic
931711078 2:64989405-64989427 AGCCGGCGGCTGCTCCAGGGAGG + Exonic
932593317 2:73079879-73079901 CGGTGGTGGCTGGCCCAAGGCGG + Intronic
934514493 2:94977727-94977749 TGCTGGAGCCTGGCCCAGGTTGG - Intergenic
934567419 2:95348262-95348284 GGCCGGATGCTGGCCCTGGCAGG + Intronic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
934946232 2:98543911-98543933 CGCCGGAGGCTCTCCCAGCAAGG - Exonic
935165091 2:100563152-100563174 CGCCGGAGCTTCCCCCAGGGCGG - Intronic
935855031 2:107264273-107264295 CTCCTGAGGCTGGCCCAGCTCGG + Intergenic
936083767 2:109452887-109452909 CCCAGGAGGCTGGTCCCGGGAGG + Intronic
937081470 2:119143183-119143205 CCCCGGGGCCTGGGCCAGGGCGG + Intergenic
937217751 2:120323511-120323533 CCACGGAGGCTGGCCCATGCTGG - Intergenic
938732184 2:134155214-134155236 GGCAGGAGCCTGGGCCAGGGTGG - Intronic
942278124 2:174337046-174337068 CGCCGCAGGCTCGCCCCGGCCGG - Exonic
942890263 2:180980280-180980302 CCCCGGAGGCGGGCCCAGGCCGG + Intronic
945067219 2:205957349-205957371 AGCTTGAGGCTGTCCCAGGGCGG + Intergenic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
946747376 2:222860079-222860101 AGCCTGAGGCTGGCTCAGGAAGG + Intergenic
947635732 2:231680074-231680096 GGCAGAGGGCTGGCCCAGGGAGG - Intergenic
948505722 2:238426084-238426106 CTGCTGAGGCTGGCCCTGGGTGG - Intergenic
948912600 2:241011927-241011949 CGCTGGGGGCTGAGCCAGGGAGG - Intronic
949014272 2:241701059-241701081 CTCCGGAGGCTGAGCCCGGGAGG - Intergenic
1170548154 20:17452640-17452662 CTCCACAGCCTGGCCCAGGGTGG - Intronic
1171173582 20:23035402-23035424 CTCGGGCGGCGGGCCCAGGGCGG - Exonic
1172114377 20:32564932-32564954 CCAGGAAGGCTGGCCCAGGGAGG + Intronic
1172118239 20:32583983-32584005 CACCCGGGGCTGGCCCGGGGAGG - Intronic
1174339714 20:49888150-49888172 GAGCGGAGGCTGGCTCAGGGAGG - Exonic
1174420386 20:50395587-50395609 GGCCCCAGGCTGGCCCAGGGTGG + Intergenic
1175199230 20:57266538-57266560 CGCCGGAGGTTGGAAGAGGGTGG - Exonic
1175856180 20:62122225-62122247 CGCCGGGAGCCGGCCGAGGGTGG + Intergenic
1176100631 20:63362881-63362903 CCCAGGAGGCTGTCCCAGTGAGG - Intronic
1176122556 20:63460645-63460667 GGACGCAGGCTGGCCCAGGAGGG - Intronic
1176147567 20:63572275-63572297 CCCAGGGGGCTGGCCAAGGGGGG + Exonic
1176295013 21:5067165-5067187 AGCCAGACGCTGGCCCAGTGGGG + Intergenic
1176411462 21:6451529-6451551 CTCCGGAGGCGGTACCAGGGCGG - Intergenic
1179686955 21:43059851-43059873 CTCCGGAGGCGGTACCAGGGCGG - Intronic
1179783874 21:43719069-43719091 CGCCGGGGGCTGGCCGGGGGCGG - Intergenic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180051153 21:45331614-45331636 CAGCAGAGGGTGGCCCAGGGAGG + Intergenic
1180095188 21:45553115-45553137 CGCTGGAGGCTGGGCCTGGAGGG + Intergenic
1180483730 22:15776977-15776999 GGCCTGAGGCTGCCCAAGGGTGG + Intergenic
1180726570 22:17950995-17951017 GGTAGGAGACTGGCCCAGGGTGG - Intronic
1182475546 22:30574659-30574681 CGCCGGAGGCTGGGCCAGGCTGG - Intergenic
1182585402 22:31341870-31341892 CCCTGGAGGATGACCCAGGGTGG - Intronic
1183688376 22:39374881-39374903 CTCATGAGGCTGCCCCAGGGAGG - Intronic
1184125281 22:42482444-42482466 TGGGGGAGGCTGGGCCAGGGAGG - Intergenic
1184133767 22:42533904-42533926 TGGGGGAGGCTGGGCCAGGGAGG - Intergenic
1184444173 22:44537682-44537704 AGCCAGAGGCGGGCGCAGGGAGG + Intergenic
1184693982 22:46129789-46129811 GGCAGGAGGCTGGCACTGGGAGG - Intergenic
1184831815 22:46993715-46993737 CGCAGCAGCCTGTCCCAGGGAGG - Intronic
1184853504 22:47134380-47134402 GGCCTGAGGGTGGGCCAGGGTGG + Intronic
1185045705 22:48527739-48527761 CGACAGAGGCTGACCCAGGAAGG - Intronic
1185162000 22:49235668-49235690 CGCCGGAGGCAGCCCCGCGGGGG + Intergenic
1185409383 22:50674294-50674316 CGCCGGAGGCGGGGGCCGGGAGG - Intergenic
952908844 3:38165449-38165471 GGCCGGAGGCGGGCCCGAGGTGG + Intronic
953871382 3:46630120-46630142 CGCCGGAGGGAGGCCCAGCCAGG - Intergenic
954717552 3:52533967-52533989 CGCCGGAGACTGGCTGGGGGAGG - Intronic
955412751 3:58666664-58666686 TGTCAGAAGCTGGCCCAGGGTGG - Exonic
956740169 3:72269527-72269549 TGGCTTAGGCTGGCCCAGGGAGG - Intergenic
957054935 3:75435729-75435751 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
958732235 3:97972166-97972188 CCCCGGAGACTGGGGCAGGGTGG - Exonic
961299903 3:125915945-125915967 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
961299943 3:125916096-125916118 CTCAGGAGGCGGGGCCAGGGCGG - Intergenic
961827595 3:129606906-129606928 CGGCGGGGCGTGGCCCAGGGCGG - Intergenic
961888607 3:130112128-130112150 CTCAGGAGGCGGGCCCTGGGAGG + Intronic
968090554 3:195895937-195895959 CGCGGGAGGCGGGCGCTGGGAGG - Intronic
968997706 4:3955885-3955907 CTCAGGAGGCGGGGCCAGGGTGG + Intergenic
968997750 4:3956035-3956057 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
969523270 4:7691258-7691280 AGCTGGGGCCTGGCCCAGGGTGG + Intronic
969532243 4:7736521-7736543 TGAAGGAGCCTGGCCCAGGGCGG + Intronic
969717070 4:8872909-8872931 GGCCCGGGGCTGGCCCTGGGAGG - Intergenic
969718846 4:8882049-8882071 CGCTGGTGGAAGGCCCAGGGGGG - Intergenic
970009824 4:11446886-11446908 CTCAGGAGGCTGGACCTGGGAGG + Intergenic
972671969 4:41221148-41221170 CGAGGGAGGCTGAGCCAGGGAGG - Intergenic
974047848 4:56912459-56912481 CTCGGGAGGCTGAGCCAGGGAGG - Intronic
975560861 4:75707082-75707104 CTCGGGAGGCTGGGGCAGGGAGG + Intronic
975801068 4:78059115-78059137 CGGCGGCGGCGGGCGCAGGGCGG + Intronic
979180961 4:117726602-117726624 CACCGGAGCCTGTCGCAGGGTGG + Intergenic
984206358 4:176792431-176792453 CGCCTCCGGCTCGCCCAGGGGGG - Exonic
985588007 5:750923-750945 CGCGGGAGGCAGGCTCGGGGAGG - Intronic
985602676 5:843390-843412 CGCGGGAGGCAGGCTCGGGGAGG - Intronic
985611630 5:892663-892685 CGCCGGCGGCGGGCCCGAGGCGG + Exonic
985733894 5:1566245-1566267 CCCCGGAGGATGGCCAGGGGCGG + Intergenic
986038325 5:3962079-3962101 CGGTGCATGCTGGCCCAGGGTGG - Intergenic
991300909 5:65128422-65128444 CTCCACAGGCTGGCCCAGAGCGG - Intergenic
991675444 5:69086097-69086119 CGCGGGAGGCTGGCTGAGGTGGG - Intergenic
993641321 5:90409589-90409611 CCCCGGAGCGGGGCCCAGGGAGG - Intronic
994072736 5:95620479-95620501 CGGCGGCGGCGGGCCCTGGGCGG + Exonic
996937404 5:128965179-128965201 GGCCGGACGCGCGCCCAGGGAGG + Exonic
997950915 5:138241964-138241986 CGCCGGAGCTGGGCCCAGGGCGG - Intergenic
999252787 5:150192546-150192568 CCCAGGAGGCTGGCACAGTGAGG - Intronic
1002091733 5:176810321-176810343 TGCCTGAGGCTCCCCCAGGGAGG - Intergenic
1002305118 5:178278644-178278666 TGGCGGAGGCTGGCCCAGGAGGG - Intronic
1003114108 6:3271963-3271985 AGCAGGAAGCTGGCCCAGGAAGG + Exonic
1005937018 6:30530894-30530916 CTTGGGAGGCTGGGCCAGGGAGG - Intergenic
1006029631 6:31169950-31169972 AGTCGGAAGCTGGCCCAGGCTGG - Intronic
1006047187 6:31308095-31308117 AGCCGGAGGCGGGGCCAGGGAGG + Intronic
1007253841 6:40514958-40514980 CCCAGGTGGCTGGCCCAGGGTGG - Intronic
1007764455 6:44152556-44152578 GGCAGGAGGATGGCTCAGGGAGG - Intronic
1017774593 6:157670879-157670901 GGCTGGAGGGTGGCTCAGGGTGG + Intronic
1017807056 6:157955028-157955050 CGTGGGAGGCAGTCCCAGGGAGG + Intergenic
1017834901 6:158168274-158168296 GGCGGGAGGCGGGCCCAGAGCGG - Intergenic
1017929530 6:158939707-158939729 GCCCGGAGGCTGACCCAGGTGGG - Intergenic
1018708450 6:166479569-166479591 CGCCAGGGGGTGGCCCAAGGTGG + Intronic
1018754716 6:166839001-166839023 CTCTGGAGGCTGGCACAGGCAGG + Intronic
1019365512 7:630611-630633 CGGGTGAGGCTGGCCCCGGGGGG + Intronic
1019663873 7:2241859-2241881 CGCCGGGGGCGAGCCCGGGGCGG - Intronic
1020283699 7:6664284-6664306 CCTCGGAGGAGGGCCCAGGGCGG - Intergenic
1021973287 7:25985525-25985547 AGAGTGAGGCTGGCCCAGGGTGG - Intergenic
1025086175 7:56025365-56025387 CTCAGGAGGCTGAGCCAGGGAGG - Intronic
1025692980 7:63761491-63761513 CGCGGGAGCCTGGCCCGAGGAGG - Intergenic
1026795530 7:73363963-73363985 CGGAGGAGGCTGGCTCAGAGGGG + Intergenic
1029432263 7:100539116-100539138 AACCGGAGGCCGTCCCAGGGAGG + Intergenic
1034441163 7:151086703-151086725 GGCCCGAGGCGGGCCCGGGGCGG - Intronic
1034464619 7:151219363-151219385 CGCTGGAGCCTGGCCCTGGCTGG - Intronic
1035404258 7:158587835-158587857 CGCCGGGGGCGGGGCCGGGGCGG - Intergenic
1036379495 8:8227925-8227947 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1036633539 8:10531904-10531926 CGTCAGAGCCTAGCCCAGGGTGG - Intronic
1036850064 8:12194688-12194710 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1036871428 8:12436961-12436983 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1037872475 8:22511377-22511399 CTCGGGAGGCTGAACCAGGGAGG - Intronic
1037884361 8:22588667-22588689 TGCCTGAGTGTGGCCCAGGGAGG + Intronic
1039155322 8:34549522-34549544 AGACGGAGTCTGGCCCAGGCTGG + Intergenic
1040296437 8:46151471-46151493 CCCTGGACTCTGGCCCAGGGAGG - Intergenic
1040318459 8:46277151-46277173 CCCCAGACTCTGGCCCAGGGTGG - Intergenic
1040481602 8:47832132-47832154 CTCCAGAGGGAGGCCCAGGGAGG + Intronic
1044336009 8:90985305-90985327 GGCACGAGGCGGGCCCAGGGCGG + Intergenic
1045098792 8:98825523-98825545 CGCCGGCGGCTGCTCCATGGCGG + Intronic
1048455627 8:134575674-134575696 CTCCAGAGGCAGGCCCAGGCTGG - Intronic
1049414944 8:142490862-142490884 CGTGGGAGGCTGGCCCAGTAGGG + Intronic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1053157542 9:35791520-35791542 CGCCGGAGGGTGGGGCCGGGAGG + Intergenic
1053381155 9:37650736-37650758 CGGCGGAGGCAGGGCCCGGGTGG + Intronic
1053446137 9:38154679-38154701 AGCACGAGGCTGGCCCTGGGGGG - Intergenic
1056634518 9:88320574-88320596 CCCCTGGGGCTGGCCCAGGCAGG - Intergenic
1056684403 9:88747511-88747533 AGCCAGAGGCTGGCCATGGGTGG + Intergenic
1060106534 9:120876626-120876648 CGCCGGGGCCTCTCCCAGGGCGG + Intronic
1060770124 9:126326663-126326685 CGCCCGAGGCTGGCTCGGGCGGG - Intergenic
1061045662 9:128163649-128163671 GGCCAGAGCCTAGCCCAGGGAGG - Exonic
1062025441 9:134338200-134338222 AGCCAGAGGGAGGCCCAGGGAGG - Intronic
1062126143 9:134864085-134864107 CCCTGCATGCTGGCCCAGGGAGG + Intergenic
1187900793 X:24025430-24025452 CGCCCGGGGCCCGCCCAGGGAGG + Intronic
1194977680 X:100410212-100410234 CGGCGGCGGCTGGCGCAGCGCGG - Exonic
1196791408 X:119468366-119468388 CGTCGGAGGCGGGGCCGGGGCGG - Intergenic
1196909228 X:120468961-120468983 CGGCGGCGGTTGGCCCGGGGAGG - Intronic
1197869225 X:131050023-131050045 CCCCAGAGCCTGGCCCAGTGAGG + Intergenic
1198750487 X:139932758-139932780 GGCCGTCGGCTGGCTCAGGGCGG - Intronic
1200047160 X:153409153-153409175 TGCCCTAGGCTGGCCCAGGACGG - Intergenic
1200079995 X:153571577-153571599 AGCAAGAGGCTGCCCCAGGGAGG - Intronic
1200152460 X:153957954-153957976 CTCCTGGAGCTGGCCCAGGGCGG + Intronic
1200247507 X:154533993-154534015 CCTGGGAGGCTGGCACAGGGTGG - Intronic
1200859964 Y:7980209-7980231 CACCTGAGGTTGGCCCAGGTGGG + Intergenic