ID: 1165080011

View in Genome Browser
Species Human (GRCh38)
Location 19:33301714-33301736
Sequence CTGGGCACGGGCGTGGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 590}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165079992_1165080011 25 Left 1165079992 19:33301666-33301688 CCAGGGCCCGGCAGGCCGGCGGC 0: 1
1: 0
2: 7
3: 46
4: 433
Right 1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG 0: 1
1: 0
2: 3
3: 57
4: 590
1165079994_1165080011 18 Left 1165079994 19:33301673-33301695 CCGGCAGGCCGGCGGCACCGAGC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG 0: 1
1: 0
2: 3
3: 57
4: 590
1165079993_1165080011 19 Left 1165079993 19:33301672-33301694 CCCGGCAGGCCGGCGGCACCGAG 0: 1
1: 0
2: 2
3: 32
4: 169
Right 1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG 0: 1
1: 0
2: 3
3: 57
4: 590
1165080001_1165080011 1 Left 1165080001 19:33301690-33301712 CCGAGCGCGGGCGCGGGGTGCGG 0: 1
1: 1
2: 3
3: 17
4: 211
Right 1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG 0: 1
1: 0
2: 3
3: 57
4: 590
1165079997_1165080011 10 Left 1165079997 19:33301681-33301703 CCGGCGGCACCGAGCGCGGGCGC 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG 0: 1
1: 0
2: 3
3: 57
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165080011 Original CRISPR CTGGGCACGGGCGTGGGCGG CGG Exonic
900192384 1:1356916-1356938 CAGGGCATGGGCGTGGGCCAGGG + Intronic
900349401 1:2227678-2227700 CTGGGCGCGGGCGGAGGCGGAGG - Intergenic
900365396 1:2309992-2310014 TGGGGCACGGGCAGGGGCGGGGG - Exonic
900365752 1:2311317-2311339 GTGGGCAGGGGCGTGGGCCGAGG + Intergenic
900557570 1:3287998-3288020 CTGGGCTCAGGGGTGGGCGGAGG + Intronic
900936221 1:5767952-5767974 CTGGGCAGAGGTGTGGGCAGAGG - Intergenic
901215752 1:7554432-7554454 CTGGGCACGGGAGGGGAAGGTGG - Intronic
901624800 1:10617825-10617847 GGGGGCACGGGGGTGGGCTGTGG - Intronic
901724097 1:11226920-11226942 GTGGGCGGGGGCGGGGGCGGGGG - Intronic
902918102 1:19650876-19650898 CTGGGCAGGAGGGTGGGCGGAGG + Intronic
902988565 1:20170734-20170756 CAGGGCACTAGCGTGGGAGGAGG - Intronic
903044482 1:20554625-20554647 CAGGGCAGAGGCGTGGGCAGCGG - Exonic
903954062 1:27012741-27012763 CTGGGCAGGGGCCAAGGCGGGGG + Exonic
904035701 1:27557377-27557399 CTGGGGAAGGAGGTGGGCGGGGG - Intronic
904287712 1:29462698-29462720 CTGGGCAGGGGCAAGGGCTGGGG + Intergenic
904418640 1:30377636-30377658 CTGGGCAGGGGTGAGGGCAGGGG - Intergenic
904467821 1:30718595-30718617 CAGGGCAGGGGCGGGGCCGGGGG - Intronic
904720539 1:32504542-32504564 CTGGGCATGGCCGGGCGCGGTGG + Intronic
905037949 1:34929705-34929727 CTGCGCGGGGGCGGGGGCGGGGG - Intergenic
905416622 1:37808428-37808450 CTGGTCACGGGGGTGAGAGGGGG + Exonic
905449115 1:38046034-38046056 CTGCACCCGGGCGCGGGCGGCGG - Exonic
905716068 1:40150942-40150964 CTGGGCATGGTGGTGGGCGCCGG + Intergenic
905789821 1:40784042-40784064 CCGGGCACGGTCCGGGGCGGGGG - Exonic
906615653 1:47231347-47231369 CTGGGGGCGGGAGTGGGGGGAGG - Intronic
906962453 1:50426777-50426799 CTGGGCGTGGGCGTGGGGGATGG - Intergenic
907305324 1:53509857-53509879 CTGGGCAGAGGCGGGGGTGGAGG + Exonic
907929998 1:58990519-58990541 GTGGGCAGGGGCGGGGGCAGGGG - Intergenic
908534687 1:65066872-65066894 CTGGACGCGGGCGGGGGCGGGGG + Intergenic
911017070 1:93345444-93345466 CTGGGCTTGGGGGTGGGAGGTGG - Intergenic
912301955 1:108526925-108526947 GTGGGCTGGGGCGGGGGCGGGGG - Intergenic
912625741 1:111203831-111203853 CTGGGCAGGGGCAGGGGCGCTGG + Intronic
912687656 1:111779694-111779716 CTGGGCAGGGGTGGGGGTGGGGG + Intronic
913113717 1:115678336-115678358 CTGGGCACGGACAGTGGCGGAGG + Intronic
914847613 1:151291641-151291663 TTGGGCGGGGGCGGGGGCGGGGG - Exonic
915362673 1:155295357-155295379 TTGGGCCCAGGCGTGGGCAGGGG - Intronic
915615007 1:157030937-157030959 GTGGGCCAGGGCGGGGGCGGGGG - Intronic
916651666 1:166839609-166839631 GTGCGCGCGGGCGGGGGCGGCGG + Intronic
916656793 1:166884079-166884101 CTGGGCAGGTGCCTGGGTGGCGG - Intergenic
916738754 1:167630330-167630352 CTGGCCACGGCCGGGAGCGGAGG + Exonic
918371173 1:183863062-183863084 CTTGGCACAGGTGTGGGAGGAGG + Intronic
918629492 1:186699258-186699280 CTGGGCCCGGCCGGGCGCGGTGG + Intergenic
919548095 1:198949112-198949134 CAGGGCAAGGGCCTGGGCGGAGG + Intergenic
920385632 1:205568905-205568927 TTGGGCCCGGGCGGCGGCGGGGG - Intronic
920697409 1:208191852-208191874 CTGGGCACGGGGCAGGGCGAGGG + Intronic
921029703 1:211326766-211326788 CGGGGCCGGGGCGCGGGCGGAGG - Intronic
921432850 1:215083199-215083221 CTGGACGCGGGAGGGGGCGGGGG - Intronic
922419826 1:225452068-225452090 GTGGGCGCGGGCGTGGGCAGCGG - Intergenic
922727032 1:227927403-227927425 CTGGACACTGCCGTGGGCTGAGG + Intronic
923008002 1:230067371-230067393 CTGGCCGGGGGCGCGGGCGGCGG + Exonic
923176116 1:231467196-231467218 CTGGGCACGGCTGGGTGCGGTGG - Intergenic
923400777 1:233614073-233614095 CCAGGCCCGGGCGGGGGCGGGGG + Exonic
923400781 1:233614079-233614101 CCGGGCGGGGGCGGGGGCGGCGG + Exonic
923542612 1:234899359-234899381 CTGGGCATGGGGGTGGGGGTAGG - Intergenic
923631150 1:235650098-235650120 CCGGGCTGGGGCGGGGGCGGGGG - Intronic
1062907257 10:1187343-1187365 CTGGTGACGGGAGTGGGAGGAGG - Intronic
1063115124 10:3067482-3067504 CTGGGGCCGGGCGGGGGCGCGGG + Intronic
1063613488 10:7582836-7582858 CTGGGCAGGGTAGTGGGGGGTGG + Intronic
1064138942 10:12774052-12774074 CTGGGCACTGGTGCGGGGGGAGG + Intronic
1064245681 10:13666048-13666070 CGGGGCCCGGGCGTGGGAGTGGG + Intronic
1064443185 10:15371314-15371336 CTGGGCGCGGGCAGCGGCGGCGG - Intergenic
1065025389 10:21535110-21535132 CTGGGCCGGGGTGGGGGCGGGGG + Intronic
1065520575 10:26567297-26567319 GCGGGCGCGGGCGCGGGCGGCGG - Exonic
1067079007 10:43203258-43203280 TGGGGCACGGGCGGGGGCAGGGG - Intronic
1067168388 10:43883580-43883602 CTGGGCATGGGTCTGGGCCGGGG + Intergenic
1067344434 10:45427558-45427580 CTGCGCGCGGGCGCGGTCGGTGG + Intronic
1067531926 10:47080500-47080522 CTGGGCATGGGGGAGGGCTGAGG - Intergenic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1071265224 10:83958520-83958542 CTGGGCACGGGCCTGAGGGCAGG + Intergenic
1072576601 10:96706178-96706200 CTGGGCATGGCCGGGAGCGGTGG - Intronic
1072791825 10:98323428-98323450 CTGGCCACAGGCGGGGGTGGAGG - Intergenic
1073043238 10:100621502-100621524 CTGGGCGGGGGCGGGGGCGGGGG - Intergenic
1073057950 10:100714056-100714078 AGGGGCACTGGCGGGGGCGGGGG + Intergenic
1074886771 10:117700124-117700146 CTGGGCACTGGCCTTGGTGGAGG - Intergenic
1075207076 10:120457177-120457199 CAGGCCGCGGGCGGGGGCGGAGG - Exonic
1075922731 10:126226334-126226356 GTGGGCATGGGCGTGGCTGGTGG + Intronic
1076639085 10:131901521-131901543 CGGGGCACGGGCGGAGGCGTCGG + Intronic
1076866472 10:133168780-133168802 CTGGGTATGGGCGTGGGCATGGG + Intronic
1076878674 10:133229840-133229862 CTGAGCCCGGGCGGGGGCGGCGG + Intergenic
1077018478 11:407186-407208 CGGCGCAGGGGCGGGGGCGGGGG + Intronic
1077037942 11:504273-504295 CTCGACGCGGGCGCGGGCGGGGG - Intronic
1077047958 11:554543-554565 GCGGGCACGGGGGTGGGGGGTGG + Exonic
1077214542 11:1389987-1390009 CGGGGCGCGGGCCTCGGCGGCGG + Intronic
1077231861 11:1461319-1461341 CGGGGCACGGGCCTGCGAGGAGG - Exonic
1077287279 11:1773147-1773169 CTGGGCACAGGTGGGGGAGGGGG + Intergenic
1077338035 11:2014129-2014151 CTGGGGTCCGGCGTGGGCAGGGG + Intergenic
1077390879 11:2300189-2300211 TTGGGCAGGGGCGTGTGGGGTGG + Intronic
1077419726 11:2444709-2444731 GTGGGCTCGGGCGGGGGTGGGGG + Intronic
1077637882 11:3855727-3855749 CTGGGCACGGGACTGGGCGGGGG + Exonic
1077917546 11:6621379-6621401 CTGGGCAGGGGCAGGGGCAGGGG + Exonic
1078516568 11:12027754-12027776 CTGGGCACGTGCCTGAGAGGTGG - Intergenic
1080805676 11:35651074-35651096 CTGGGCACAGGGGTAGGCAGTGG + Intergenic
1081981707 11:47270497-47270519 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1082743540 11:56937812-56937834 CTGGGGACGGTGGTGGGTGGGGG - Intergenic
1083595547 11:63916960-63916982 CGGGGCACCGGCGGCGGCGGCGG + Intergenic
1083624768 11:64066910-64066932 CTGGGCTGGGGCGTGGGCTCCGG - Intronic
1083634053 11:64110645-64110667 CGGGCCACGGGGGTGGGCGAAGG - Intronic
1083683454 11:64361794-64361816 CTGGGCAGGGCTGTGGGTGGGGG + Intronic
1083891855 11:65599543-65599565 CAGGGCGCGGGCGTTGGCGTGGG + Exonic
1084000944 11:66295216-66295238 CTGGGCACGGCCCCCGGCGGGGG - Exonic
1084086389 11:66857163-66857185 ATGGGCCCGAGGGTGGGCGGCGG + Intronic
1084517054 11:69642858-69642880 CTGGGGACGCGCGGGGGAGGGGG + Intronic
1084591760 11:70094395-70094417 CTGGGCACTGGCAGGGGCTGGGG + Intronic
1084938000 11:72597473-72597495 CTGGGCAGGGGCAGGGGCAGGGG - Intronic
1085284534 11:75351412-75351434 CCCGGCAGGGCCGTGGGCGGGGG - Intronic
1087297061 11:96389867-96389889 CGGGGCAGGGGCGGAGGCGGAGG - Intronic
1088067460 11:105738006-105738028 CAGGGCAGGGGGGTGGGAGGGGG - Intronic
1088481096 11:110296770-110296792 CTGGCTCCGGGCGTGGCCGGGGG + Intergenic
1088807775 11:113367713-113367735 TTGGTGACGGGGGTGGGCGGTGG + Intronic
1089499323 11:118923293-118923315 CTGGGCAGGGGCCTAGGGGGTGG - Intronic
1089667328 11:120028843-120028865 CAGGGCACTGGCGTTGGGGGAGG - Intergenic
1090699074 11:129278915-129278937 CGGGGCGCGGGCGCGGGAGGCGG + Intronic
1202821019 11_KI270721v1_random:69311-69333 CTGGGGTCCGGCGTGGGCAGGGG + Intergenic
1091434230 12:460569-460591 AAGGGCGCGGGGGTGGGCGGCGG + Intronic
1091724635 12:2837188-2837210 CTGGGCATGGCCGGGCGCGGTGG + Intronic
1091766078 12:3120668-3120690 CTTGGCACGGGCCTGGGCCAGGG + Intronic
1091844576 12:3645981-3646003 TTGGGCACGGGGGTAGGGGGTGG + Intronic
1092229050 12:6766747-6766769 CAAGGTACGGGCGGGGGCGGCGG + Exonic
1092727681 12:11500719-11500741 CTGGGCCCCGGCGGTGGCGGCGG - Intronic
1092899496 12:13044818-13044840 CTGGACCTGGGCGGGGGCGGCGG + Intronic
1092949639 12:13489458-13489480 CTGGGCAGGGGCAGGGGCAGTGG + Intergenic
1095261665 12:40105633-40105655 CAGAGCGCGGGCGCGGGCGGCGG - Exonic
1096313044 12:50538441-50538463 CTGGGCACGGAGGTGGGGTGGGG - Intronic
1096461077 12:51821686-51821708 GCGGGCAGGGGCGTGGGCGCGGG + Intergenic
1096784418 12:54009066-54009088 CGGGGCTGGGGCGCGGGCGGCGG - Intronic
1096843302 12:54391634-54391656 GTGGGCAGGGGAGTGGGGGGGGG + Intergenic
1097222663 12:57460133-57460155 CTGGGCTGGGGGGTGTGCGGTGG - Exonic
1097527858 12:60761615-60761637 CTGGGGACTGTCGTGGGAGGCGG - Intergenic
1101870349 12:108560820-108560842 GTGGGCCCGGGGGTGGGCAGCGG - Intronic
1103828709 12:123762141-123762163 CGGGGCCGGGGCGTGGGCTGCGG + Intergenic
1103908669 12:124340128-124340150 GTGGGCATGGGAGTGGGAGGCGG + Exonic
1103949827 12:124544627-124544649 CTGGGCCCGGGCGGGTGTGGAGG - Intronic
1104376181 12:128267093-128267115 CGGGGCCCGGGCGGGGGCGGGGG + Intergenic
1104893393 12:132150809-132150831 CAGGGCAGGGGAGTGGGGGGTGG - Intronic
1104961583 12:132490638-132490660 CTGGGCGCGGGCGTCGCGGGCGG - Exonic
1105502888 13:20988343-20988365 CGGGGCGGGGGCGGGGGCGGGGG + Exonic
1105814004 13:24016884-24016906 CTGGGCATGAGCCTGGGCGGGGG - Intronic
1105900993 13:24752970-24752992 CTGGGCAGTGGCCTGGGCGAGGG - Intergenic
1106097309 13:26659560-26659582 CTGAGCAGGGGCGTGGATGGAGG + Intronic
1107102249 13:36606246-36606268 CTGGGCTTGGGCTTGGGCTGGGG + Intergenic
1108080545 13:46730439-46730461 CTGGGGATGGGAGAGGGCGGAGG - Intronic
1108587419 13:51882873-51882895 CTGAGCAAGGCCCTGGGCGGAGG - Intergenic
1108771572 13:53708289-53708311 CTGGGGATGGGCGTGGCTGGAGG + Intergenic
1110119631 13:71865878-71865900 GTGGGAAGGGGCGCGGGCGGCGG + Intronic
1110484337 13:76020125-76020147 CTGAGCACAGGCCTGGGGGGTGG + Intergenic
1112216314 13:97434310-97434332 CTGGGCGCCGGCGGCGGCGGCGG - Exonic
1112326050 13:98443527-98443549 CTGGGCACGGGACTGGGGAGAGG - Intronic
1112644845 13:101318345-101318367 CTGGGAACTGGCATGGGCGCCGG + Intronic
1113312034 13:109140998-109141020 CCGGGCGGGGGCGGGGGCGGGGG - Exonic
1113378290 13:109783511-109783533 CTGGGCCCTGGCGTGGCCTGAGG + Exonic
1113589202 13:111486449-111486471 CCAGGCACGGGCCTGGGCAGAGG - Intergenic
1113656005 13:112068115-112068137 GTGGCCATGGGCGTGGGCGTGGG + Exonic
1113656008 13:112068121-112068143 ATGGGCGTGGGCGTGGGCGTGGG + Exonic
1113792143 13:113034636-113034658 CAGGGCAAGGGCGAGGGCGTGGG - Intronic
1113834447 13:113319528-113319550 TTGGGCACGGGTGAGGGCGAGGG - Exonic
1113895831 13:113764123-113764145 ATGGGCCGGGGCGTGGGCGTGGG + Intronic
1114318240 14:21526018-21526040 CTGGGCAGGGGTGGGGGCGGAGG - Intronic
1114458334 14:22871784-22871806 CTGGGCAAGGGCCGGGGCGCCGG + Exonic
1114577134 14:23725641-23725663 CTGGGAAGGGGCCTGGGCAGAGG - Intergenic
1116861792 14:50001333-50001355 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1117871161 14:60201735-60201757 CTGGGAACGATTGTGGGCGGTGG + Intergenic
1117998509 14:61500803-61500825 CTGAGCACGGGGGTGGGATGGGG + Intronic
1119262541 14:73245995-73246017 CTGGGCTCGGGCGGGGCGGGAGG + Intronic
1119984864 14:79126328-79126350 CTGGGGACGGTCGTGGGGTGGGG - Intronic
1120935478 14:89891902-89891924 GTGGGCTCGGGCTTGGGCTGTGG - Intronic
1121648171 14:95535183-95535205 GCGGGCTCGGGCGCGGGCGGCGG + Exonic
1121695779 14:95910742-95910764 CTGGGCATGGGCATGTGTGGAGG + Intergenic
1121872982 14:97426367-97426389 CTGGACAGGGGCATGGTCGGTGG + Intergenic
1122077561 14:99245933-99245955 CTGGGGACCGACGGGGGCGGGGG + Intronic
1122402713 14:101476712-101476734 CTGGGCAGGAGCCTGGGCAGTGG - Intergenic
1122840782 14:104461631-104461653 CGGGGCGGGGGGGTGGGCGGGGG + Intergenic
1122975296 14:105168447-105168469 CCGGGCGCGGGCGGCGGCGGCGG - Exonic
1122975344 14:105168587-105168609 CGGCGCGCGGGCCTGGGCGGCGG + Exonic
1123037768 14:105478374-105478396 CGCGGCGCGGGCGGGGGCGGGGG + Intronic
1123037933 14:105478877-105478899 CTGGGCGCGGGCTGGGGCTGGGG + Intronic
1123037985 14:105479072-105479094 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1123630686 15:22258041-22258063 CTGGGCACGGGCATGGGCTCGGG + Intergenic
1124087139 15:26561415-26561437 GTGGGCAGGGGGGTGGGTGGGGG - Intronic
1124248867 15:28094839-28094861 CTGGGCACGGCTGCGGGAGGCGG - Intronic
1124466033 15:29940877-29940899 CGGGGCAGGGGCGAGGGTGGGGG - Intronic
1124604896 15:31162616-31162638 CTGGGCAGGGATGTGGGAGGAGG + Intergenic
1124629220 15:31327507-31327529 GTGGGCTCGGGGGCGGGCGGCGG - Exonic
1125950292 15:43746239-43746261 CTGGGCCCGGTCCTGGGCTGGGG - Intergenic
1126140116 15:45430516-45430538 CTGGTCACGCGCGTGGGGCGGGG - Intronic
1127103170 15:55588000-55588022 CGAGGCACGGCCGAGGGCGGTGG + Intronic
1127168393 15:56271999-56272021 CTGGGCATGGGGGTGGGCACCGG + Intronic
1128391646 15:67186722-67186744 CTGGGCACTGGGCTGGGTGGAGG - Intronic
1128605385 15:69033070-69033092 GCCGGCGCGGGCGTGGGCGGGGG - Exonic
1129273871 15:74433207-74433229 CCGGGCCGGGGCGGGGGCGGGGG + Intronic
1130622002 15:85473239-85473261 CTGGGCGCGGGTGTGGGGGTGGG + Intronic
1132515166 16:362810-362832 CTTGGCATGGGCCTGGGCGCCGG + Intergenic
1132604523 16:788227-788249 CTTGGCGTGGGCGTGGGCGCGGG - Intronic
1132686683 16:1165125-1165147 CTGGGCCCGGGAGTGGGTGGGGG + Intronic
1132694469 16:1195724-1195746 CTGGGCACAGGTGAGGGAGGTGG + Intronic
1132716013 16:1290152-1290174 GTGGGCAGGGGCGGGGGCTGGGG - Intergenic
1132748657 16:1447362-1447384 CAGGGCATGGGCATGGGCGTGGG - Intronic
1132779410 16:1614444-1614466 GTGGGCAGGGCCGGGGGCGGCGG + Intronic
1132947116 16:2537903-2537925 ATGGGCGCGGGCGTCGGCTGCGG + Intergenic
1132968571 16:2673500-2673522 ATGGGCGCGGGCGGCGGCGGCGG - Intergenic
1133024210 16:2980612-2980634 CTGGCCCGGGGCGTGGGTGGCGG + Intergenic
1133055106 16:3141888-3141910 CTGGAAACGGGAGTGGGAGGGGG - Exonic
1133259381 16:4538446-4538468 CTGGGCGGTGGGGTGGGCGGTGG - Intronic
1134068538 16:11246129-11246151 CTGGGCAGGGGTGTGGGGGCAGG - Intergenic
1134107248 16:11493844-11493866 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107257 16:11493864-11493886 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107266 16:11493884-11493906 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107275 16:11493904-11493926 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107284 16:11493924-11493946 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107293 16:11493944-11493966 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107302 16:11493964-11493986 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107311 16:11493984-11494006 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107320 16:11494004-11494026 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107329 16:11494024-11494046 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134107338 16:11494044-11494066 CGGGGCAGTGGCGTGGGGGGCGG + Intronic
1134441272 16:14301165-14301187 CTGGGCAGGGGTGTGGGGGTGGG + Intergenic
1135383011 16:22009067-22009089 CAGGGGATGGGCGGGGGCGGCGG - Intronic
1135821862 16:25692299-25692321 CTGGGCAGCGGCGGCGGCGGCGG + Exonic
1136364789 16:29805043-29805065 CTGGGGGAGGGCGGGGGCGGGGG + Intronic
1136470118 16:30474136-30474158 CTGGGCACGTGCAGGGGCGGGGG + Intronic
1136611962 16:31371791-31371813 CTGGGCATGAACGTGGGTGGCGG + Intronic
1138178597 16:54928376-54928398 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1138443200 16:57047278-57047300 CTGGGCTCTGGAGGGGGCGGTGG + Intronic
1139532379 16:67548762-67548784 CTGGGCATGGGCCTGGGTGTAGG - Intergenic
1140469479 16:75206194-75206216 CTGGGGGCGGGAGTGGGCTGAGG + Intronic
1141421436 16:83920459-83920481 CTGAGAACGGGCATGGGCTGGGG - Exonic
1141924314 16:87157337-87157359 CTGGGGAGGGGAGTGGGCGGGGG + Intronic
1141972430 16:87492711-87492733 CTGGGCGGAGGCGCGGGCGGCGG - Intergenic
1141985949 16:87580069-87580091 CTGGGCATGGTGGTGGGCGGCGG + Intergenic
1142005984 16:87689822-87689844 CTGGCGGCGGGCGCGGGCGGCGG - Exonic
1142009305 16:87705783-87705805 CAGGGCCTGGGCGGGGGCGGGGG + Intronic
1142009310 16:87705789-87705811 CTGGGCGGGGGCGGGGGCGGGGG + Intronic
1142155672 16:88531930-88531952 CAGGGCAAGGCTGTGGGCGGAGG - Intronic
1142156147 16:88533624-88533646 CAGGGCGCGGGCGCGGGCGCCGG + Exonic
1142352409 16:89586304-89586326 CTGGGCACAGGGGTGGTGGGAGG + Intronic
1142352735 16:89587336-89587358 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1142373309 16:89694808-89694830 GTGGGCACGGGCGGGGGCTGCGG - Intronic
1142373321 16:89694842-89694864 GTGGGCACGGGCGGGGGCTGCGG - Intronic
1142373333 16:89694876-89694898 GTGGGCACGGGCGGGGGCTGCGG - Intronic
1142434147 16:90046656-90046678 CTGTGCCAGGGCGAGGGCGGGGG - Intergenic
1142492771 17:289449-289471 CTTGGTGTGGGCGTGGGCGGTGG - Intronic
1142518531 17:489572-489594 CTGGGCACGCGGGTGGAGGGCGG + Intergenic
1142559695 17:802754-802776 CTGGGCAGGGCCGGGGGCTGAGG + Intronic
1142858845 17:2749220-2749242 CAGGGCCCGGGTCTGGGCGGTGG + Intergenic
1143028766 17:3955735-3955757 CTGGGCAGGGGCGAGGCCTGGGG + Intronic
1143036851 17:4004261-4004283 CTTGGCTCGGGCTTGGGAGGAGG + Intergenic
1143518135 17:7430148-7430170 CTGGGCTGGGGAGTGGGCTGAGG - Intergenic
1143783371 17:9240734-9240756 CTGGGCAGGGGCAGGGGCAGGGG - Exonic
1144224414 17:13131023-13131045 CTGGGCATGGTGGTGGGCGCCGG + Intergenic
1144864174 17:18324252-18324274 CTGGGGACGGCCGTGAGCTGTGG - Intergenic
1144870340 17:18365690-18365712 CTGTGCACGGCCGGGCGCGGTGG - Intergenic
1146271364 17:31487955-31487977 CGGGGCGGGGGCGGGGGCGGAGG - Intronic
1146339613 17:32007685-32007707 ATGGGTCCGGACGTGGGCGGCGG - Intergenic
1147959657 17:44158932-44158954 CTGGGCATGGCCGGGCGCGGTGG - Intronic
1148225492 17:45895733-45895755 CTGGGGGCGGGAGTGGGAGGAGG - Intronic
1148331786 17:46817975-46817997 CGGGGCAGGGGAGTGGGTGGGGG - Intronic
1148440519 17:47709403-47709425 CTCGGCGTGGGCGTAGGCGGTGG - Exonic
1148629068 17:49092607-49092629 CTGGGCTGGGGCGGGGGTGGGGG + Intergenic
1148677895 17:49455615-49455637 CTGGGCAGGGGGGTGCGGGGAGG + Intronic
1148736804 17:49869626-49869648 CTGGGCCCGGGGGTGGGGGGCGG - Intergenic
1149691138 17:58577888-58577910 GTGGGCGTGGGCGTGGGCGTGGG + Intronic
1150217080 17:63476920-63476942 CCGGGCAGGGGCGCGGGCCGGGG - Intergenic
1150407969 17:64919155-64919177 ATGGGTCCGGACGTGGGCGGCGG + Intronic
1150747252 17:67825809-67825831 ATGGGTCCGGACGTGGGCGGCGG - Exonic
1151717027 17:75836169-75836191 CTGGGCAAGGGGGAGGGCAGGGG - Intronic
1152181591 17:78825566-78825588 CTGGGCATTGGGGTGGGTGGTGG - Intronic
1152248380 17:79198256-79198278 CAGGGCAGGGGCGAGGGCAGAGG - Intronic
1152349689 17:79777924-79777946 CCGGGCGGGGGCGGGGGCGGGGG - Intergenic
1152407346 17:80105138-80105160 CAGGGCAGGGGCGGGGGCGGCGG + Intergenic
1152596747 17:81241556-81241578 CTGGACACGGGGCAGGGCGGAGG + Intergenic
1152632153 17:81415109-81415131 CTGGGGACGGGCCCGGGCGAGGG + Intronic
1152737275 17:82003759-82003781 CTGTGCCAGGGCGTGGGCGCGGG - Intronic
1152906448 17:82973099-82973121 CTGGGCTTGTGAGTGGGCGGTGG - Intronic
1153382491 18:4454964-4454986 CGGGGCTGGGGCGTGCGCGGCGG - Intronic
1153805267 18:8705185-8705207 ATGCGCACGGGCCTGGGCGAGGG + Intergenic
1154161115 18:11981439-11981461 CTCGGCACGGGGCGGGGCGGAGG + Exonic
1155244454 18:23894053-23894075 CTGGGCACTGGCATGGGTGAGGG + Intronic
1155954216 18:31943297-31943319 GTGGGCGGGGGCGGGGGCGGGGG + Intronic
1157279103 18:46334191-46334213 CGGGGCGCGGGCGCGGGCGGCGG - Intronic
1157285360 18:46373857-46373879 CTGGGACCGGGGGTGGGAGGGGG - Intronic
1157376987 18:47176151-47176173 CGGGGCGCGGGCTGGGGCGGCGG - Intronic
1157712991 18:49862890-49862912 CTGGGGAGGGGGGTGGGGGGTGG - Intronic
1157849084 18:51030601-51030623 CTGGGCTCGGGCGGTGGCGAGGG - Exonic
1159858592 18:73618745-73618767 ATGGGCAGGGCCGTGTGCGGTGG + Intergenic
1160004387 18:75059045-75059067 CTGGGCCTGTGCGTGTGCGGAGG + Intronic
1160631262 18:80247578-80247600 CGGGGCGCGGGCGCGGGCGCCGG - Intergenic
1160757356 19:764721-764743 CTGGTCAGAGGCGTGGGCGCTGG + Intergenic
1160811019 19:1012915-1012937 ATGGGCAGGGGTGGGGGCGGGGG + Intronic
1160927764 19:1555426-1555448 GGGGGCAGGGGGGTGGGCGGCGG - Exonic
1160988557 19:1851396-1851418 CTGGGCACGTGTGTGTGCTGGGG + Intergenic
1160989443 19:1854481-1854503 CTGGGCGCGGGGCTGGGCGCAGG + Exonic
1160991920 19:1863620-1863642 CCGAGCGCGGGCGTCGGCGGCGG - Intergenic
1160996821 19:1885897-1885919 CTGGGCATGGTGGTGGGCGCCGG - Intergenic
1161150107 19:2702872-2702894 CCGGGCGCGGGCGGGGCCGGGGG + Intergenic
1161221528 19:3120252-3120274 CTGGGCAGGGGAGTGGCGGGGGG + Intronic
1161241182 19:3224794-3224816 CTGCCCACGGGCGAGGGCCGCGG - Exonic
1161300068 19:3538199-3538221 CTGGGCCCGGCCTTGGGTGGGGG - Intronic
1161482910 19:4519604-4519626 CTGGGCACTGGGCTGGGAGGAGG + Intergenic
1161522039 19:4730101-4730123 CTGGGGAGGGGTGTGGGTGGAGG - Intergenic
1161593360 19:5138825-5138847 CTGGGTGCTGGGGTGGGCGGAGG - Intronic
1161607403 19:5222604-5222626 CTGGGCAGGGGAGAGGGAGGGGG + Intronic
1161699922 19:5788992-5789014 CTGGACAGGGCCGGGGGCGGTGG - Intronic
1161738351 19:6005483-6005505 CTTGGCACGGGCCTGGCCCGAGG + Intronic
1161820892 19:6530918-6530940 CTGGGAAGGGGCGTGGCCGCGGG + Intergenic
1161983586 19:7642743-7642765 CTGGCCATGAGGGTGGGCGGGGG - Intronic
1162742688 19:12782649-12782671 GTGCGCGCGTGCGTGGGCGGTGG + Intronic
1163242946 19:16075645-16075667 CTGGGGACAGGGATGGGCGGAGG + Intronic
1163427233 19:17246146-17246168 CTGGGCGAGGGCGAGGGCGGGGG - Intronic
1163607280 19:18281995-18282017 CCGGGCGGGGGCGGGGGCGGGGG + Intergenic
1163623520 19:18374640-18374662 CTGAGCACGGGGGTGGGGGCGGG + Intergenic
1163815746 19:19463498-19463520 CTGAGCAGGAGCGGGGGCGGGGG + Intronic
1164615778 19:29665948-29665970 CTGGGCAGGGGCGCGGCGGGGGG + Intronic
1165080011 19:33301714-33301736 CTGGGCACGGGCGTGGGCGGCGG + Exonic
1165305154 19:34999144-34999166 CTGGGCCAGGGCGTGGGCAGCGG + Intronic
1165331505 19:35143151-35143173 GTGGGCGGGGGCGGGGGCGGGGG + Intergenic
1165420071 19:35718091-35718113 CGGGGCGCCGGCGGGGGCGGGGG + Exonic
1165745578 19:38228398-38228420 CTGGGGGCGGGGGTGGGGGGTGG - Intronic
1165913423 19:39243879-39243901 CTGGGCCCTGCCGTGGGCTGAGG + Exonic
1165917532 19:39269744-39269766 CTGGGCCCTGCCGTGGGCTGAGG - Exonic
1166042909 19:40214026-40214048 CTGGGCGAGGGCGTGGGTGTGGG - Exonic
1166441091 19:42815999-42816021 CTGGGCACTGGTGTGGGGGTGGG + Intronic
1166460565 19:42984606-42984628 CTGGGCACTGGTGTGGGGGTGGG + Intronic
1166477865 19:43144579-43144601 CTGGGCACTGGTGTGGGGGTGGG + Intronic
1166673449 19:44725220-44725242 CAGGTCAGGGGCGGGGGCGGGGG - Intergenic
1166837688 19:45677398-45677420 CTGGGGCGGGGCGTGGGAGGTGG + Intronic
1167079822 19:47271207-47271229 CAGGGCACGGGCCTGGGGTGGGG + Intronic
1167257988 19:48442654-48442676 CTGGGCAGGGGCTGTGGCGGCGG - Exonic
1167456761 19:49600321-49600343 TTGGGGATGGGGGTGGGCGGTGG + Intronic
1167638564 19:50668313-50668335 GTGGGCACGGGCGAGGGGGACGG + Exonic
1167862537 19:52297122-52297144 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1168316474 19:55486782-55486804 CCGGGCTCGGGCCTGGGCTGGGG + Exonic
1168515133 19:57004546-57004568 CTGGGCATGGAGGTGGGAGGAGG - Intergenic
1168694411 19:58396570-58396592 CGCGGCCCGGGCGGGGGCGGCGG - Exonic
1168701104 19:58440072-58440094 CAGGGCACGGGAGTGGGTGCAGG - Exonic
1168701650 19:58443482-58443504 CTGGACAAGGGCGTGGGAGTGGG - Intergenic
925040150 2:726333-726355 TGGGGCACAGGCGTGGGTGGAGG + Intergenic
925104870 2:1282735-1282757 GTGGGGGCGGGGGTGGGCGGGGG - Intronic
926107683 2:10162681-10162703 CTCGGCAGGGGGGTGGGGGGCGG - Intronic
926305811 2:11636778-11636800 AGGGGCACGGGCATGGGCAGGGG + Intronic
926320646 2:11746568-11746590 CGGGGCAGGGGCGGGGGCAGAGG - Intronic
926801775 2:16665735-16665757 CGCGGCAGGGGCGCGGGCGGGGG - Intronic
927022197 2:19029008-19029030 CTGTGGAGGGGCGGGGGCGGGGG - Intergenic
927204044 2:20595770-20595792 CTGGGCAGGGAAGTGGGCAGAGG + Intronic
927236546 2:20880366-20880388 CTGGGCACTGGAGTGGGCACTGG + Intergenic
927652441 2:24920459-24920481 GCGGGCGCGGGCGTGGGCGGTGG + Intergenic
927751259 2:25673088-25673110 CGGGGCACGGGCGCGAGCGGGGG - Intronic
927885881 2:26718197-26718219 CTGGGCAGGGGCGTGGCTGTGGG - Intronic
929231303 2:39563332-39563354 GTGGGCAGGGGGTTGGGCGGGGG - Intergenic
929607891 2:43247452-43247474 CTGGGCACGGCCGGGTGAGGTGG + Intronic
930358228 2:50346894-50346916 CTGGGCTCGCCCGGGGGCGGCGG - Intronic
930754041 2:54958042-54958064 CTGGGCATGGGCATGGGCATGGG + Intronic
931201935 2:60106059-60106081 CTGGGCGTGGGCGTGGGTGGAGG - Intergenic
931241873 2:60461302-60461324 CGGGGCGCGGTCGTGGGCGTGGG - Exonic
932476477 2:72009369-72009391 AGGGGCAGGGGCGGGGGCGGGGG + Intergenic
933354730 2:81197016-81197038 GTGGGCACGGGCGTGGAGGGCGG + Intergenic
933571246 2:84015557-84015579 CTGGGCATGGTGGTGGGCGCCGG - Intergenic
934988616 2:98904961-98904983 CTGGGCCCGGCCGGGCGCGGTGG + Intronic
935402057 2:102670301-102670323 CTGGGCACGGCCGGGCGTGGTGG - Intronic
935746372 2:106193604-106193626 CTGGGCACGGCCGCGGGCCGGGG + Intronic
936433423 2:112482930-112482952 CTTGGCGTGGGCGCGGGCGGGGG + Intronic
937122334 2:119449568-119449590 CTGGGCACTGGGGTTGGGGGAGG - Intronic
937221746 2:120346068-120346090 GCGGGCGCGGGCGCGGGCGGGGG + Intergenic
937263618 2:120601997-120602019 CTGGGCAGGGGCATGGTGGGTGG - Intergenic
937392074 2:121497866-121497888 CTGGGCCCGGGCGTGGTGGTGGG - Intronic
938063665 2:128269890-128269912 CTGGGCAGGGGTGGGGGTGGGGG + Intronic
938338952 2:130522926-130522948 GTGGGGACGGGGGTGGGCGCCGG + Intronic
938350886 2:130597824-130597846 GTGGGGACGGGGGTGGGCGCCGG - Intronic
938962530 2:136356192-136356214 CTGGGCACAGGAGAGGGAGGAGG + Intergenic
940982125 2:160015607-160015629 CGGGGCAGGGGCGAGGGTGGGGG - Intronic
942234814 2:173893570-173893592 CTGGGCATGGCCGGGTGCGGTGG - Intergenic
942529523 2:176894599-176894621 CTGGGCACTGCCGGGCGCGGTGG + Intergenic
944531778 2:200674413-200674435 CTGGTCAAGGGCCTGGGTGGGGG + Intronic
946029070 2:216690891-216690913 GTGGGCGGGGGCGGGGGCGGTGG + Intronic
946157394 2:217815976-217815998 CTGGGCATGGGTGTGTGTGGGGG - Intronic
947593032 2:231395843-231395865 CTGGGCGGGGGCGTGGGCCCGGG + Intronic
947724159 2:232387211-232387233 CTGGGCCCGGTCGCGGCCGGCGG - Intergenic
947724421 2:232388213-232388235 CTGGGAATGGGGGTGGGTGGGGG - Intergenic
947741336 2:232486379-232486401 CTGGGCCCGGTCGCGGCCGGCGG - Exonic
947992487 2:234497718-234497740 CTGGGCACAGGCCTGGGCTCCGG - Intergenic
948046866 2:234951957-234951979 CTGGGCGGGGGCGGGGGCGGGGG - Intronic
948115825 2:235493985-235494007 CGGGGCGCGGGCGCGGGCGCGGG + Intergenic
948202859 2:236142371-236142393 CGGGGCAGGGGCCGGGGCGGGGG - Intergenic
948445057 2:238026150-238026172 CCGGGCAGGGGTGGGGGCGGGGG - Intronic
948775802 2:240288200-240288222 CTGAGCAGGGGAGTGGGCGAGGG + Intergenic
948836809 2:240629849-240629871 CTGGGCAGGGATGTGGGAGGAGG - Intronic
948874651 2:240820151-240820173 ATGGGCACTGGCATGGGCGCGGG + Exonic
949026688 2:241769711-241769733 CTGGGCATGGCCGGGTGCGGTGG - Intergenic
1169130872 20:3165909-3165931 CTGGGCTCTGGGGAGGGCGGAGG - Exonic
1171531567 20:25856734-25856756 CTGGGCTCGGTCTTGGGCTGGGG - Intronic
1172037010 20:32018185-32018207 CGGGGGAGGGGCGGGGGCGGGGG + Intronic
1172037025 20:32018208-32018230 CGGGGGAGGGGCGGGGGCGGGGG + Intronic
1172178519 20:32986833-32986855 CAGGGCCCGGGAGTGGGGGGTGG - Intronic
1172482202 20:35277772-35277794 CTGGGCTCGGGCTGGGGCTGGGG + Intergenic
1172661330 20:36571105-36571127 CTGGGCACGGTGGTGGGCGTGGG + Intergenic
1172702763 20:36863170-36863192 CTGAGCCCGGGCCTGGGCCGCGG + Exonic
1173475931 20:43359742-43359764 CTGAGCAGGGGCGTGGGTGTGGG + Intergenic
1173869478 20:46332465-46332487 CTGTGCAGGGCCGTGGGTGGTGG + Intergenic
1173973859 20:47172765-47172787 CTGGGCTCTGGCGTGCACGGCGG + Exonic
1174133218 20:48360173-48360195 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1175394738 20:58650499-58650521 CGGGGCACGGGGGGGCGCGGGGG + Intergenic
1175421938 20:58840243-58840265 CTGGGCACGGGCGTTGGAGGTGG - Intronic
1175470266 20:59222421-59222443 CTTGGCGCCGGCGGGGGCGGAGG - Intronic
1175522317 20:59609656-59609678 CTGGGCGTGGGAGAGGGCGGAGG + Intronic
1175796321 20:61773448-61773470 GTGGGCAGGGGCGTGGGTCGTGG + Intronic
1175917040 20:62430741-62430763 CTGGGCACTTGGGAGGGCGGAGG + Intergenic
1175992145 20:62794883-62794905 CTGGGCCCGGCCGGGCGCGGTGG + Intergenic
1176031666 20:63015913-63015935 CTGGGCAGGGGTGGGGGAGGTGG - Intergenic
1176039225 20:63055731-63055753 CTGGGCCTGGGGGTGGGCTGGGG + Intergenic
1176207217 20:63895494-63895516 CTGGGCCGGGGCGGGGGCGCGGG + Intronic
1176242942 20:64083511-64083533 CTGGGGTCCGGCGTGTGCGGAGG + Exonic
1178555778 21:33588751-33588773 CTCGGAACCGGCGGGGGCGGAGG - Intronic
1178992481 21:37367202-37367224 CGGGGCCCGGGCGGCGGCGGCGG - Intronic
1179720387 21:43313227-43313249 GTGGGCACTGGGGTGGGGGGTGG - Intergenic
1179868386 21:44229762-44229784 CTGGGCACTGGGGAGCGCGGGGG + Intronic
1180137644 21:45871552-45871574 CTGGGCAGGGGCGTGGGGTGTGG + Intronic
1180231490 21:46429273-46429295 CTTGTCAGGGGCATGGGCGGGGG + Intronic
1180651502 22:17381087-17381109 TTGTACACGGGGGTGGGCGGGGG + Intronic
1180843604 22:18970363-18970385 GGGGGCGCGGGCCTGGGCGGGGG - Intergenic
1180977371 22:19855647-19855669 CTGGGCACGGCCCTGTGGGGAGG - Intergenic
1181045201 22:20211041-20211063 GTGGGCTCAGGCCTGGGCGGGGG + Intergenic
1181514363 22:23402665-23402687 CTGGGCGCCGGCGCGGGCGCGGG + Intergenic
1181646472 22:24233906-24233928 CAGAGCATGGGCCTGGGCGGAGG - Exonic
1182041018 22:27239197-27239219 CTGGGCTTGGGCGTTGGCTGGGG + Intergenic
1182365698 22:29777385-29777407 CTGGGCATGGTGGTGGGGGGGGG + Intergenic
1182439833 22:30356743-30356765 GTGGGCACGGGCGGCGGCGGGGG + Exonic
1182749490 22:32630124-32630146 CTGGGCATGGTGGTGGGCGCCGG - Intronic
1182923794 22:34104069-34104091 CTGGGGAGGGGGGTGGGTGGGGG - Intergenic
1183294906 22:37023896-37023918 CTGGGCAGGAGGGTGGGTGGAGG - Exonic
1183385088 22:37509874-37509896 ATGGGCACGGGGGTGGGGGGTGG - Intronic
1183385131 22:37509993-37510015 ATGGGCACGGGGGTGGGGGGTGG - Intronic
1183388303 22:37527889-37527911 ATGGGCACGGGAGTGGCGGGGGG - Intergenic
1183392932 22:37556156-37556178 ATGGCCACGGGTGTGGGCAGTGG + Intergenic
1183648587 22:39140876-39140898 CTGGGCAGGAGCGTGGGCTTTGG - Intronic
1183712284 22:39512246-39512268 CTGGCCACTGGCTTGGGCCGGGG - Exonic
1183741535 22:39671092-39671114 CTGGGCACTGCAGTGGGAGGAGG + Intronic
1183780369 22:39995278-39995300 CTTGCCCCGGGCGTTGGCGGCGG - Exonic
1184101569 22:42343926-42343948 CGGGGGAGGGGCGCGGGCGGGGG + Intergenic
1184210499 22:43032574-43032596 CTGGGCACGGCTGGGTGCGGTGG - Intergenic
1184337513 22:43862442-43862464 CGGGGCGCGGGCGCGGGCGCGGG - Exonic
1184645459 22:45892470-45892492 CTGGGCAGGGCCCTGGGCTGCGG + Intergenic
1184728711 22:46361120-46361142 CTGGGCATGGGGAGGGGCGGGGG + Exonic
1185278854 22:49961375-49961397 TGGGGCACGGGCGGCGGCGGCGG + Intronic
1185316212 22:50180319-50180341 CAGGGGACGGGCGTGGAGGGAGG - Intergenic
1185335772 22:50270334-50270356 CTCGGCTCGGGCGCGGGCGCGGG - Exonic
1185342351 22:50297275-50297297 CAGGCCCCAGGCGTGGGCGGGGG + Intronic
1185365974 22:50436902-50436924 CTGGGCATGGTCCTGGGCGCTGG + Intronic
1185375657 22:50481694-50481716 CTGGGCACGGGCGTCCGTCGGGG - Exonic
1185418382 22:50721815-50721837 CTGGGCACCGTGGTGGGCGAGGG - Intergenic
949987826 3:9553685-9553707 CTGGGCACGGCCGGAGGCAGCGG + Exonic
950110368 3:10414800-10414822 GTGGGCAAGGGCGGGGGCTGGGG - Intronic
950309191 3:11941129-11941151 CTGGGCATGGTGGTGGGCGCCGG + Intergenic
950477797 3:13224760-13224782 GTGGTCACGGGAGTTGGCGGGGG - Intergenic
950612464 3:14135041-14135063 CTGGGCACGGGTGTGGAGGTGGG + Intronic
950676133 3:14555374-14555396 CTGGGAAGGGGTGGGGGCGGGGG + Intergenic
953357121 3:42265150-42265172 CTGGGGGCGGGGGTGGGGGGTGG + Intronic
953399565 3:42600935-42600957 CAGGGCAGGGGCGAGGGCGGGGG - Intronic
953886609 3:46717750-46717772 CAGGGCACCGGCGCGGGAGGGGG + Exonic
954002541 3:47569098-47569120 CAAGGCACGGGCATGGGGGGAGG + Exonic
954390995 3:50267830-50267852 CTGGGCAGGAGTGTGGGTGGAGG + Intronic
954415490 3:50391337-50391359 CTGGGCCAGGGCGTGGGAAGGGG - Intronic
954707635 3:52489515-52489537 CTGGGCAGGGGCCTCGGCTGGGG - Exonic
955356594 3:58237472-58237494 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
955413711 3:58673005-58673027 CTGAGGACTGGAGTGGGCGGTGG + Intergenic
955770353 3:62378749-62378771 CTGGGCGGGGGCGTAGGGGGAGG + Intergenic
959988940 3:112609086-112609108 CTGGGCAGGGGCAGGGGCAGGGG - Intronic
960664215 3:120094376-120094398 CTTGGCCCGGGCGGCGGCGGCGG + Intronic
960914369 3:122681194-122681216 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
960925982 3:122795242-122795264 CCGGGCTCGGGCCTGGGCTGGGG + Exonic
961236884 3:125375056-125375078 CCGGGCCCGGGGGAGGGCGGGGG - Intronic
961305729 3:125958428-125958450 CTGGGCGCGGGCGTGGCGGGTGG - Intergenic
961358358 3:126352645-126352667 CTGGGCAGTGGCGGGGGCAGCGG - Exonic
961569011 3:127785061-127785083 CTGGGCACTGCAGTGGGCAGAGG - Intronic
962156821 3:132956822-132956844 CGGGGCAGGGGCGGGGGGGGCGG - Intergenic
965544761 3:169904048-169904070 CTGGCCATGGGGATGGGCGGGGG - Intergenic
966246042 3:177809005-177809027 CTGGGCACGGGGGTGGGGGCGGG + Intergenic
966866529 3:184261491-184261513 CGGGGACCGGGCGGGGGCGGGGG + Intronic
966866534 3:184261497-184261519 CCGGGCGGGGGCGGGGGCGGGGG + Intronic
968085770 3:195873264-195873286 CTGGGCAGGGGCAGGGGCAGGGG + Intronic
968225075 3:196968383-196968405 CAGGGCACGGGTCTGGGCGCAGG - Intronic
968487157 4:868205-868227 CAGGGGAAGGGCCTGGGCGGAGG - Intronic
968516657 4:1018347-1018369 CTGGGCAGGGGTGGGGGGGGCGG + Intronic
968569840 4:1333780-1333802 ATGGGCACGGGAGTGGGCATGGG - Intronic
968569891 4:1333921-1333943 ATGGGCACGGGAGTGGGCATGGG - Intronic
968701211 4:2059106-2059128 CCCGGCACGGGCGGGGGCGGCGG - Intergenic
968908020 4:3463458-3463480 GGGGGCGCGGGCGCGGGCGGCGG + Intronic
969219016 4:5747274-5747296 CTGGGCATGGGAGGGGGCAGGGG - Intronic
969219704 4:5751808-5751830 CTGGGCAGGGGAGTGAGAGGAGG + Intronic
969536679 4:7760582-7760604 CTGGGCACAGGCATGGGCGATGG - Exonic
969720852 4:8892553-8892575 CCGGGGAAGGGCGTGGGGGGAGG - Intergenic
972629749 4:40832947-40832969 CTGGGCTCGGGGGTGGGTTGGGG + Intronic
972770989 4:42196875-42196897 GGGGGCAGGGGCGGGGGCGGGGG - Intergenic
975870732 4:78776247-78776269 CGGGGCACTGGCGGAGGCGGCGG + Intergenic
977607378 4:98996064-98996086 CTGGGCTCACGCGGGGGCGGGGG + Intronic
978789337 4:112644273-112644295 CTGGGGTGGGGCGGGGGCGGGGG + Intronic
979785676 4:124712789-124712811 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
981782500 4:148444158-148444180 CTGGGCACGCGAGGCGGCGGCGG + Intronic
983917850 4:173311634-173311656 GTGGGCATGGGGGTGGGGGGTGG + Intronic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
984896851 4:184548816-184548838 ATGGGCAGGGGCGTGGGAGTGGG - Intergenic
984923412 4:184785595-184785617 CTGGGCGGGGGCGGGGGGGGGGG + Intronic
985737900 5:1595057-1595079 CTGACCACGGCCGTGCGCGGTGG - Intergenic
985911473 5:2887372-2887394 CTGGGCCTGGGTGTGGGCGGAGG + Intergenic
991435746 5:66596204-66596226 CGGGGCCCGGGCGCGGGCCGTGG - Intergenic
992165747 5:74049486-74049508 CTGGGCACAGGCATGGGTGGAGG + Intergenic
993501776 5:88674289-88674311 GTGGGCACGGGGGTGCGGGGAGG + Intergenic
994353877 5:98774029-98774051 GTGGGCTCCGGCGAGGGCGGCGG - Exonic
996147918 5:119997856-119997878 CTGGGGACTGTTGTGGGCGGGGG - Intergenic
997548837 5:134734827-134734849 CTGGGCTCGGCCGGGGACGGTGG + Intergenic
998033932 5:138897298-138897320 CTGGGCGGGGGCGGGGGGGGGGG - Intronic
998156115 5:139788180-139788202 CTGGGCACGGGTTCGGGGGGGGG - Intergenic
998513845 5:142735528-142735550 CTGGGCACGGGCCTGGTCTCAGG + Intergenic
999321500 5:150618301-150618323 CTGGGCCAGGGCCTGGGCTGGGG - Exonic
999516172 5:152303899-152303921 CTGGGAATGGGGGTGGGAGGTGG - Intergenic
1000328781 5:160191672-160191694 CTGGGCTCGGCCGGGCGCGGTGG + Intronic
1002104840 5:176874904-176874926 ATGAGCACGGGCCTGGGCAGAGG + Intronic
1002342798 5:178527747-178527769 CCTGGCAGGGGCGTGGGCAGGGG - Intronic
1002641754 5:180633719-180633741 GTGGGCACCGGAGTGGGTGGTGG + Intronic
1003291276 6:4780407-4780429 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1003868172 6:10381953-10381975 CAGGGCCCGGGCCTGGACGGTGG - Intergenic
1004348106 6:14866894-14866916 CTGGACATGGGAGTGGGGGGAGG - Intergenic
1006369414 6:33634653-33634675 CTGGGCACTGGCATGGGGAGGGG + Intronic
1006463430 6:34177215-34177237 CTGGGCATGGCCGTGGGCCAGGG - Intergenic
1006677858 6:35776934-35776956 AGGGGCACGGGCGGGGGAGGTGG - Intronic
1007269301 6:40624092-40624114 CTGGGCAGGGGTGTGGGAGGGGG - Intergenic
1007521392 6:42453367-42453389 CGCGGCGCGGGCGGGGGCGGAGG + Intergenic
1007656895 6:43455845-43455867 CAGGGCTGGGGCGTGGGCCGCGG - Intronic
1008013256 6:46491026-46491048 CAGGGCGGGGGCGGGGGCGGGGG - Intronic
1008932440 6:56954866-56954888 CTGCGCACGGACGGGGGCGGGGG - Intergenic
1010244795 6:73653511-73653533 CCGGGCGGGGGCGGGGGCGGGGG - Intronic
1010256577 6:73765115-73765137 TTGGGCATGGGAGTGGGAGGTGG + Intronic
1012679419 6:102160468-102160490 CTGGGAACGGTAGTGGGGGGTGG + Intergenic
1013594690 6:111649897-111649919 GTGGGCATGGGGGTGGGGGGAGG + Intergenic
1013836562 6:114342231-114342253 CAGGGCGCGGGGGTCGGCGGCGG + Exonic
1013866008 6:114697155-114697177 CTGGGCACACATGTGGGCGGTGG - Intergenic
1014288987 6:119536757-119536779 CTCAGCAAGGGCGTGGGCAGAGG - Intergenic
1014751582 6:125262889-125262911 CTGGGCACTGGCATGGGCCGTGG - Exonic
1016340900 6:143060787-143060809 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1016378764 6:143451097-143451119 CTGGGCACGGTCCTTGGAGGTGG + Exonic
1017156336 6:151325615-151325637 CTGGGTGGGGGCGTGGGTGGGGG + Intronic
1017725824 6:157275194-157275216 CCGGGGCCGGGCGCGGGCGGCGG + Intergenic
1017770393 6:157639731-157639753 CTGGGGAGGGGTGAGGGCGGAGG + Intronic
1017774800 6:157672627-157672649 CAGGGCACGGGCGGGGAGGGTGG - Intronic
1019179033 6:170175808-170175830 CAGGGCAGGGGCGGGGGCGGGGG - Intergenic
1019287724 7:231940-231962 CTGGGCAGGGGCGGGTGCTGGGG - Intronic
1019345989 7:531174-531196 CGGGGCAGGGGCAGGGGCGGGGG + Intergenic
1019409554 7:900629-900651 GTGGGCACAGGCTTGGGCTGAGG + Intronic
1019414932 7:922803-922825 GTGGGCGGGGGTGTGGGCGGGGG - Intronic
1019474377 7:1236840-1236862 CTGGGCGACGGCGCGGGCGGCGG - Exonic
1019525473 7:1478616-1478638 CTGGGCAGTGGCTTGGGGGGTGG - Intronic
1019577683 7:1745428-1745450 CTGGGCTCCGGCGGAGGCGGGGG - Exonic
1019586904 7:1809953-1809975 CTGGGCACGGGCGGAGGCGGTGG - Intergenic
1019613472 7:1948353-1948375 CTGGGCAGGGCCCTGAGCGGAGG - Intronic
1019637301 7:2082809-2082831 CGGCGCACAGGCGTGGGCGGAGG - Intronic
1019801094 7:3089021-3089043 CTGGGAAAGGGAGTGGGAGGGGG - Intergenic
1020257008 7:6508103-6508125 CAGGGCACGGGTGGGGGCAGGGG + Exonic
1020972341 7:14960911-14960933 ATGATCTCGGGCGTGGGCGGAGG + Intronic
1022506598 7:30911640-30911662 CTGGGCAGGGCTGAGGGCGGAGG + Intergenic
1023610488 7:41966233-41966255 TTGGGCAGGGGCGTCGGCGGCGG + Exonic
1023638712 7:42237652-42237674 CTGGGCGGGGGCCGGGGCGGAGG - Intronic
1026987841 7:74565829-74565851 CTGGGCATGGTGGTGGGTGGTGG + Intronic
1027592695 7:80135295-80135317 CGGGGCCCGGGGGTCGGCGGGGG + Intronic
1029541255 7:101183510-101183532 CTGGGCATGGCCGGGTGCGGTGG - Intergenic
1029608957 7:101616367-101616389 CTGGGCAGGGGCTGGGGCTGGGG + Intronic
1030614759 7:111728293-111728315 CGGGGCAGGGGCCTGGGCCGCGG + Exonic
1031361830 7:120857371-120857393 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1032193975 7:129779519-129779541 CTGTTCCCGGGCGGGGGCGGGGG - Intergenic
1033227390 7:139572771-139572793 CGGGGCAGGGGCGGGGGGGGGGG - Exonic
1033299971 7:140176819-140176841 CAGTACACGGGCGGGGGCGGCGG + Exonic
1033365948 7:140672911-140672933 CAGGGCGCGGGCGCAGGCGGGGG - Intronic
1033475463 7:141687919-141687941 CTGGGCATGGCCGGGTGCGGTGG - Intronic
1034244760 7:149635932-149635954 CCGGGGACCGGGGTGGGCGGGGG - Intergenic
1034445989 7:151114700-151114722 CTGGGCCCGGGCCGGGGCCGCGG - Intronic
1034447607 7:151121569-151121591 CGGGGACTGGGCGTGGGCGGAGG - Intronic
1034470475 7:151251945-151251967 CCGGGGACCGGCGCGGGCGGAGG - Intronic
1034911711 7:155003092-155003114 CTCGGCGCGGGCGCGGGCGGGGG - Intergenic
1035032262 7:155869266-155869288 CTGGGGATGGGGGTGGGTGGTGG + Intergenic
1035169566 7:157010040-157010062 CTGGGCGCGGGCGGCGGCGGCGG - Exonic
1035185915 7:157125727-157125749 CTGAGCAAGGGTGTGGGCCGTGG + Intergenic
1035368543 7:158363742-158363764 CGGGGCACGGGCCTGGGAAGCGG + Intronic
1035602068 8:902747-902769 GTGGGCGGGGGCGGGGGCGGTGG + Intergenic
1036558820 8:9884248-9884270 TGGGGCAAGGGGGTGGGCGGTGG + Intergenic
1036910928 8:12755894-12755916 CTGGGCGGGGGCGTCGGGGGAGG - Intronic
1037529097 8:19756974-19756996 CAGGGCACGGGCAGGGGCCGGGG - Intronic
1038395233 8:27241606-27241628 CTGTGGCCGGGGGTGGGCGGGGG - Intronic
1038613204 8:29071985-29072007 GCGGGGACGGCCGTGGGCGGTGG + Exonic
1041072177 8:54135808-54135830 CTGGGTGCGGCCGGGGGCGGTGG - Intronic
1041690360 8:60680320-60680342 CGGGGCTCGGGCGGGGGCGCGGG + Intronic
1043388151 8:79768010-79768032 CCGGGCAGGGGCGGGCGCGGAGG - Intergenic
1045006164 8:97918606-97918628 CAGGGCACTGGCCTGGGCAGAGG + Intronic
1045034260 8:98165179-98165201 CTGGGCACAGGCGTAGGCCAAGG - Intergenic
1049172330 8:141169281-141169303 CTGGGAACGGGTGTGGTTGGCGG + Intronic
1049241438 8:141539355-141539377 CTGTGCAAGGGCCTCGGCGGTGG + Intergenic
1049419668 8:142511106-142511128 CCGGGCAGGGGCGCGGGCGGGGG + Intronic
1049552625 8:143267489-143267511 GTGGGCGCGGGCGGCGGCGGCGG + Intronic
1049582118 8:143417550-143417572 CTGGGCAGGGGTCTGGGCAGGGG + Intergenic
1049585304 8:143430168-143430190 CCGGGCACCGGCGGCGGCGGCGG - Exonic
1049760674 8:144330757-144330779 CGGGGCACAGGCGGGGGTGGGGG + Exonic
1051828303 9:21246909-21246931 CTGGGGACTGTTGTGGGCGGGGG - Intergenic
1053447838 9:38166553-38166575 CTGGGCTGGGGCGGGGGTGGTGG + Intergenic
1054462181 9:65471283-65471305 ATGGGCTCGGGGGTAGGCGGGGG - Intergenic
1054906985 9:70420527-70420549 CTGGGCCTGGGCCTGGGCGTAGG - Intergenic
1056154153 9:83817837-83817859 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1056404150 9:86258197-86258219 CTGGGCATGGTGGTGGGCGCCGG + Intronic
1057067990 9:92073087-92073109 CTGGGCAGGGGCATGGGGGTCGG - Intronic
1057605458 9:96495397-96495419 CTGGGCAGGGGCGGGGGGCGGGG - Intronic
1058005149 9:99906588-99906610 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1058687907 9:107493798-107493820 CTGGGGACTGTTGTGGGCGGGGG - Intergenic
1059385545 9:113961434-113961456 CTGGGCAAGGCCTTGGCCGGTGG - Intronic
1060199955 9:121646515-121646537 CTGGGCAGGGGTGGGGGTGGGGG - Intronic
1060504214 9:124186124-124186146 CTGGGCATGGGCGGGGGAGGTGG - Intergenic
1061028959 9:128068278-128068300 CCGGGCGCGGGCGGGAGCGGGGG - Exonic
1061066364 9:128280256-128280278 GTGGGCACTGGGGTGGGCTGAGG - Intronic
1061449274 9:130659823-130659845 CGGGGAACGGGGGTGGGGGGAGG + Intergenic
1061489799 9:130938672-130938694 GTGGGCGCGGGCGCGGGCGCGGG + Exonic
1061491648 9:130948104-130948126 CTGGGCACATGGGTGGTCGGGGG - Intergenic
1061860612 9:133466728-133466750 CTGGGCTGGGGTGGGGGCGGGGG - Intronic
1061960045 9:133983302-133983324 CTGGGCTCTGGCCTGGGTGGTGG - Intronic
1062029770 9:134356951-134356973 CTGGGCATGGGCATGGGCCTTGG - Intronic
1062160104 9:135075323-135075345 CTCGGAAGGGGCGGGGGCGGGGG - Intergenic
1062309804 9:135929638-135929660 CTGGGCAGGGCTGGGGGCGGGGG - Intergenic
1062313746 9:135954735-135954757 ATGGGCACCGTCGTGGGCCGAGG - Intronic
1062451579 9:136617909-136617931 CTGGGCAGGGGCGTGCCTGGAGG + Intergenic
1062547538 9:137070402-137070424 CTGGGCGCGGGTGCGGGGGGAGG + Exonic
1185464449 X:346376-346398 CAGGGCACAGGCGGGGGCAGAGG + Intronic
1186187930 X:7040173-7040195 CTGGGCACTGGTGTGGGGGTGGG + Intergenic
1186402098 X:9269497-9269519 CCAGGCACGGCCATGGGCGGTGG + Intergenic
1186485631 X:9932479-9932501 CTGGGCTCGCGCTTGGGTGGCGG - Exonic
1187443965 X:19344319-19344341 CTGGGCCCGGGGGCGGGAGGTGG - Intronic
1188069046 X:25696194-25696216 CTGGGCGGGGGGGTGGGGGGGGG + Intergenic
1189310624 X:40014929-40014951 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1189801389 X:44694967-44694989 CTGGGCATGGTGGTGGGTGGTGG + Intergenic
1189928582 X:45983548-45983570 CTGGCCACGGGGATGGCCGGGGG + Intergenic
1190024632 X:46912466-46912488 CTGGGCAGGCGGTTGGGCGGCGG - Exonic
1190230902 X:48581065-48581087 CTGGGGGCGGGGGGGGGCGGGGG + Intergenic
1190285287 X:48957428-48957450 GGCGGCACGGGCGTGGGCGGCGG - Exonic
1190526329 X:51332759-51332781 CGGGGCACGGGCGGAGGCGGGGG - Intronic
1191141766 X:57121838-57121860 GTGGGCGCGGGGGTGGGCGCGGG - Intergenic
1192422967 X:71050284-71050306 CTGGGCACGGCCGGGCGCGGTGG - Intergenic
1192491066 X:71578008-71578030 CTGGGAAAGGGCGCGGGGGGAGG - Intergenic
1192584062 X:72306436-72306458 CTGGGCGCCGGGCTGGGCGGCGG - Intronic
1195228356 X:102821177-102821199 GTTGGCAGGGGCTTGGGCGGGGG - Intergenic
1196031179 X:111096757-111096779 CTGGGTAGGGGGGCGGGCGGGGG - Intronic
1196636927 X:118012671-118012693 CTGGGCGGGGGCGGGGGCAGGGG + Intronic
1196862763 X:120043166-120043188 CAGGGCACTGGGGTGGGAGGAGG - Intergenic
1196880339 X:120193178-120193200 CAGGGCACTGGGGTGGGAGGAGG + Intergenic
1197727836 X:129788111-129788133 CTGGGCAGGGGGGTGGGGGTGGG + Intronic
1197749903 X:129957266-129957288 CTGGGCAGGGGCGGAGGGGGAGG - Intergenic
1197792383 X:130268731-130268753 CGCGGCACAGGCGGGGGCGGGGG + Intronic
1199794388 X:151180584-151180606 ATGGGCACGGGCGCGGGCCAGGG - Exonic
1200085933 X:153605141-153605163 CTGGCCACGGGGATGGCCGGGGG - Intergenic
1200128464 X:153829204-153829226 CGGGGCGGGGGCGGGGGCGGGGG - Intronic