ID: 1165080106

View in Genome Browser
Species Human (GRCh38)
Location 19:33302068-33302090
Sequence CCGGGCGCGCCCGCGGGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 488}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165080106_1165080115 13 Left 1165080106 19:33302068-33302090 CCGGGGCCCGCGGGCGCGCCCGG 0: 1
1: 0
2: 3
3: 61
4: 488
Right 1165080115 19:33302104-33302126 CCGCCGCCGCCGCCGCCCGTGGG 0: 1
1: 13
2: 61
3: 256
4: 723
1165080106_1165080124 30 Left 1165080106 19:33302068-33302090 CCGGGGCCCGCGGGCGCGCCCGG 0: 1
1: 0
2: 3
3: 61
4: 488
Right 1165080124 19:33302121-33302143 CGTGGGGCCCACGGCCGCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 141
1165080106_1165080119 21 Left 1165080106 19:33302068-33302090 CCGGGGCCCGCGGGCGCGCCCGG 0: 1
1: 0
2: 3
3: 61
4: 488
Right 1165080119 19:33302112-33302134 GCCGCCGCCCGTGGGGCCCACGG 0: 1
1: 0
2: 1
3: 17
4: 183
1165080106_1165080116 14 Left 1165080106 19:33302068-33302090 CCGGGGCCCGCGGGCGCGCCCGG 0: 1
1: 0
2: 3
3: 61
4: 488
Right 1165080116 19:33302105-33302127 CGCCGCCGCCGCCGCCCGTGGGG 0: 1
1: 8
2: 48
3: 253
4: 684
1165080106_1165080113 12 Left 1165080106 19:33302068-33302090 CCGGGGCCCGCGGGCGCGCCCGG 0: 1
1: 0
2: 3
3: 61
4: 488
Right 1165080113 19:33302103-33302125 GCCGCCGCCGCCGCCGCCCGTGG 0: 5
1: 51
2: 207
3: 490
4: 1274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165080106 Original CRISPR CCGGGCGCGCCCGCGGGCCC CGG (reversed) Exonic
900189964 1:1349185-1349207 GCGGGGGCGCCCGGGGGCCTCGG - Intronic
900287495 1:1908651-1908673 CCCAGCGCGCCCGGTGGCCCAGG - Intergenic
901409352 1:9071829-9071851 CCTGGCGGGCCTGCGGGCTCCGG + Intronic
901832086 1:11898825-11898847 CCTGGAGCGCCCTCGGGTCCCGG - Intergenic
902067544 1:13700452-13700474 CCGGGCGTGCCGGGGGCCCCGGG + Intronic
902311513 1:15584926-15584948 CCGGGTGCGCCCGGGGCCCGGGG - Exonic
902336954 1:15759266-15759288 CCTGGAGCGCCCCCGGGCTCCGG - Intronic
902501444 1:16914146-16914168 CCGGGGGCGCGCGCGTGCGCGGG + Intronic
903349741 1:22710688-22710710 CCGCGCGCCGCCGCGAGCCCGGG - Intergenic
903349816 1:22710910-22710932 CCGGGCGGGAGCGCGCGCCCCGG - Intronic
904528844 1:31155123-31155145 TCGGGCGCGGGCGCGGGCGCGGG + Intergenic
904724834 1:32539530-32539552 CCGGTCGCGCGCGCGGGCCGAGG - Exonic
904744523 1:32702784-32702806 CCGGGCGCGCCCACTTGGCCGGG + Exonic
904773323 1:32893119-32893141 CCGGGCTGGCACCCGGGCCCAGG - Intronic
905580892 1:39082010-39082032 AGGGGCGCGCCCGCGAGCCTGGG - Intronic
906614606 1:47225707-47225729 CTGGGCGCGCGCGGAGGCCCGGG - Exonic
906769602 1:48472135-48472157 CCAGGCTGGACCGCGGGCCCCGG - Exonic
906805549 1:48776532-48776554 CCGGGAGGGGCCGGGGGCCCGGG - Intronic
906961321 1:50421007-50421029 GCGGGAGCGCCCGCGGGGACCGG - Exonic
907160588 1:52366117-52366139 CCCTGGGCTCCCGCGGGCCCTGG + Exonic
912401472 1:109397465-109397487 CCTGCCGCGCCCGCGTCCCCCGG - Intronic
913274179 1:117121726-117121748 CCCGGGACGCCCGCGGGCTCTGG + Exonic
913654088 1:120944883-120944905 ACGCGCGCGTCCGCTGGCCCAGG + Intergenic
916219855 1:162433251-162433273 CCGGCCGGCCCTGCGGGCCCGGG + Intergenic
916666951 1:166975407-166975429 CCGGCCGCGCAGGCGGGGCCGGG + Intronic
916792508 1:168136702-168136724 TGGGGCGCGGGCGCGGGCCCGGG - Intronic
917565403 1:176207351-176207373 CAGGGCGCGCCCTCGGGGTCGGG + Exonic
918215896 1:182391822-182391844 CCGGGGGCGGCCCCGGGCCGCGG - Exonic
922518222 1:226223802-226223824 CCTGCGCCGCCCGCGGGCCCCGG + Exonic
922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922836030 1:228625012-228625034 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922837707 1:228631735-228631757 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922839944 1:228640672-228640694 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922841067 1:228645144-228645166 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922841623 1:228647368-228647390 CCGGGCGCGTCCGGAGGCCTGGG + Intergenic
923193459 1:231642168-231642190 CCGGCCGGCCCCGCCGGCCCCGG - Intronic
924172453 1:241356790-241356812 GCGGGAGCGTCCGCGGGCGCAGG - Intronic
1063663615 10:8049580-8049602 CCAGGCGCCGCCGCTGGCCCCGG - Intergenic
1064167802 10:13001610-13001632 CCCGGGGAGCCCGCCGGCCCGGG + Exonic
1064354389 10:14604284-14604306 CTGGGCGCCGCCGCGGGCGCCGG - Intronic
1064552847 10:16520740-16520762 CCGGGCCCGCCCGGGGCGCCCGG - Exonic
1065214701 10:23438881-23438903 CCGCGCGCGCTCGCGCGCCGAGG + Intergenic
1067769904 10:49115555-49115577 GCGGGCGCGAGCGCGGGCCCGGG - Intergenic
1070865486 10:79706059-79706081 CCGGGCGTGACCGCGAACCCTGG + Exonic
1070879280 10:79844190-79844212 CCGGGCGTGACCGCGAACCCTGG + Exonic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1071632386 10:87228280-87228302 CCGGGCGTGACCGCGAACCCTGG + Exonic
1071645839 10:87360498-87360520 CCGGGCGTGACCGCGAACCCTGG + Exonic
1072916558 10:99540624-99540646 CCGGCGGCGCGCGCGGGCCCGGG - Intergenic
1074721754 10:116271176-116271198 CCGGGCGAGGGCGCGCGCCCGGG + Intronic
1075375539 10:121975264-121975286 CTGTGCGCTCGCGCGGGCCCGGG - Intergenic
1075645057 10:124091893-124091915 CCAGCCGCGCCGGCCGGCCCCGG + Intronic
1075782563 10:125026661-125026683 CCGGGGGGGCCCGCTGCCCCGGG - Exonic
1076372308 10:129963605-129963627 CCGGCCGCCCCCGCGCGCCCTGG - Intronic
1076686350 10:132200064-132200086 CCGGGCACTCCAGCGGGGCCAGG - Intronic
1077008404 11:369609-369631 CCGCCCTCGGCCGCGGGCCCGGG - Intergenic
1077076368 11:704222-704244 CTGGCCTCGCCCTCGGGCCCTGG + Intronic
1077105951 11:842724-842746 CCGCGCGGGCCCGGGAGCCCCGG - Intergenic
1077264151 11:1640787-1640809 CCGGGCTCCCCCACCGGCCCGGG + Intergenic
1077269089 11:1666605-1666627 CCGGCTGCGCACGCGGGGCCAGG + Intergenic
1077271458 11:1684109-1684131 CCGGCTGCGCACGCGGGGCCAGG - Intergenic
1077329338 11:1977086-1977108 CCGGGCCCACCCCAGGGCCCAGG - Intronic
1077505884 11:2929783-2929805 CGGGAAGCACCCGCGGGCCCGGG + Intergenic
1078164509 11:8870906-8870928 CCGGGCGCGCACGCGGGAACCGG + Intronic
1078594479 11:12674664-12674686 CCCAGCGCGCCAGCCGGCCCCGG + Exonic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081812815 11:45922891-45922913 CCGAGGGCGCCCCCGGGCGCTGG + Exonic
1082003703 11:47408539-47408561 CCGGGGGCGGCCCCGGGCCGGGG + Intronic
1082028646 11:47589716-47589738 CCAGGCGCGCCCGGAGGCCGTGG + Exonic
1083430749 11:62612658-62612680 CCGGGAGAGTCCGAGGGCCCGGG - Exonic
1083670942 11:64299674-64299696 CCGTGCGGCCCCGCGGCCCCGGG + Exonic
1083922068 11:65786589-65786611 CCCGGCGCGCCCGAGGCTCCTGG - Intergenic
1083933379 11:65857923-65857945 GCGTGCGCGCCCGTGGGCGCCGG - Intronic
1084118818 11:67057060-67057082 CCGGGCGCGCGAGCGGAACCGGG - Intronic
1084186640 11:67476189-67476211 GCCGGCCCGCCCGCCGGCCCTGG + Intergenic
1084967547 11:72752415-72752437 CCGGGCGCGCCCACCCCCCCGGG + Intronic
1086043022 11:82501256-82501278 CCGGCCGGCCCTGCGGGCCCCGG + Intergenic
1086455339 11:86955033-86955055 CCGGGGGCGCCCGGGGGCGTCGG - Exonic
1089713671 11:120336325-120336347 GCGGGCGCGCGCGCGGGTTCCGG - Intergenic
1089796623 11:120986173-120986195 ACGGCCGTGCCCGCAGGCCCTGG - Exonic
1090285567 11:125496177-125496199 CCGGCCGCTCCCGCGGCCCGTGG - Exonic
1090285607 11:125496320-125496342 GCGGGCGCGCCCCCGGAGCCCGG - Intronic
1091229329 11:133977533-133977555 CAGGGCCCCCCCGAGGGCCCTGG - Intergenic
1202812317 11_KI270721v1_random:32265-32287 CCGGGCCCACCCCAGGGCCCAGG - Intergenic
1091550307 12:1531037-1531059 CCCAGCGCGGCCGCGGGGCCGGG - Intronic
1091589201 12:1833480-1833502 CCTGGCGAGCCCGTGCGCCCAGG + Intronic
1091718334 12:2795312-2795334 CCGTGCCCGGCCGCGGGCTCCGG - Intronic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1092471759 12:8787364-8787386 CCGGCCGGCCCTGCGGGCCCTGG + Intergenic
1095440795 12:42237785-42237807 GCGGGGGCGGCCGCGGGGCCCGG - Intronic
1095687234 12:45050478-45050500 CCAGCCGCGCCCGCGCCCCCAGG - Intronic
1096073574 12:48788943-48788965 CCCGCCGCCCCCGCGGGCTCCGG + Intronic
1096154829 12:49336197-49336219 CCGGGAGGGCCCGGGGGGCCTGG + Exonic
1096156745 12:49345422-49345444 CTGGCCGCTCCCGCGGGGCCGGG + Intergenic
1096482395 12:51951536-51951558 GCGGGCGCCCGCGCGCGCCCCGG + Intergenic
1096498397 12:52051491-52051513 TCGGGAGCGCACGCGGGACCAGG + Intronic
1096647586 12:53047175-53047197 ACGGGCGCGGGCGCGGGCGCGGG + Intronic
1096813760 12:54188728-54188750 CCGGGGGCGCCCGCTGGCTCCGG + Intronic
1097166786 12:57090202-57090224 CCGGGCGGGCCCGGTGGCTCAGG + Intronic
1097251071 12:57632608-57632630 CCGGGGGCGCCCGCCAGCACGGG - Intronic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1100260652 12:92929334-92929356 GCGGGCCCGCCCGCGGCCGCCGG + Intergenic
1100839130 12:98594078-98594100 CGGGGCTGGCCCGTGGGCCCTGG - Exonic
1100869398 12:98894871-98894893 GGGGGCGCGCGCGCGGGCCCGGG - Intronic
1101254714 12:102965749-102965771 CCCTGCTCCCCCGCGGGCCCGGG + Intergenic
1102501855 12:113358642-113358664 CCGGGCGCTGACGCGGGCGCTGG + Exonic
1103364006 12:120369315-120369337 CCGCGCTCGCCCGCGAGCCCGGG + Intergenic
1103764650 12:123271621-123271643 CCCGGCGCGCCCGCCGCCCGGGG - Exonic
1103800319 12:123533632-123533654 GCGGGCGCGGGCGCGGGCACGGG + Exonic
1104049446 12:125186154-125186176 CCGCGAGCGCCCGCGACCCCCGG + Intergenic
1110860515 13:80341036-80341058 CCGGGCGGGCGCGGGGGCCTGGG + Intergenic
1110860636 13:80341513-80341535 CGCGGGGCGCCCGCGGGGCCGGG + Intergenic
1112091734 13:96090593-96090615 CCGGGCGCACCCGGGAGCGCAGG + Intergenic
1112494676 13:99895597-99895619 GCGGGCTCGCCCGCGGGGTCTGG - Exonic
1112752559 13:102597223-102597245 CCGCCCGCGCCCCCGCGCCCGGG - Intronic
1113834755 13:113321497-113321519 CCGCCCCCGCCCGCGCGCCCAGG + Intronic
1114989056 14:28264440-28264462 CCGGGAGCGCCCCCGGGCCGCGG + Intergenic
1115320741 14:32077122-32077144 CCCGGCGCGGCGGCGGGCGCTGG + Intronic
1115545469 14:34462063-34462085 CCGGCCGCGCGCGCGGGGGCCGG - Intronic
1115761730 14:36582884-36582906 CCCGGCGCTCCCGCGGGGCCTGG - Intergenic
1116223195 14:42113712-42113734 CCCGGCCAGCCCGCCGGCCCCGG - Intergenic
1117092847 14:52267925-52267947 CCGAGCGCGCCAGCAGCCCCAGG - Exonic
1117302495 14:54443149-54443171 CCGGCCGCCCCTGCCGGCCCCGG + Intergenic
1117424498 14:55580463-55580485 GGGGGCGCGGCCGCGGGGCCCGG + Intronic
1117841947 14:59869933-59869955 GCGGGCAGGCCCGCGGCCCCTGG - Intronic
1118343299 14:64914553-64914575 CGGGGGCCGCCCGCGGGCCAAGG - Intronic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1119786911 14:77320898-77320920 CCGGGAGGGCCGGCCGGCCCGGG + Exonic
1120330969 14:83092482-83092504 CCGGCCGGCCCTGCGGGCCCCGG + Intergenic
1120881298 14:89417017-89417039 CGGGGGGCGGCCGCGGGCGCGGG + Intronic
1121253007 14:92513631-92513653 GCGGCCGCGCCCCCGGGGCCGGG - Intergenic
1121751739 14:96363377-96363399 CCCGGCGCGCCGCCGGGCGCTGG + Exonic
1122077701 14:99246452-99246474 CCAGGCGCGCCCGCAGGCCTGGG + Intronic
1122221198 14:100239931-100239953 CCGGCCGCGCGCCCCGGCCCCGG + Intronic
1122270798 14:100567789-100567811 CCGAGGCCGCCCGCGGGCCCTGG + Intronic
1122854257 14:104552562-104552584 CCGGGGGCACCCGCGAGACCTGG + Intronic
1122975034 14:105167567-105167589 CCCGGCGCGCCCACGTGGCCAGG + Intronic
1122975105 14:105167813-105167835 CCGAGCGCGGGCGCGGGCCCGGG - Exonic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1123783321 15:23646665-23646687 CTGGGGGTGCCTGCGGGCCCTGG + Exonic
1124251070 15:28106852-28106874 CCGGAGGCGGCCGCGGGGCCCGG - Intergenic
1126281666 15:46958952-46958974 CCGGGCGCGGTGGCGGGCGCCGG - Intergenic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1127606485 15:60592358-60592380 CCGGGCGCCCCGCCGGGGCCGGG - Intronic
1127763598 15:62164512-62164534 CCGGCCACCCCCGCGGCCCCCGG - Exonic
1128115494 15:65102395-65102417 CCGGGCTCCCCGGCGAGCCCCGG - Exonic
1128424117 15:67521808-67521830 GCGGGCGCGTCCTCGGGCCTAGG + Intronic
1128987348 15:72231027-72231049 CCCGGCGCGCCGGCCGGCCCCGG - Exonic
1129644849 15:77420265-77420287 ACGCGCGCGCTCACGGGCCCCGG + Intergenic
1129711032 15:77820267-77820289 CCGGCCCCACCCGGGGGCCCCGG + Intronic
1129814709 15:78541153-78541175 CCTGGAGAGCCCGCGTGCCCAGG - Intronic
1131097481 15:89665746-89665768 CCCGGCGCGCCCCCCGGCCCGGG - Exonic
1131515284 15:93072882-93072904 CCGGCCGGGCGCGCGGGGCCGGG - Intronic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132320031 15:100919137-100919159 CCGGAAGGGCCCGCGGACCCCGG + Intergenic
1132398222 15:101489551-101489573 CGGGGGGCGCCGGCGGGCCCGGG - Exonic
1132527728 16:425932-425954 CAGGGCGCGGCGGCGGGCGCGGG - Exonic
1132559908 16:588964-588986 GCGGCTGCGTCCGCGGGCCCCGG - Intergenic
1132574755 16:659278-659300 CCGGGGGAGCTCGCTGGCCCTGG - Exonic
1132578754 16:675745-675767 CCGGCCGCGGCCGCCGACCCCGG + Exonic
1132611324 16:817695-817717 CCGGGCGGCCCCACGGGGCCCGG + Intergenic
1132744438 16:1430843-1430865 GCTGGCTCGCCCCCGGGCCCCGG - Intergenic
1132778868 16:1612314-1612336 CCCCGCGCGCCCGCGCACCCCGG + Exonic
1132838061 16:1964582-1964604 GCGGGGGGGCCCGGGGGCCCTGG - Exonic
1132843537 16:1989947-1989969 CCGGGAGCGCGCGCCGGCCGCGG - Exonic
1133029733 16:3004659-3004681 ACGAGCGCGCCCACGGGCCCAGG - Intergenic
1133784486 16:8963725-8963747 CGCGGCGGGCCTGCGGGCCCTGG + Intronic
1135751080 16:25059173-25059195 CCGGCCGGCCCTGCGGGCCCCGG - Intergenic
1136111082 16:28063823-28063845 CCGGGCGCGGGCGGGGGCCTGGG + Intergenic
1137530905 16:49278249-49278271 CCAGGCGCGGCCGCCGGCCCAGG - Exonic
1138178708 16:54928780-54928802 CCGCGCGGGCGCGCGGGCCGCGG + Intergenic
1138450814 16:57092678-57092700 TCGGCCGGGCCCGCGGGCGCGGG - Exonic
1138450904 16:57092974-57092996 CGGGGCGCCCCCGCGTGGCCGGG - Intronic
1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG + Intronic
1141430617 16:83968787-83968809 CCCGCCGCCCCCGCGGACCCCGG + Exonic
1141608662 16:85169483-85169505 CCCGGGGCGCGCGGGGGCCCGGG + Intergenic
1141639963 16:85335305-85335327 CCGGGAGCAGCCCCGGGCCCGGG + Intergenic
1141709286 16:85688714-85688736 CAGGGCGAGCCCGCGACCCCGGG + Intronic
1142156147 16:88533624-88533646 CAGGGCGCGGGCGCGGGCGCCGG + Exonic
1142156205 16:88533861-88533883 CCGCGCTCGTCCCCGGGCCCCGG + Exonic
1142204842 16:88778006-88778028 CCGGGAGCTCCTGCGGGCCTGGG + Intronic
1142429748 16:90019573-90019595 CAGGGGGCGCGCGCGGGCCGGGG - Intronic
1145049509 17:19648584-19648606 CCGAGCGCGGCCACGGGCCAGGG - Intronic
1146581195 17:34040114-34040136 CCCGACGCGGCCCCGGGCCCGGG + Intronic
1147139656 17:38453954-38453976 CCGGGAGCCCCCGCCGGCCGCGG + Intronic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1147792478 17:43022099-43022121 CCGGCAGCGCCCCCGGCCCCTGG - Exonic
1148183050 17:45620531-45620553 GCGGGCGCCGCCGAGGGCCCTGG + Intergenic
1148206776 17:45784373-45784395 CCGGGCCGGGCCGCGGGGCCGGG + Intronic
1148265803 17:46225160-46225182 GCGGGCGCCGCCGAGGGCCCTGG - Intronic
1148593150 17:48831405-48831427 CCGTCCCCTCCCGCGGGCCCAGG + Intronic
1148603076 17:48908657-48908679 GCGGGCGGGGCCGGGGGCCCGGG + Exonic
1148786865 17:50149827-50149849 CCGGCCTCCACCGCGGGCCCGGG - Exonic
1149849563 17:60026818-60026840 CCGGTTGCGCCCGCTGCCCCGGG + Intergenic
1149860605 17:60119706-60119728 CCGGTTGCGCCCGCTGCCCCGGG - Intergenic
1149993744 17:61396538-61396560 CCGGGCTCCCCCGCGGTCCCAGG - Intergenic
1150124681 17:62628279-62628301 CAGGGCGCGCCCGGGGAGCCAGG + Intronic
1150137665 17:62704382-62704404 CCGGGCGCAACCGCGGGGTCTGG - Intronic
1150423282 17:65056944-65056966 CCGGCCGCGGCTGCGGGCGCGGG - Intergenic
1151477901 17:74354211-74354233 CCGGCGGCGCTCGCGGGCCCTGG + Exonic
1151558774 17:74860105-74860127 CCAGGCCCGCCCGGGGGCCCTGG + Intronic
1151582407 17:74987870-74987892 CCGGGAGCCCACGCGGGGCCTGG - Exonic
1152162156 17:78675509-78675531 CCAGGCCCTGCCGCGGGCCCAGG + Exonic
1152433393 17:80261264-80261286 CCGGGCGGACCTGCAGGCCCGGG - Intronic
1152649905 17:81488034-81488056 CACGGCGCGCCCGGGGGCGCCGG - Intergenic
1152748408 17:82051625-82051647 ACGGGGGCGCGCGCGGGGCCGGG + Exonic
1153382622 18:4455446-4455468 CGCGGCGCGACCGCGGGCTCCGG + Intergenic
1153457241 18:5295317-5295339 CCGGGTGCGCCCGCGGAGCTTGG - Intronic
1153805487 18:8705922-8705944 CCGGGCGCGGCCAGGGACCCCGG - Intronic
1153900676 18:9614670-9614692 CGGGGCGCGGCCGGGGGCCCGGG - Intronic
1154218289 18:12431590-12431612 CCCGGAGCAGCCGCGGGCCCAGG - Exonic
1154447988 18:14450366-14450388 ACGGGCGCGGGCGCGGGCGCGGG - Intergenic
1156411091 18:36828940-36828962 CCGGGCGGGGCCGCGGGAACCGG - Intronic
1156489048 18:37485650-37485672 CAGGGCGCGTCGGCGGGCCCGGG - Intronic
1157095106 18:44680213-44680235 CTCCGCGCGCCCGGGGGCCCCGG + Intronic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1157464203 18:47930530-47930552 CCGGGCCCGGCCGGCGGCCCGGG + Exonic
1157544846 18:48540055-48540077 CCCGGTGAGCCCGCGGGCCGCGG + Intronic
1157566407 18:48681615-48681637 CCGGGGGTGCCAGCAGGCCCTGG - Intronic
1157610102 18:48950613-48950635 CCGGGCCCCCGCGCGCGCCCCGG - Exonic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1157761367 18:50268141-50268163 CCGGGCCCGCCCGTCGGTCCGGG + Intronic
1158962206 18:62596469-62596491 CCGGGGGCGCCCGAAGGCCCAGG - Intergenic
1159003364 18:62992227-62992249 CTGGGCGCGCCCAGGCGCCCTGG + Intergenic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1160499730 18:79395794-79395816 CCGGGCCCGCGCGGGGCCCCGGG - Intergenic
1160499733 18:79395795-79395817 CCGGGGCCCCGCGCGGGCCCGGG + Intergenic
1160631262 18:80247578-80247600 CGGGGCGCGGGCGCGGGCGCCGG - Intergenic
1160691432 19:462047-462069 CCGGCGCCGCCCGCGGGGCCGGG + Intergenic
1160805937 19:992161-992183 CCGGAAGACCCCGCGGGCCCTGG + Intronic
1160843973 19:1158633-1158655 ACGGTCGCGCCCGCTCGCCCGGG - Intronic
1160864375 19:1250551-1250573 CCGGCCGCCCCCTCGGGCCCCGG + Intronic
1160992205 19:1864414-1864436 CCGGGCCCCGCCGCGGGCGCGGG - Intergenic
1161051324 19:2165254-2165276 CCGGGCATCCCCGCGCGCCCTGG + Intronic
1161108747 19:2456836-2456858 GCGGGCCCGCCCGCGCGGCCGGG + Exonic
1161395858 19:4044535-4044557 GCGGGGGCGCCCGGGGGCCGGGG - Exonic
1161461560 19:4400573-4400595 CCGGGGGCGCGCGCGGGGGCCGG - Intergenic
1161461569 19:4400592-4400614 CCGGGGGCGCGCGCGGGGGCCGG - Intergenic
1161609136 19:5231333-5231355 ACGGGCGAGCTCTCGGGCCCTGG + Exonic
1162013166 19:7830246-7830268 CCGGCGGCGGCCGCGGTCCCGGG + Intronic
1162951315 19:14073456-14073478 CCCCGCGCTCCCGCGCGCCCTGG + Exonic
1163154452 19:15432439-15432461 GCGGGAGCGGACGCGGGCCCGGG + Intronic
1163559380 19:18009920-18009942 GCGGGCGAGCCGGTGGGCCCCGG + Exonic
1163715199 19:18869180-18869202 CAGGGCGCGGGCGCGGACCCCGG - Exonic
1163807089 19:19405941-19405963 CCGGGGTCGCCCGCGGGGCCGGG - Intronic
1163820316 19:19492736-19492758 CCAGGCGCTCCTGCTGGCCCAGG - Intronic
1165056010 19:33176731-33176753 CCGGCCGCGCTGGCGGGGCCGGG + Intergenic
1165058578 19:33194297-33194319 CCGGGCGCGGGCGAGGGGCCGGG + Intronic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165349732 19:35269178-35269200 CCGGCCGTGCCCCCGCGCCCCGG + Intronic
1165415540 19:35691321-35691343 CCGGCCGGCCCCGCCGGCCCCGG - Intergenic
1165745735 19:38228863-38228885 CCGGGAGCGCCCTCGGTCTCCGG - Intronic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1166042959 19:40214194-40214216 CCGCCCGAGCCCGCGGGCCATGG + Exonic
1166706094 19:44908841-44908863 CTCGGCGCCCTCGCGGGCCCCGG - Exonic
1166723644 19:45012132-45012154 CCAGGTGCGGCTGCGGGCCCGGG - Exonic
1166737210 19:45093242-45093264 CCGGGTCCGCCCGCCGTCCCGGG - Exonic
1166791726 19:45402733-45402755 CCGAGCTCTCCCGCGGGCTCTGG + Intronic
1166840222 19:45692711-45692733 GCGGGGTCGCCCGCGGCCCCCGG - Exonic
1167001178 19:46746438-46746460 GCGGGCGCGCAGGCCGGCCCCGG - Exonic
1167258393 19:48443979-48444001 GCGGGCGCCCCCTCGGGCCGTGG - Exonic
1168076173 19:53981983-53982005 CCGCCTGCGCCAGCGGGCCCAGG - Intronic
1168076291 19:53982442-53982464 CCCGGCGGCCCCGGGGGCCCGGG + Exonic
1168293007 19:55366126-55366148 GCGGGGGCGCCGGCGGGTCCGGG + Exonic
1168536023 19:57171917-57171939 CCGCTCGCGCCCCCCGGCCCGGG - Intergenic
1168544645 19:57240514-57240536 CCAGGTGCGACGGCGGGCCCTGG + Intergenic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
925029265 2:636722-636744 CCCGGCGCGCCCAGGGGCTCAGG + Intergenic
926012966 2:9423205-9423227 CCGGGCGGGGCCGCGCTCCCGGG - Exonic
927472102 2:23384894-23384916 CCGGGCGCGGCCGCGGAGCCAGG + Intergenic
927751454 2:25673711-25673733 CGGGGCGCGGCCGCGGGGGCGGG - Intergenic
927811878 2:26185010-26185032 CCGGGGGCGCGGGCGAGCCCGGG - Exonic
927942198 2:27111730-27111752 CCGGCCGGCCCCGCCGGCCCCGG - Intronic
927956772 2:27212312-27212334 CGGGGCGGGGCCGCGGGGCCGGG + Exonic
927997349 2:27495234-27495256 CGGGGCGGGCCCGCGCGTCCCGG - Exonic
928554594 2:32410841-32410863 CCGGGCGTGCTGGCGGGCACCGG - Intronic
928965013 2:36967019-36967041 CCCGGTGCGGCCGCGGGACCGGG + Intergenic
929033714 2:37671807-37671829 CCGGGCGCGCGCGCGGGGGGGGG + Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929604754 2:43226809-43226831 CCGGGCGGGGCCGGCGGCCCGGG + Intergenic
930651657 2:53970511-53970533 CCGGCCCGGCCCGCAGGCCCGGG + Intronic
931253868 2:60554206-60554228 CCGAGCGCAGCCGCGGGCTCGGG - Intergenic
931253931 2:60554455-60554477 TTGGGGGCGCCCTCGGGCCCCGG - Intergenic
931602676 2:64019463-64019485 GCGGGCGCTCCCCCCGGCCCGGG - Intergenic
933666875 2:84971324-84971346 CCGGGCTCGGCCGCGGGGGCGGG - Exonic
934079011 2:88452156-88452178 CCCGCCGCGCCCGCGGGGCCCGG - Exonic
935112451 2:100105227-100105249 CTGGGCGCTCCCGCGGGCGGCGG + Intronic
935746372 2:106193604-106193626 CTGGGCACGGCCGCGGGCCGGGG + Intronic
938291410 2:130152735-130152757 CCGGCCACACCCGCGGCCCCAGG - Exonic
938465133 2:131520224-131520246 CCGGCCACACCCGCGGCCCCAGG + Intergenic
939053231 2:137331870-137331892 CCGGCCGGCCCCGCCGGCCCCGG - Intronic
939898899 2:147826958-147826980 CCGGCCGGCCCCGCAGGCCCCGG + Intergenic
941020934 2:160407556-160407578 GCGGGCGCGGGCGCGGGCGCGGG + Intronic
941111607 2:161423517-161423539 CCGGGCGCGGGCGCGGGCCCCGG + Exonic
943185178 2:184598358-184598380 GCTGGCGCGGCCGCGGGTCCCGG + Exonic
944495862 2:200306861-200306883 GCGACCGCGCCCCCGGGCCCCGG + Intronic
944675783 2:202033707-202033729 CCGGGGGCGGCCCCAGGCCCCGG - Intergenic
946053986 2:216885346-216885368 CCGGCTGGCCCCGCGGGCCCTGG + Intergenic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946362823 2:219229349-219229371 ACGGGGGCGCGCGCGGGCGCCGG - Exonic
947641259 2:231708971-231708993 CCGGGCGCCCTCGGGGGCCGAGG + Intronic
948115825 2:235493985-235494007 CGGGGCGCGGGCGCGGGCGCGGG + Intergenic
948115882 2:235494159-235494181 GCGGGCTCGCGCGGGGGCCCCGG + Exonic
949080001 2:242088925-242088947 CCTGACGCGCCCGCCGCCCCCGG - Intergenic
1168802609 20:653118-653140 CGGGGGGCGCCCGAGGGGCCCGG - Exonic
1168878250 20:1185522-1185544 CCGGGCGCCCTCGCCGGCCGCGG - Intronic
1169213035 20:3778181-3778203 CCGGGCGTCCCCGCGCGGCCCGG + Exonic
1169214713 20:3786484-3786506 CCCGGCGCGCCCCCCGCCCCGGG + Exonic
1169278434 20:4248722-4248744 CCGCCCGCGCCCGCGCTCCCCGG + Exonic
1169849658 20:10035260-10035282 CCGGTCGCCCCAGCAGGCCCAGG + Exonic
1171439403 20:25148422-25148444 GCGGGTGCGCCGGCTGGCCCTGG + Intergenic
1173663597 20:44750641-44750663 CCGGGGGCGCCCGAGAGCCGTGG + Exonic
1173840418 20:46153288-46153310 CCTGGCCCGCCCGCCGGTCCTGG - Intergenic
1173865088 20:46308158-46308180 CCGGCCGCTCCCGCCGGCCAGGG + Intronic
1174287741 20:49484115-49484137 CGGGGGGCGCCGGCGGGCGCCGG + Intergenic
1175847169 20:62065233-62065255 CCTGGCAAGCCCGCCGGCCCCGG - Exonic
1176029867 20:63006737-63006759 CCCGGCGAGCCCCCGAGCCCAGG - Exonic
1176031493 20:63015174-63015196 CCGGGTGTGTCCCCGGGCCCAGG - Intergenic
1176547805 21:8209013-8209035 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176549532 21:8215078-8215100 CGGGTCGCGCCGTCGGGCCCGGG + Intergenic
1176555697 21:8253215-8253237 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1176557423 21:8259307-8259329 CGGGTCGCGCCGTCGGGCCCGGG + Intergenic
1176566748 21:8392050-8392072 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1176568457 21:8398112-8398134 CGGGTCGCGCCGTCGGGCCCGGG + Intergenic
1176574631 21:8436247-8436269 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1176576369 21:8442342-8442364 CGGGTCGCGCCGTCGGGCCCGGG + Intergenic
1176611244 21:8987539-8987561 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1178334675 21:31732292-31732314 GCGGCCGCGGCCGCGGGCCGGGG + Intergenic
1179213581 21:39348619-39348641 CCGGGCGGGCCCGCGAGTCCTGG - Intronic
1179783845 21:43718986-43719008 CCTGGCGCGGCCGCGCGGCCAGG + Intergenic
1179794676 21:43776133-43776155 CAGGGCGCGGCCGCGGCTCCTGG - Intronic
1179810096 21:43864953-43864975 CCGAGGGCGCCGGCGGGGCCGGG - Intergenic
1180559337 22:16602331-16602353 CGGGGCGGGCCCGCGGGCGGCGG + Intergenic
1180609207 22:17084947-17084969 CCCGGCCCGCCCCTGGGCCCGGG + Exonic
1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG + Intronic
1180961899 22:19766052-19766074 TCGGGCGAGGCCGCCGGCCCGGG - Intronic
1181478231 22:23181343-23181365 CCGGGACCGCCCGCAGGCCCGGG + Exonic
1181514365 22:23402671-23402693 GCCGGCGCGGGCGCGGGCCCGGG + Intergenic
1181567954 22:23751148-23751170 CCGGAAGTGCCCGCGGGCCGGGG - Intergenic
1181652968 22:24271062-24271084 CCGGGCGTCCCCGCAGACCCCGG + Intronic
1182296497 22:29313551-29313573 TCGGGCGCGCCCGCCGGCCTGGG + Exonic
1182903952 22:33920732-33920754 CCGGGAGCGCTCGCCGGCCTTGG + Intronic
1183411764 22:37659083-37659105 CCCGGCGCGTCCGGAGGCCCGGG - Exonic
1183537736 22:38412991-38413013 CCGCGGGCCCCTGCGGGCCCCGG - Intergenic
1183601692 22:38843872-38843894 GCGGGGGCGCCCGAGGCCCCCGG + Exonic
1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG + Intronic
1184101463 22:42343643-42343665 CCGCGCGCCCCGGCCGGCCCGGG + Intergenic
1184337511 22:43862436-43862458 GCGGGCGCGGGCGCGGGCGCGGG - Exonic
1184337513 22:43862442-43862464 CGGGGCGCGGGCGCGGGCGCGGG - Exonic
1184662667 22:45972474-45972496 CAAGGCGCGCCCGCTGCCCCCGG - Intronic
1184679212 22:46061435-46061457 CTGGGAGGTCCCGCGGGCCCTGG + Intronic
1184713675 22:46268185-46268207 GCGGACGCGCCCGTGCGCCCAGG - Intronic
1185232042 22:49688969-49688991 CCGGGCACAGCCTCGGGCCCAGG - Intergenic
1185255204 22:49827760-49827782 GCGGGCGCGGGCGCGGGCGCGGG + Intergenic
1185349403 22:50326785-50326807 GCGGGCGCGAGCGCGGGCGCGGG - Intronic
1185384610 22:50526103-50526125 CCGGGCGCTGCCGCTGGCGCTGG - Exonic
1203252679 22_KI270733v1_random:125298-125320 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1203254419 22_KI270733v1_random:131400-131422 CGGGTCGCGCCGTCGGGCCCGGG + Intergenic
1203260735 22_KI270733v1_random:170384-170406 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1203262475 22_KI270733v1_random:176479-176501 CGGGTCGCGCCGTCGGGCCCGGG + Intergenic
949559502 3:5188395-5188417 CCTGGCGCCCTCGGGGGCCCCGG - Intronic
950632633 3:14293309-14293331 CCGGCGGACCCCGCGGGCCCCGG + Intergenic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
951543635 3:23806121-23806143 CCGGCCGCGCCGCCGGGCCTCGG + Intronic
952241367 3:31533461-31533483 CCGGGCGCGCCCCCTGCCCGTGG + Intronic
952889253 3:38029808-38029830 CGGGGCGCGCCCGCTGGCCCGGG - Intergenic
955228459 3:57079361-57079383 CCGGGGACCCCCGCGGGCGCCGG + Intergenic
956414597 3:69013321-69013343 CCCGGAGCGCAGGCGGGCCCCGG - Intronic
960586161 3:119322991-119323013 CCGGGCGGGCGCCCGGACCCCGG - Intronic
961260077 3:125595296-125595318 CCGGCTGCGCGCGCCGGCCCTGG - Intergenic
961377280 3:126475501-126475523 CCGGCCGCCCCCCCCGGCCCTGG - Exonic
961402044 3:126654646-126654668 GCCGGGGCGCCCGCGGGTCCCGG - Intronic
961698917 3:128726472-128726494 CCGGGTGTGCCCGCGTGGCCAGG - Intronic
961827616 3:129606956-129606978 CAGGACCCGCCCGCGGCCCCAGG + Intergenic
962998126 3:140651522-140651544 CCGGCCGGCCCCGCCGGCCCAGG + Intergenic
963168042 3:142225175-142225197 CCTGCAGCACCCGCGGGCCCTGG - Intronic
963253210 3:143120520-143120542 CCGGGCGCGCCCTCGGCTCCAGG + Exonic
963589987 3:147245828-147245850 CCGGCCGGCCCCACGGGCCCCGG - Intergenic
964227907 3:154428765-154428787 CCGGGTGCGCCCGCTGCCGCTGG - Exonic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
968161641 3:196432028-196432050 CCGTCCGCCCCCGCCGGCCCGGG - Intronic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
968504890 4:967160-967182 CCGGGCTCTGCCGCGGGCCCAGG - Exonic
968506425 4:973304-973326 CCCGGCGCGGCAGCGGGGCCCGG + Exonic
968766089 4:2469819-2469841 CCGGGCGCGCTTCCGGGCCCCGG + Intronic
969240357 4:5893073-5893095 CCGGGCGCGACTGCGGCCCAGGG + Intergenic
969288308 4:6222086-6222108 CCGGGCGCAGCGGCGGGCGCCGG + Intergenic
969362626 4:6674310-6674332 CCGGGCGCGCTCGCGCTCCAGGG - Intergenic
969532159 4:7736125-7736147 CCGGGAGCTCCCGAGGGCACAGG - Intronic
969778925 4:9381128-9381150 CCGGGTGCCCCCGCTGGGCCCGG - Intergenic
974747906 4:66100091-66100113 CTGGGCGCGGCGGCGGGCGCCGG + Intergenic
975778926 4:77819520-77819542 GCGCGCCCGCCCGCGAGCCCCGG - Intronic
976608695 4:87007104-87007126 CCGGGGGCGCTCGCTTGCCCCGG + Intronic
977941957 4:102868950-102868972 GCGGGCGGGGCGGCGGGCCCTGG - Intergenic
978503579 4:109433951-109433973 GCCGCAGCGCCCGCGGGCCCGGG + Exonic
981044423 4:140252728-140252750 GGGGGCTCGCCCGCCGGCCCGGG + Intergenic
983940230 4:173529403-173529425 CCGGGCGGGCCCGGGCGCCCGGG - Exonic
984462870 4:180058694-180058716 CCGGGCGGGGGCGCGGGGCCGGG - Intergenic
985068403 4:186144876-186144898 CCGGGCGCGCCCGGGGTCCGCGG - Exonic
985068425 4:186144925-186144947 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068427 4:186144931-186144953 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068429 4:186144937-186144959 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985129099 4:186723882-186723904 CCGGCCCCGCCCGCCGGCGCCGG + Intronic
985445547 4:190019379-190019401 CCGAGCGTGCCCACGGGCCCCGG - Intergenic
985641768 5:1066759-1066781 CCAGGGTCGCCCGGGGGCCCAGG + Intronic
986858948 5:11904233-11904255 CCGGGCGCCGCGGCGGCCCCAGG - Intergenic
990210789 5:53480239-53480261 CCGGCAGCGCCGGCGCGCCCGGG - Intergenic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
994171404 5:96662603-96662625 CCCGGCGCCCCCGCGGGGCAGGG + Intronic
995853994 5:116574156-116574178 TGGGGCGCGCCCGGGCGCCCGGG + Intronic
997453921 5:134004283-134004305 CCGGCGGCGCCCTCTGGCCCTGG - Intronic
998166717 5:139848470-139848492 CCGGGCCCGGGCCCGGGCCCGGG + Exonic
999223541 5:150000974-150000996 CCGGGCGGGGCCGCGGGGCCGGG + Exonic
1000071412 5:157743982-157744004 CGGGGCGCGGCCGCGGGCTCTGG + Exonic
1001773413 5:174312020-174312042 CCCCGCGCCCCCGCGCGCCCGGG - Intergenic
1002140224 5:177133508-177133530 CCGGGCCGGCCCGTAGGCCCCGG + Intronic
1002417314 5:179127270-179127292 CCGGGGGTGCCCAGGGGCCCTGG + Intronic
1002508771 5:179699070-179699092 ACGGGCACCCCCGCGGTCCCCGG + Exonic
1002900038 6:1402580-1402602 CCGGGGCCGCCCGCAGGACCGGG + Intergenic
1002926768 6:1609687-1609709 CCGGGCGCCGGCGCGGGCGCAGG + Intergenic
1002927280 6:1611682-1611704 CAGGGCGCGCCCGGGGGCGCGGG + Exonic
1003840384 6:10113399-10113421 CCCGGCGCCCCCGCTGGGCCAGG - Intronic
1003901581 6:10659985-10660007 CCGGGCGACCCCGCCGGCCTTGG + Intergenic
1004229068 6:13814559-13814581 CCGGGCGCGCGGGCGGGGCTCGG + Exonic
1004615057 6:17281456-17281478 CCGGGCTCGCCCTTGGCCCCCGG + Exonic
1004906202 6:20239162-20239184 CCGGCCGGCCCCGCCGGCCCCGG + Intergenic
1006926463 6:37658180-37658202 CCTGGGGCGCCCTCTGGCCCGGG + Intronic
1007656856 6:43455674-43455696 CCCGGCGCGCCCCGGGGCCCCGG + Intronic
1012245763 6:96924430-96924452 CAGCGCGCGCCCGCCGGTCCCGG - Intergenic
1012916888 6:105180026-105180048 CCGGGCACGGGCGCGCGCCCCGG + Intergenic
1012939669 6:105403214-105403236 CCGGCCGCGCCCGCGCCGCCCGG + Intergenic
1013170747 6:107634735-107634757 CCGCCCGCGCCCGGGGGGCCCGG - Exonic
1013372467 6:109482992-109483014 CCAGTCGGGCCCGCGGGGCCTGG - Intronic
1014240729 6:119015423-119015445 CCGGCCGGCCCTGCGGGCCCCGG + Intronic
1014778167 6:125533977-125533999 CCGCACTCTCCCGCGGGCCCCGG + Intergenic
1015149257 6:130019942-130019964 CCGGGTGCGGGCGCGGGCGCGGG + Intronic
1016014243 6:139167209-139167231 CCGGGAGCGCCCGGTGGCACAGG - Exonic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1016386827 6:143537280-143537302 CCCGGGGCGCCCGCGGGCACTGG + Intronic
1017103315 6:150866459-150866481 CTCGGCGCGCCGGCTGGCCCGGG + Intronic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1017206509 6:151808499-151808521 CCGGGCTGGGCCGCGCGCCCCGG - Intronic
1017793652 6:157823114-157823136 CGGGCCGCGGCCGAGGGCCCAGG + Intronic
1017954830 6:159169307-159169329 CGGGTCGCCCCCGCCGGCCCTGG + Intergenic
1018690736 6:166342369-166342391 CCGGGGCTGCCCGCTGGCCCCGG - Intronic
1018959920 6:168441059-168441081 GCGGGCGCGGCAGCGGGCGCTGG + Intergenic
1019198650 6:170296628-170296650 CCGGCCCCGCCCGCCGACCCCGG - Intronic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1019944282 7:4314199-4314221 CCGGCCGGCCCTGCGGGCCCCGG - Intergenic
1019989629 7:4682492-4682514 CCGGGCGCGATCGCGGGCGCGGG + Exonic
1020086250 7:5312464-5312486 CCGGGCACGGCCGAGGGGCCGGG - Intronic
1020274304 7:6615522-6615544 CCCGCCGCGCCCCCGCGCCCCGG - Intergenic
1020274353 7:6615646-6615668 CTGGGCTCGCCCGCCCGCCCGGG - Exonic
1020274355 7:6615647-6615669 CCGGGCGGGCGGGCGAGCCCAGG + Exonic
1020889891 7:13866303-13866325 CCGGGCGTGGCGGCGGGCGCCGG - Intergenic
1021653597 7:22854144-22854166 CCCGCCCCGCCCGCGGGGCCCGG - Intergenic
1022207611 7:28179786-28179808 CCGCCCGCGGCCGCCGGCCCCGG + Intronic
1022923292 7:35037261-35037283 AGGGGCGCGCGCTCGGGCCCCGG + Intronic
1024969382 7:55054502-55054524 CCTGGCGCGCCCGCGGGGCCTGG + Intronic
1025208055 7:57004608-57004630 CCGGGCACGGCCGAGGGGCCGGG + Intergenic
1025663898 7:63572267-63572289 CCGGGCACGGCCGAGGGGCCGGG - Intergenic
1026360467 7:69598129-69598151 CTGGCCGCGCTCGCGAGCCCAGG - Intergenic
1026806913 7:73434536-73434558 CCGGGAGGGCGCGCGGGCCGCGG - Exonic
1027138290 7:75639439-75639461 CCGTGCGAGCCCGGGGGCCGCGG - Intronic
1027238022 7:76309698-76309720 CCGGCCGGCCCCGCCGGCCCCGG - Intergenic
1027244530 7:76358478-76358500 CCCGGCGCGGGCGCGGGCCGGGG - Intronic
1027421135 7:78019425-78019447 CCGGCCGGGCCCGCGACCCCCGG - Exonic
1029465249 7:100721009-100721031 CTGGGCGCTCCCGCCCGCCCGGG + Intronic
1029597165 7:101544021-101544043 CCGGGGGGGCCTGCAGGCCCTGG - Exonic
1030121214 7:106112318-106112340 CCGGGCTCGGAGGCGGGCCCGGG + Intronic
1032074566 7:128830335-128830357 CCCGCCGCGCCCGCGGCCCCCGG - Intergenic
1032151647 7:129434491-129434513 GCGGGCGGGCCCCCGGTCCCAGG - Exonic
1033312434 7:140271566-140271588 CCGGCCGGCCCCGCAGGCCCGGG - Intergenic
1034218013 7:149422566-149422588 CAGGGCGCGCCGGCGGCCCACGG - Intergenic
1034306297 7:150047704-150047726 CCGCCTGCGCCCGCGGGCCGAGG + Intergenic
1034324615 7:150219792-150219814 CGGGGCTCTCCCGCGGGCGCTGG - Intergenic
1034617906 7:152435488-152435510 CGGGGCGGGCCCGCGGGCGGTGG - Intronic
1034768579 7:153749439-153749461 CGGGGCTCTCCCGCGGGCGCTGG + Intergenic
1034800550 7:154052949-154052971 CCGCCTGCGCCCGCGGGCCGAGG - Intronic
1035212265 7:157337178-157337200 CCGGGCGCGCGCGGGGCCCTAGG - Intronic
1035265159 7:157686010-157686032 CCGCGCGGGGCCGCGGGACCTGG + Intronic
1035538039 8:407190-407212 CCTGACGCGCCCGCCGCCCCCGG - Intronic
1035538068 8:407276-407298 CCTGACGCGCCCGAGGCCCCCGG - Intronic
1036276371 8:7355089-7355111 CCGGATGCCCCCGCTGGCCCCGG - Intergenic
1036562242 8:9906891-9906913 CCGGGCGCGCTGGAGGGCTCCGG - Intergenic
1036739501 8:11347851-11347873 CCGGGCGCGCGCAGGGTCCCCGG + Intergenic
1037977660 8:23224831-23224853 CAGGGCGCGCCCCAGGACCCAGG - Exonic
1038554122 8:28494565-28494587 CCAGCCGCCACCGCGGGCCCGGG - Intronic
1041059393 8:54021921-54021943 CCCGCCGCGCCCGCGTCCCCGGG - Intronic
1041068172 8:54101966-54101988 CCGCGCGCGCCCGCGCGTCCAGG + Exonic
1042962945 8:74321704-74321726 CCGCGCGCGCCCGCCTGCCGAGG - Intronic
1043502983 8:80874407-80874429 CCGGCTGCGCCCGCGCGCTCCGG + Intronic
1045047583 8:98294109-98294131 GCGGTGGCGCCCGCGGGCCCCGG - Exonic
1045305452 8:100952801-100952823 CCGGGAGGGGCCGCGCGCCCCGG - Intronic
1045367857 8:101493369-101493391 CCGGCCGCCCCCGCGCCCCCCGG - Intronic
1049585120 8:143429418-143429440 CCGGCCCCGCCCGCGCTCCCGGG + Exonic
1049654594 8:143792048-143792070 CCAGGGGCCCCCGCGTGCCCCGG + Exonic
1049672522 8:143876304-143876326 CCGGGCGCGCCTGCTGGCTCAGG - Intronic
1049801073 8:144517781-144517803 CCGGGCGGGCGCGCGCGCCATGG - Exonic
1051174364 9:14347883-14347905 CCGAGCGCGCGCGCGCGCCAGGG + Intronic
1053435168 9:38069303-38069325 CGGGGCGCGCGAGCGGGCTCCGG - Intergenic
1056743731 9:89282524-89282546 CCGGCCGCCCCTGCCGGCCCTGG + Intergenic
1058908186 9:109498148-109498170 CCGAGCGCGACCCCGGCCCCCGG + Intronic
1059176606 9:112174811-112174833 CTGGGCGCGAGCGCGGACCCGGG - Intronic
1059305414 9:113349814-113349836 CCAGGCGCGCCCGGGGTCTCCGG - Intronic
1059791165 9:117642989-117643011 CCGGCCGGCCCCGCCGGCCCGGG - Intergenic
1060478081 9:124000066-124000088 CCCGGCCCGCCCGAGGGCCCTGG + Intergenic
1061190786 9:129081440-129081462 CAGGGCGCTCCCCCGGGTCCCGG + Intronic
1061242715 9:129383672-129383694 CCGGGCGCGCCCGGGTGCGCAGG - Intergenic
1061506809 9:131036280-131036302 CCAGGACCGCCCGTGGGCCCGGG + Exonic
1061840551 9:133356458-133356480 CCGGAAGCGCCCGCGGGGCCGGG - Exonic
1062305840 9:135906934-135906956 CCGGCCGCGTCCCCCGGCCCCGG + Intronic
1062318956 9:135981219-135981241 CAGGGGGCACCCACGGGCCCTGG - Intergenic
1062341311 9:136094997-136095019 CCGGGCGTGCGCGCGGGAACCGG - Intronic
1062435749 9:136545943-136545965 CCGGGCGCGGAGCCGGGCCCGGG - Intergenic
1062460103 9:136659424-136659446 CCAGGCGCGGCCGCGGGAGCCGG - Exonic
1062472530 9:136712736-136712758 CGGTGCGCGCCCGCCGCCCCCGG + Intronic
1062556078 9:137114050-137114072 CCGGGCGGGGTCGCGGGGCCGGG - Intronic
1062558795 9:137129999-137130021 CCGGGCGCCTCCCCGGGTCCCGG - Intergenic
1062596235 9:137301140-137301162 CAGGACCCGCCCGCAGGCCCGGG - Exonic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1203469082 Un_GL000220v1:108449-108471 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1203470820 Un_GL000220v1:114544-114566 CGGGTCGCGCCGTCGGGCCCGGG + Intergenic
1203476903 Un_GL000220v1:152421-152443 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1203478641 Un_GL000220v1:158516-158538 CGGGTCGCGCCGTCGGGCCCGGG + Intergenic
1186987424 X:15031935-15031957 CCGGGCGCGATGGCGGGCGCTGG + Intergenic
1187698031 X:21940657-21940679 CCGGCCCCGCCCCCGCGCCCCGG + Exonic
1187904650 X:24054639-24054661 CCCGGCGCGCGCGCTGGCCTGGG - Intergenic
1190024862 X:46913194-46913216 CAGGGCGCGCCCTCGCTCCCTGG - Intronic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1192533718 X:71911064-71911086 CCGGCCGCGGGCGCGGGCGCAGG - Intergenic
1197745970 X:129932405-129932427 CGGGGCGCGGCCGCGGGGCGGGG - Intergenic
1199285109 X:146046419-146046441 GCCGGCGGGCCCGCAGGCCCCGG - Intergenic
1199595855 X:149505265-149505287 CCGCCCGGGCCCGCAGGCCCGGG + Intronic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200163245 X:154019772-154019794 CCGGGGGAGCCCGCAGCCCCCGG - Exonic
1200173653 X:154097309-154097331 ACAGGGGCGCCCGCGGGGCCGGG + Intronic