ID: 1165080415

View in Genome Browser
Species Human (GRCh38)
Location 19:33303166-33303188
Sequence CGGGGTCCTAGCGCCCTGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165080415_1165080427 5 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080427 19:33303194-33303216 AGCGGAGGCGGCCTCGGCCCGGG No data
1165080415_1165080425 -1 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080425 19:33303188-33303210 GCGGGGAGCGGAGGCGGCCTCGG No data
1165080415_1165080434 25 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080434 19:33303214-33303236 GGGAGCCTGGAGGACCTGGCCGG No data
1165080415_1165080431 21 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080431 19:33303210-33303232 GCCCGGGAGCCTGGAGGACCTGG No data
1165080415_1165080426 4 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080426 19:33303193-33303215 GAGCGGAGGCGGCCTCGGCCCGG No data
1165080415_1165080420 -10 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080420 19:33303179-33303201 TAGGACCCCGCGGGGAGCGGAGG No data
1165080415_1165080421 -7 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080421 19:33303182-33303204 GACCCCGCGGGGAGCGGAGGCGG No data
1165080415_1165080429 15 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080429 19:33303204-33303226 GCCTCGGCCCGGGAGCCTGGAGG No data
1165080415_1165080428 12 Left 1165080415 19:33303166-33303188 CCGCGCAGGGCGCTAGGACCCCG No data
Right 1165080428 19:33303201-33303223 GCGGCCTCGGCCCGGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165080415 Original CRISPR CGGGGTCCTAGCGCCCTGCG CGG (reversed) Intergenic
No off target data available for this crispr