ID: 1165084470

View in Genome Browser
Species Human (GRCh38)
Location 19:33333977-33333999
Sequence TGAGTTTACCAGAACCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165084470_1165084471 10 Left 1165084470 19:33333977-33333999 CCAGCTGGGTTCTGGTAAACTCA No data
Right 1165084471 19:33334010-33334032 TTCATTAATTCTCTCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165084470 Original CRISPR TGAGTTTACCAGAACCCAGC TGG (reversed) Intergenic
No off target data available for this crispr