ID: 1165089281

View in Genome Browser
Species Human (GRCh38)
Location 19:33374128-33374150
Sequence GACGGGCGGCGCCGCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 150}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165089281_1165089292 9 Left 1165089281 19:33374128-33374150 CCAGCGCTGCGGCGCCGCCCGTC 0: 1
1: 0
2: 2
3: 30
4: 150
Right 1165089292 19:33374160-33374182 GCTGCCCGGGGCGCCCCTCGCGG 0: 1
1: 0
2: 1
3: 20
4: 177
1165089281_1165089295 13 Left 1165089281 19:33374128-33374150 CCAGCGCTGCGGCGCCGCCCGTC 0: 1
1: 0
2: 2
3: 30
4: 150
Right 1165089295 19:33374164-33374186 CCCGGGGCGCCCCTCGCGGCGGG 0: 1
1: 0
2: 2
3: 21
4: 237
1165089281_1165089297 17 Left 1165089281 19:33374128-33374150 CCAGCGCTGCGGCGCCGCCCGTC 0: 1
1: 0
2: 2
3: 30
4: 150
Right 1165089297 19:33374168-33374190 GGGCGCCCCTCGCGGCGGGCCGG 0: 1
1: 0
2: 3
3: 30
4: 191
1165089281_1165089286 -4 Left 1165089281 19:33374128-33374150 CCAGCGCTGCGGCGCCGCCCGTC 0: 1
1: 0
2: 2
3: 30
4: 150
Right 1165089286 19:33374147-33374169 CGTCGACCCCCGCGCTGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1165089281_1165089293 12 Left 1165089281 19:33374128-33374150 CCAGCGCTGCGGCGCCGCCCGTC 0: 1
1: 0
2: 2
3: 30
4: 150
Right 1165089293 19:33374163-33374185 GCCCGGGGCGCCCCTCGCGGCGG 0: 1
1: 0
2: 2
3: 20
4: 205
1165089281_1165089287 -3 Left 1165089281 19:33374128-33374150 CCAGCGCTGCGGCGCCGCCCGTC 0: 1
1: 0
2: 2
3: 30
4: 150
Right 1165089287 19:33374148-33374170 GTCGACCCCCGCGCTGCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 70
1165089281_1165089285 -5 Left 1165089281 19:33374128-33374150 CCAGCGCTGCGGCGCCGCCCGTC 0: 1
1: 0
2: 2
3: 30
4: 150
Right 1165089285 19:33374146-33374168 CCGTCGACCCCCGCGCTGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 102
1165089281_1165089298 18 Left 1165089281 19:33374128-33374150 CCAGCGCTGCGGCGCCGCCCGTC 0: 1
1: 0
2: 2
3: 30
4: 150
Right 1165089298 19:33374169-33374191 GGCGCCCCTCGCGGCGGGCCGGG 0: 1
1: 1
2: 1
3: 23
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165089281 Original CRISPR GACGGGCGGCGCCGCAGCGC TGG (reversed) Intronic
900109860 1:1000784-1000806 CACGGGTGGCCCCGCAGAGCAGG + Intergenic
900255033 1:1693435-1693457 GGGGGGCGGGGCCGCCGCGCGGG + Intronic
900263776 1:1746701-1746723 GGGGGGCGGGGCCGCCGCGCGGG + Intergenic
900342402 1:2195108-2195130 GAGAGGCGGCTCCGCAGAGCCGG - Intronic
900458589 1:2789507-2789529 GACGGGCGGCCCCACCACGCAGG - Exonic
900524364 1:3121258-3121280 GACCGGAGGCACCGCAGCCCCGG - Intronic
902601107 1:17540478-17540500 GACTGGCGGCTCCGCAGCCACGG - Intronic
903153280 1:21428198-21428220 GCCGGGCCGGGCCGGAGCGCGGG + Intergenic
904044843 1:27603065-27603087 GAGGGGGCGCGCGGCAGCGCTGG + Intronic
904199875 1:28812622-28812644 GCGGGCCGGCGCCGCAGGGCTGG + Intronic
906203496 1:43974865-43974887 GACGGGCGGCGGCGCTGCGCGGG + Exonic
908561292 1:65309456-65309478 GCCGGGCGGCTCCGCGGCGTTGG + Intronic
910760817 1:90729609-90729631 GACCCGCGGCCCTGCAGCGCGGG - Intergenic
912337538 1:108876894-108876916 GGCGGGCGGCGCAGCGGGGCGGG - Exonic
912514606 1:110210233-110210255 GGCGGGGCGCGGCGCAGCGCGGG - Intergenic
913456143 1:119033107-119033129 GAAGTGGTGCGCCGCAGCGCGGG - Exonic
915128090 1:153679519-153679541 GACCGCCGGCGCCCCGGCGCTGG + Exonic
916761312 1:167820266-167820288 GGCTGCTGGCGCCGCAGCGCCGG + Intronic
917962320 1:180154836-180154858 GGCAGGCGGTGCCGCGGCGCCGG + Exonic
920333516 1:205228716-205228738 GTTGGGCGCCGCGGCAGCGCCGG - Exonic
921355608 1:214281573-214281595 GCAGCGCGGGGCCGCAGCGCGGG - Intronic
922526700 1:226309408-226309430 GAGGCCCGGCGCCGGAGCGCGGG + Exonic
1063377203 10:5561478-5561500 GACAGGCGGCCACGCAGCGCTGG + Intergenic
1066303834 10:34119711-34119733 CACGGCCGGCGACGCAGAGCGGG - Exonic
1070835592 10:79445287-79445309 GACCGCCGGCGCCGCACCCCCGG - Exonic
1073363556 10:102918850-102918872 GAGCGGCGGCGCCACAGCCCGGG + Exonic
1076535558 10:131174502-131174524 GGCGGGCGGAGCTGCAGCGGTGG - Intronic
1076769001 10:132652936-132652958 GACGGGAGGCTCTGCACCGCAGG + Intronic
1077923012 11:6655588-6655610 GCCGGACGGCGCCCCAGCACCGG - Exonic
1078246218 11:9574535-9574557 GGCGGCCGGGGCCGCGGCGCCGG + Intronic
1079407506 11:20159139-20159161 GCAGGGCGGCGCCCCAGCCCCGG - Intronic
1080012395 11:27472219-27472241 GAGAGGCGGCGCCGCGCCGCTGG + Exonic
1082986154 11:59172566-59172588 GCCGCGCAGCGCCGCAGCCCCGG + Exonic
1083335056 11:61917419-61917441 GGCGGGCGGGGACGCGGCGCTGG - Exonic
1083885270 11:65570418-65570440 AACGGGCGGAGCCGCAGCGGAGG + Exonic
1083903017 11:65652757-65652779 GACGGGCGGCGCCGGCGAGACGG - Intergenic
1084165405 11:67372940-67372962 GACGGGCCGAGCCGCGCCGCGGG - Intronic
1090788526 11:130070175-130070197 GACCCCCGGCGCCGCACCGCCGG - Intronic
1092609145 12:10153717-10153739 GGCGTGCAGCGCCGCAGTGCGGG - Intergenic
1093711569 12:22334682-22334704 GCCTGGCGGCGCAGCAGCGCGGG - Exonic
1095986857 12:48004740-48004762 GGGGGGCAGCGCCGCAGCCCCGG - Intergenic
1096675081 12:53221807-53221829 CACGGGCAGCGCCGCGGAGCGGG + Intronic
1101023108 12:100573527-100573549 GACGCCCGGAGGCGCAGCGCTGG + Intergenic
1101479618 12:105084455-105084477 CACTGGCGACGCGGCAGCGCGGG + Exonic
1102853849 12:116277197-116277219 GCCGGGCGGCGGCGCCTCGCCGG + Exonic
1104376289 12:128267428-128267450 GGCCGGCGGCGCCGCTGTGCGGG + Exonic
1104891994 12:132144610-132144632 GCCTGGCGGCGTCGCAGGGCCGG + Intronic
1106512415 13:30422468-30422490 GACCGGCGGCCGCGCAGCTCAGG + Intergenic
1111975928 13:94967693-94967715 CACGGGCGCCGCCGCAGACCCGG + Intergenic
1113506220 13:110818290-110818312 CACGGGCAGTGCCGCAGAGCAGG - Intergenic
1113654206 13:112057938-112057960 AGCGGGCGGCTCCGCGGCGCTGG - Intergenic
1113766322 13:112882962-112882984 GGCGGGCGGAGCTGCAGTGCGGG - Exonic
1115851749 14:37595019-37595041 GACGGGCGGCCGCGCGGCGCGGG + Exonic
1121322337 14:92999359-92999381 GACGGGCAGGGCCGGAGCCCGGG - Intronic
1122045659 14:99021349-99021371 GGGGGGCGGGGCCGCAGCTCTGG + Intergenic
1122582024 14:102777239-102777261 CAACGGCGGCGCCGCGGCGCGGG - Intergenic
1122779121 14:104136263-104136285 GGCGGGCGGGGCCGGAGCGCGGG + Intergenic
1122940385 14:104978502-104978524 GAGGGGCGGGGCCGCGGCGACGG - Intergenic
1122947830 14:105021243-105021265 AACGGCCGTCGCCGCAGCGCGGG - Intergenic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1125516486 15:40323924-40323946 GAGGAGCGGCGGCGGAGCGCGGG + Intergenic
1127488112 15:59437973-59437995 GAGGGGCGGCGCCGCCAGGCTGG + Intronic
1129710914 15:77819862-77819884 GAAGGGCGGCGGCGCCGCGGAGG - Intronic
1132055651 15:98648884-98648906 GGCGGGCGGCGGCGCAGAGCCGG + Intergenic
1132055773 15:98649360-98649382 GCGGGGCGGCCCCTCAGCGCCGG - Exonic
1132480586 16:164729-164751 GGCGGGCGGGGCCGCGGGGCGGG + Intronic
1132842367 16:1984315-1984337 GACGCGCGGGGCCGGGGCGCGGG + Exonic
1134005860 16:10818526-10818548 GACGGGCGGAGCTGGAGCCCCGG - Exonic
1136364849 16:29805289-29805311 GTCAGGAGGCGCCACAGCGCTGG - Exonic
1136590528 16:31215406-31215428 GGCGGGCGGAGCCCCAGGGCGGG + Intronic
1139506246 16:67399498-67399520 GACCGGCCGGGCCGCAGAGCGGG - Intronic
1141582718 16:85011307-85011329 GCCGGGAGGAGCCGCAGCGCCGG - Exonic
1141840026 16:86568246-86568268 GGCGGGCGGCGCGGCGGCGTAGG - Exonic
1142136178 16:88453025-88453047 CAGGGGCGGGGCCGCAGCGCTGG + Intergenic
1146271431 17:31488154-31488176 GGCGGGCAGCCCCGAAGCGCAGG - Intronic
1147150353 17:38510509-38510531 GCCGGGCGGCTCCGGGGCGCGGG - Exonic
1147636352 17:41966824-41966846 GGCGGGCGGCCCCGGAGCGCTGG + Exonic
1148838390 17:50478743-50478765 GGCAGGTGGCGCCGCAGCCCCGG + Intergenic
1148936246 17:51166460-51166482 GCCGGGCGGCGGCGCTGCGCTGG - Intronic
1149849344 17:60026115-60026137 GGCGGGCGGCTGCGCAGGGCTGG - Intergenic
1149860824 17:60120409-60120431 GGCGGGCGGCTGCGCAGGGCTGG + Intergenic
1150764660 17:67993646-67993668 GCCGGGCGGCGGGGAAGCGCAGG + Intronic
1151497357 17:74466792-74466814 GAGGGGCAGGGCCGCAGGGCAGG + Intronic
1151625062 17:75271210-75271232 CACGGCGGGCCCCGCAGCGCCGG - Intronic
1152663164 17:81552309-81552331 GATGGCCGGCGCCGCGCCGCGGG - Exonic
1153382497 18:4454978-4455000 GCCGGGCTGCGCCGCGGGGCTGG - Intronic
1153457562 18:5296398-5296420 GCCCGGCGCCGGCGCAGCGCCGG + Intronic
1157833678 18:50879390-50879412 GGCCGGAGGCGCGGCAGCGCTGG - Intronic
1160575936 18:79853833-79853855 GACGGGCGCCACCCCAGGGCGGG + Intergenic
1160999840 19:1905168-1905190 GAGAGGCGGGGCCGCTGCGCTGG - Intergenic
1161015050 19:1979269-1979291 GGCGGGCGGGGACGCAGGGCGGG + Intronic
1161382140 19:3971040-3971062 TACGGCCGGCGCCGCCGCGCTGG + Exonic
1162386754 19:10364733-10364755 GAAGGACAGCGCCGCAGCCCGGG + Exonic
1162733803 19:12734619-12734641 GACGGGCGGAGCCTCAGGGCCGG - Exonic
1162745126 19:12793716-12793738 GCCGGGCAGGGCCGCGGCGCCGG + Intronic
1162954306 19:14089992-14090014 CACGGGCCGCGCCGCGCCGCCGG + Exonic
1163015219 19:14450659-14450681 GAGGGGCGGGGCCTCAGCGAGGG + Intronic
1165089281 19:33374128-33374150 GACGGGCGGCGCCGCAGCGCTGG - Intronic
1165784474 19:38453070-38453092 GAGGGGCGGGGCCACGGCGCTGG + Intronic
1168239283 19:55081280-55081302 GACGGGCGGCGCTGCAGGGGCGG - Exonic
1168719068 19:58544913-58544935 GGGGGGCGGCGCCGAGGCGCTGG + Exonic
927988200 2:27428571-27428593 GATGGGCGGTGCCGCACCGCCGG - Exonic
936512160 2:113157335-113157357 GGCGGGCGGCGGCGCAGGGCGGG - Intronic
938073101 2:128318645-128318667 GCCGGGCCGGGCCGGAGCGCGGG - Intergenic
938320085 2:130356525-130356547 GGCGGGCGGCCCTGCTGCGCTGG + Intronic
944242305 2:197498987-197499009 GACGGAAGGCGCCGCAGCTTCGG + Intronic
944579062 2:201116578-201116600 GACGCGGGGCGCGGCGGCGCAGG - Intronic
948824718 2:240568618-240568640 GACGGGCGCGGCCTCGGCGCCGG - Intronic
1168756779 20:324188-324210 GAGGTGCGGCTCCGCGGCGCGGG - Intergenic
1171013723 20:21522300-21522322 GCCGAGCGGCGCCGGAGCTCGGG - Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1175419830 20:58824252-58824274 GACGGGCAGCGCAGCTGCGCTGG + Intergenic
1177669583 21:24208665-24208687 GACTGCCGGCGCTGCAGTGCAGG - Intergenic
1180733810 22:18001198-18001220 GCCGGGAGCCGCCGCGGCGCGGG - Intronic
1180876532 22:19177658-19177680 GACGGGCGGCCCCGCTGGCCCGG - Intronic
1181457967 22:23070371-23070393 GGCGGGCGGCGCGGGAGGGCGGG + Exonic
1183517104 22:38272948-38272970 GGCGGGCGGCGCCGCAGCCCCGG + Exonic
1183702170 22:39457112-39457134 GCCGGGCTCCGCCGCCGCGCCGG - Intergenic
1183924710 22:41197524-41197546 GAGGCGGGGCGACGCAGCGCGGG + Intergenic
1183939618 22:41285990-41286012 AACAGGCGGCGCCGCCGCGTGGG + Intronic
1184086807 22:42270403-42270425 GACGGCGGGCGGCGCTGCGCGGG + Intronic
1184101509 22:42343753-42343775 CGCGGGCGGCGCCGCTGCGGTGG + Intergenic
952354283 3:32570450-32570472 GGAGGCCGGAGCCGCAGCGCGGG + Intronic
952908910 3:38165721-38165743 GTCGGACGGCGCCGGGGCGCGGG - Exonic
954401460 3:50321751-50321773 GGCTGGCGGCGCCGCGGAGCTGG - Exonic
954405028 3:50340855-50340877 GCCGGGCGGGGCCACAGGGCGGG + Intronic
961013209 3:123449175-123449197 GACGGGCGGAGCAACAGCTCCGG + Exonic
964801794 3:160565579-160565601 GATGGGCGTGGCCGCAGCGCCGG - Exonic
968372668 4:10601-10623 GACGCACGCCGGCGCAGCGCCGG + Intergenic
968372724 4:10852-10874 GACGGACGCCGCCGGGGCGCAGG + Intergenic
968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372739 4:10939-10961 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG + Intergenic
969346769 4:6575143-6575165 GAGGGGCGGGGCGGCCGCGCGGG - Intergenic
970824047 4:20252464-20252486 GCCGGGCGGCGTCGCCACGCCGG + Intergenic
973954405 4:56049019-56049041 GCCGGGCGGGGCGGCGGCGCGGG + Intergenic
975131935 4:70839740-70839762 GGCAGGCGGCGCCGGTGCGCCGG + Exonic
978340804 4:107719974-107719996 GCCGGGAGGCGCCGCAGCCCCGG + Intronic
979349278 4:119627339-119627361 GCCAGGGGGCGGCGCAGCGCGGG - Intronic
980362724 4:131762536-131762558 GATCGCCGGGGCCGCAGCGCGGG + Intergenic
983649779 4:170026466-170026488 GCCGGGCGGCGCGGAGGCGCGGG + Intronic
985068374 4:186144784-186144806 GGCGGGCGAGGGCGCAGCGCAGG + Intronic
985462652 4:190121598-190121620 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462658 4:190121627-190121649 GACGGACGCCGCCGCCGCGCAGG - Intergenic
985462662 4:190121656-190121678 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462667 4:190121685-190121707 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462672 4:190121714-190121736 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462677 4:190121743-190121765 GACGGACGCCGCCGCGGCGCAGG - Intergenic
992473112 5:77077231-77077253 GAGCGGCGGCGGCGCAGCGGGGG + Exonic
998406687 5:141878282-141878304 GCCGTGCGGAGCCGCAGCCCAGG - Exonic
999223539 5:150000973-150000995 GCCGGGCGGGGCCGCGGGGCCGG + Exonic
1002293536 5:178215389-178215411 GACGGCCAGCCCCACAGCGCAGG + Exonic
1002645145 5:180649247-180649269 GCCGGGCCGCGCCTCGGCGCAGG - Intronic
1003290857 6:4776857-4776879 GTCGGGCGGCGCGGCCGGGCCGG - Intronic
1004193963 6:13487667-13487689 GGCGCGCGGCGCTGCAGCGAGGG - Intergenic
1016923215 6:149317064-149317086 GGCGGCCGGCGGCGCCGCGCGGG - Intronic
1017696419 6:157021051-157021073 GAAGGACGCCGCCGCCGCGCAGG - Intronic
1018876504 6:167826803-167826825 GAGGTGCGGCGGCGCCGCGCGGG + Intergenic
1019157827 6:170050890-170050912 GAGGGGCGGCGAGGCAGTGCCGG - Intergenic
1029079239 7:97959257-97959279 GACGGGCGCCCCCGCGACGCGGG - Intergenic
1029506479 7:100966467-100966489 GACGGCCGGCGCCGCGCTGCTGG + Exonic
1029539112 7:101172678-101172700 GAGGGGGGGCGCAGCAGGGCTGG + Intronic
1031604312 7:123749360-123749382 GAAGGCCGGCGGCGCAGCGACGG - Intergenic
1032037433 7:128531076-128531098 GACGGGCGGCGCCGGCGGACGGG - Intergenic
1033253323 7:139778188-139778210 GAGGGGCTGCCGCGCAGCGCGGG + Intronic
1034491882 7:151397193-151397215 GACGGGAGGAGCAGCAGGGCCGG - Intronic
1034985397 7:155509990-155510012 GCCGGACCGCGCCGCAGCCCGGG + Intronic
1035074805 7:156170214-156170236 GACAGGCAGCGCCGCAGAGCTGG - Intergenic
1035262727 7:157671952-157671974 GACGGGTGGGGCAGCAGCCCTGG + Intronic
1035404116 7:158587388-158587410 GAGGGGCGGCGCCTCAGTGAGGG - Intronic
1038828505 8:31033013-31033035 GACGGGCGGCGGCGGCGTGCGGG - Exonic
1040077129 8:43247316-43247338 GAGGGGCGACGCCGCAGAGGTGG + Intergenic
1041109294 8:54470112-54470134 TCCGGGAGGCGGCGCAGCGCGGG + Intergenic
1041910707 8:63085920-63085942 GCCTGGCGGCGCTGCGGCGCCGG - Exonic
1049784608 8:144444442-144444464 GCGGGGCCGCGGCGCAGCGCGGG - Exonic
1057801269 9:98192676-98192698 GGCGGGCGGGGCCGGAGGGCGGG + Intergenic
1060182782 9:121545729-121545751 GAGGGGCTGAGGCGCAGCGCTGG + Intergenic
1061183120 9:129036715-129036737 GGCGGGCAGCGCGGCAGGGCCGG + Intronic
1061502023 9:131009436-131009458 GGTCGGCGGCGTCGCAGCGCTGG - Exonic
1061674846 9:132209848-132209870 GGCGGGAGGCGCGGCAGCGTTGG + Intronic
1061961784 9:133992404-133992426 GACGCACGGCGGCGCAGCGGGGG - Intronic
1198807303 X:140504751-140504773 CACCGGCGGCCCCGCAGCCCCGG - Exonic