ID: 1165093342

View in Genome Browser
Species Human (GRCh38)
Location 19:33397678-33397700
Sequence CAGCAAAGCCCAGTGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 7, 3: 94, 4: 386}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165093326_1165093342 23 Left 1165093326 19:33397632-33397654 CCATTCCCTTACACAGGGATCCT 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG 0: 1
1: 0
2: 7
3: 94
4: 386
1165093327_1165093342 18 Left 1165093327 19:33397637-33397659 CCCTTACACAGGGATCCTCCAGA 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG 0: 1
1: 0
2: 7
3: 94
4: 386
1165093332_1165093342 3 Left 1165093332 19:33397652-33397674 CCTCCAGACCCCAGGCTGGGTCT 0: 1
1: 0
2: 9
3: 59
4: 503
Right 1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG 0: 1
1: 0
2: 7
3: 94
4: 386
1165093338_1165093342 -7 Left 1165093338 19:33397662-33397684 CCAGGCTGGGTCTGGGCAGCAAA 0: 1
1: 1
2: 3
3: 28
4: 274
Right 1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG 0: 1
1: 0
2: 7
3: 94
4: 386
1165093328_1165093342 17 Left 1165093328 19:33397638-33397660 CCTTACACAGGGATCCTCCAGAC 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG 0: 1
1: 0
2: 7
3: 94
4: 386
1165093336_1165093342 -5 Left 1165093336 19:33397660-33397682 CCCCAGGCTGGGTCTGGGCAGCA 0: 1
1: 0
2: 6
3: 51
4: 475
Right 1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG 0: 1
1: 0
2: 7
3: 94
4: 386
1165093334_1165093342 0 Left 1165093334 19:33397655-33397677 CCAGACCCCAGGCTGGGTCTGGG 0: 1
1: 0
2: 8
3: 77
4: 656
Right 1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG 0: 1
1: 0
2: 7
3: 94
4: 386
1165093337_1165093342 -6 Left 1165093337 19:33397661-33397683 CCCAGGCTGGGTCTGGGCAGCAA 0: 1
1: 0
2: 1
3: 38
4: 298
Right 1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG 0: 1
1: 0
2: 7
3: 94
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165093342 Original CRISPR CAGCAAAGCCCAGTGGTGGG TGG Intronic
900540955 1:3202414-3202436 CAGCAAAGCCCAGTGCACAGGGG - Intronic
901086554 1:6614751-6614773 CAGCAAAGCCCGCGGGCGGGGGG - Intronic
902840419 1:19070639-19070661 CAGCAAAGGGCAGGGGTTGGTGG + Intergenic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
902924355 1:19686120-19686142 CAGCAAAGCCCAGAGAGGGGTGG + Intronic
904094431 1:27966276-27966298 CAGCAAAGCGCTGTGGTGAGGGG + Intronic
904473294 1:30748802-30748824 CCCCAGAGCCCAGTGGAGGGAGG - Intronic
904960827 1:34331549-34331571 CAGCAAAGCCCAGGGTTCTGTGG + Intergenic
905015784 1:34777456-34777478 AAGCAAAGGCCAGTTGTTGGGGG + Intronic
906091883 1:43186463-43186485 TAGCCAAGCGCGGTGGTGGGCGG + Intronic
906148133 1:43572023-43572045 CAGCACAGCTCAGTGTTAGGAGG - Intronic
907456723 1:54581108-54581130 GAGCAAAGTCCCATGGTGGGTGG + Intronic
907716967 1:56934914-56934936 CAGCAAACCCCAGTGCTGGTAGG - Intronic
907829167 1:58048074-58048096 CAGCCAAACACAGTGGTGGCAGG - Intronic
908527620 1:65002838-65002860 CAGGAAAGCGCTGTGGCGGGCGG + Intergenic
909850088 1:80450975-80450997 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
910528772 1:88211678-88211700 CAGCACAGACCATTGGAGGGTGG + Intergenic
911124414 1:94327317-94327339 CACCAAAACTCAGTGGTGAGCGG + Intergenic
911699915 1:100940909-100940931 CAGCCAAGCACAGTGGTGGCAGG - Intronic
913112161 1:115666443-115666465 CAGCAGAGCTGTGTGGTGGGAGG - Intronic
913132730 1:115856801-115856823 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
913148095 1:116012010-116012032 GGGCAAAGCCCACTTGTGGGAGG + Intronic
915031724 1:152885428-152885450 CAGCAAAGCACAGTGGCTAGCGG + Intergenic
915282713 1:154833514-154833536 CAGCTAAGTCGAGTGTTGGGTGG - Intronic
916558495 1:165912852-165912874 CATCAAAGTCCAGAGGTGGTCGG - Intergenic
916781634 1:168037171-168037193 CAGCGGGGCTCAGTGGTGGGAGG - Intronic
917892847 1:179456123-179456145 CAGCCAAGCACAGTGGTAGCAGG - Intronic
918951491 1:191145919-191145941 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
919947233 1:202328519-202328541 CAGCAAAGCCCAGGAGAGGTTGG - Intergenic
920016358 1:202912810-202912832 CAGCCAAGCACAGTGGTGGCAGG + Intronic
920498408 1:206471263-206471285 CAGCAGAGCCCTGAGGAGGGAGG + Intronic
920528081 1:206683616-206683638 CAGGAAAGGACAGTGTTGGGAGG + Intronic
920761042 1:208783999-208784021 CAACAAAGCCCAGTGGTGGTGGG + Intergenic
922233817 1:223708220-223708242 AAGCAAAGCCTGGTGGTGGACGG + Intronic
922727592 1:227930268-227930290 AAGCAGAGCCCAGGAGTGGGTGG + Intronic
923017412 1:230137445-230137467 CAGCAAAGCCAGGTGGGGAGGGG - Intronic
923135006 1:231109793-231109815 CCCCACAGCCCAGGGGTGGGTGG + Intergenic
923215138 1:231842081-231842103 GATCAAAGCCCAGTAGTGTGAGG - Intronic
924132097 1:240920691-240920713 CAGCCAAGCACAGTGGTGGCAGG + Intronic
924482569 1:244451039-244451061 GTCCAAAGCCCAGAGGTGGGTGG + Intronic
924487635 1:244501896-244501918 CAGCAGAGTCCAGTGGCCGGAGG - Intronic
1064136056 10:12751792-12751814 CAGGGAAGCCATGTGGTGGGCGG + Intronic
1065921445 10:30396854-30396876 CAGCAGGGTGCAGTGGTGGGAGG - Intergenic
1066514400 10:36140936-36140958 AATCAAAGCCCAGTAGTGGTGGG - Intergenic
1066634973 10:37491274-37491296 CAGCAGGGCCCACTGGAGGGTGG + Intergenic
1067277871 10:44850738-44850760 CAGGAAGGCACAGAGGTGGGAGG + Intergenic
1067455509 10:46416496-46416518 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1067539647 10:47142270-47142292 CAGGAAGGCCCTGGGGTGGGTGG - Intergenic
1067631695 10:47968139-47968161 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1067828584 10:49597089-49597111 CAGGAAAGCACAGAGGTGGAGGG - Intergenic
1068685725 10:59868388-59868410 CTGCATGGCCCAGTGGTGGTGGG - Intronic
1068788504 10:61001863-61001885 CCGCAAGTCCCAGAGGTGGGTGG - Intergenic
1069034026 10:63629823-63629845 CAGCAAACCCCAGTTGGGGGAGG - Intergenic
1069611235 10:69774035-69774057 CAGCAAAGCCCAGTGGCCTGGGG - Intergenic
1069906841 10:71736993-71737015 CACAAAAGCCCTGTGGTGTGAGG + Intronic
1070664186 10:78331943-78331965 CAGCAAAGGCCAGGGGTGCAAGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1073035857 10:100563784-100563806 CAGCAGAGTCAAGCGGTGGGTGG + Intergenic
1073080046 10:100853986-100854008 ACCCAAAGCTCAGTGGTGGGTGG + Intergenic
1073204529 10:101761908-101761930 GAGCAAATGCCAGGGGTGGGGGG + Intergenic
1073303915 10:102487925-102487947 CAGAAAAGCCAAGTCGTGGCCGG - Intronic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1074187923 10:111113210-111113232 CTGGAAAGTCCAGAGGTGGGTGG + Intergenic
1074346226 10:112688926-112688948 CAGGAAAGCCCAGCAGTGTGTGG + Intronic
1074868028 10:117556120-117556142 CTGCAAACCCAAGAGGTGGGTGG + Intergenic
1075045978 10:119147021-119147043 CAGCAAACCCCAGGGGAGGCAGG - Intronic
1076576586 10:131473852-131473874 CAGGTAAGCCCAGTGCTGAGAGG + Intergenic
1077002548 11:331520-331542 CAGCAAAGCCAAGAGCAGGGAGG + Intergenic
1077110406 11:859711-859733 CAGCACAGCCCGGTGGAGGGCGG - Intronic
1077274119 11:1695454-1695476 CAGCAAAGCCCAAAGGTGGGGGG + Intergenic
1077651016 11:3972700-3972722 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1077803933 11:5571146-5571168 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1078692812 11:13598784-13598806 CAGCAAACCCCAGTGGGAGATGG - Intergenic
1079118137 11:17653674-17653696 CGGCCCAGCCCAGTGCTGGGGGG + Intergenic
1079359133 11:19755953-19755975 CTGCACAGCCTAGTGGTGGCTGG + Intronic
1080824525 11:35836839-35836861 CAGGCAAGCCCACTGTTGGGTGG - Intergenic
1080989388 11:37511897-37511919 CAGCCAGGCCCAGTGTTGAGGGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081710493 11:45212687-45212709 CAGTCAAGGCCCGTGGTGGGTGG - Intronic
1081929286 11:46857571-46857593 CTCCAAAGTCCTGTGGTGGGAGG - Exonic
1082998843 11:59273691-59273713 CAGAAAAGCCCAGTTGGGGGTGG - Intergenic
1083479322 11:62933655-62933677 CACCAAGGCCGAGAGGTGGGGGG + Intergenic
1083775039 11:64890485-64890507 GAGCACAGCCCTGTGGTTGGTGG - Intergenic
1084150826 11:67287192-67287214 CAGCAAAGCCCTGTGTGGAGTGG - Intergenic
1084400937 11:68942497-68942519 GAGCAAAGCCCAGAGCTGGCAGG - Intergenic
1084462518 11:69303814-69303836 CAGCGAAGACCAGTGGTGGTCGG + Intronic
1085161966 11:74355810-74355832 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1085393484 11:76194479-76194501 CAGCTTGCCCCAGTGGTGGGGGG - Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088970843 11:114773483-114773505 AAGCCAAGCCCAGAAGTGGGGGG - Intergenic
1089262739 11:117233233-117233255 CAACATAGCCCAGGGCTGGGGGG - Intronic
1089286822 11:117412745-117412767 CAGCTAAGCCCAGTCCTGAGAGG - Exonic
1090276720 11:125425304-125425326 CAGCACTGCCCAGTCGTGTGAGG + Intronic
1090615164 11:128507587-128507609 CAGCAAACCCCAGAGGTGCATGG + Intronic
1090992049 11:131826635-131826657 GAGCAAAGGCCAGGAGTGGGAGG + Intronic
1091240186 11:134046890-134046912 CAGCAATGCCCAGAGGTCTGCGG - Intergenic
1091402023 12:186922-186944 CAGCAGAGGGCAGTGGTTGGGGG - Intergenic
1093236290 12:16611401-16611423 CAGCAAAGCCCAGAGGAGCTGGG - Intergenic
1094008116 12:25777230-25777252 CAGCAAAGCACAGTGGAAGATGG + Intergenic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096522907 12:52194175-52194197 AAGCAAAGCCCCCTGGTGTGGGG - Intergenic
1096826735 12:54284623-54284645 CAGCCAAGCACAGTGGTGGCAGG + Exonic
1097041806 12:56160451-56160473 CAGCCCAGCCCAGGAGTGGGAGG + Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097743481 12:63272421-63272443 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1098199264 12:68037261-68037283 CAGCCAAGCACAGTCGTGGTAGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100256113 12:92884782-92884804 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1100657116 12:96659165-96659187 CATCAGATCCCAGAGGTGGGGGG + Intronic
1101388572 12:104279408-104279430 TAGCAAAGCCCTGTGGTGGGAGG + Intronic
1101433481 12:104645654-104645676 CAGCTAAGCCAAGGGGAGGGTGG - Intronic
1101506383 12:105350354-105350376 GAGCAGAGCCCAGGGCTGGGAGG + Intronic
1101857458 12:108455889-108455911 CAGCAAAGCACTGAGGTTGGTGG - Intergenic
1102031378 12:109741865-109741887 CAGCCAAGCTCAGTGGTGAGGGG + Intronic
1103082308 12:118035022-118035044 CAGCAAAGCCCATTGGTCATAGG + Exonic
1104643400 12:130481357-130481379 CTGCAAAGCGCTGTGGTTGGTGG + Intronic
1105498091 13:20948188-20948210 CAGCCAAGCACAGCGGTGGCAGG - Intergenic
1107938253 13:45363042-45363064 CAGCAAAGGCTAGTGGCTGGTGG + Intergenic
1108494212 13:51008070-51008092 GAGCAAGGCCCAGAGGTGGTGGG - Intergenic
1108667107 13:52643534-52643556 CAGCCAAGCACAGTGGTGGCAGG + Exonic
1109868605 13:68301497-68301519 CAGCCAAGCCCAGTGGTGGCAGG - Intergenic
1110758959 13:79208686-79208708 CAGGGCAGCCCAGTGGTGGTGGG - Intergenic
1110884761 13:80618992-80619014 CAGCCAAGCCCTGTGGTGGCAGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112339705 13:98543056-98543078 CAGCAAAGGCCAAGGGAGGGGGG + Intronic
1113394490 13:109933877-109933899 CAGCTAAGCCCAGTGTTAAGGGG + Intergenic
1113484224 13:110642612-110642634 CAGGGAAGCCCAGGGCTGGGTGG - Intronic
1113766175 13:112882307-112882329 CAGCAAAGGCCAATGATGGCAGG - Exonic
1113880757 13:113624138-113624160 CACCAAAGCCCAGGGTTGGCAGG - Intronic
1114061986 14:19026613-19026635 CAGCAAAGGCCAGTGGTTTGTGG + Intergenic
1114100274 14:19373388-19373410 CAGCAAAGGCCAGCGGTTTGTGG - Intergenic
1114317263 14:21520786-21520808 CAGAAAAGCCTGGTGGTGGAAGG + Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114528561 14:23381149-23381171 CTGCAAAGCCCAGTGGGGAGTGG + Intergenic
1114607178 14:24007046-24007068 CTCCAAAGCCCGGTGGGGGGAGG + Intergenic
1116330292 14:43587371-43587393 CAGCATGGCCAAGTGGTGGTGGG + Intergenic
1118312953 14:64706292-64706314 CAGCAGAGCCCAGAGGGGTGAGG + Intronic
1118711567 14:68523634-68523656 CATCAAAGCCCACTGTTGAGGGG - Intronic
1120077266 14:80173004-80173026 CAGCACAGCCCACTCTTGGGAGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1121243850 14:92448959-92448981 CAGCACAGCCCAGGAGTGGTGGG - Intronic
1121732914 14:96198634-96198656 CAGCAACCCCCAGAGGTGGAGGG + Intergenic
1121816391 14:96932174-96932196 CATCATAGCCCAGTGGTCAGTGG - Intergenic
1121956527 14:98218431-98218453 CAGCAAAGCCAGGGCGTGGGAGG + Intergenic
1122059770 14:99129275-99129297 AAGCAAGGCCCAGAGATGGGAGG - Intergenic
1122260969 14:100522855-100522877 CACAAGAGCCCAGAGGTGGGTGG - Intronic
1124895132 15:33769444-33769466 TGGCAAACCCCACTGGTGGGTGG + Intronic
1124896912 15:33785853-33785875 CAGCATGGCCCTGTGCTGGGGGG - Exonic
1125059515 15:35401854-35401876 CAGTCAAGCACAGTGGTGGCAGG + Intronic
1125469180 15:39985918-39985940 CAGCAACACCCAGTAGTGGCGGG + Intronic
1126340162 15:47631931-47631953 CAGCTAAAGCCAGTGGTGAGAGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1128434200 15:67629220-67629242 CAGCCAAGCACGGTGGTGGCAGG + Intronic
1129678040 15:77642993-77643015 GAGCTAAGTCCAGTGGTGTGGGG - Intronic
1129844446 15:78761852-78761874 CTGTTAATCCCAGTGGTGGGGGG - Intronic
1130257355 15:82331964-82331986 CTGCTAATCCCAGTGGTGGGGGG + Intergenic
1130597590 15:85258025-85258047 CTGCTAATCCCAGTGGTGGGGGG - Intergenic
1130807880 15:87345711-87345733 CAGCAGAGCCCAATGGAGGTGGG + Intergenic
1131236109 15:90698483-90698505 CAGCTAAGCCCCATGGTTGGTGG + Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131425351 15:92341376-92341398 CTGCACAGTCCAGTGGTGGTGGG - Intergenic
1131670176 15:94611399-94611421 CAGCAATACACAGTGGAGGGTGG + Intergenic
1132131474 15:99284513-99284535 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1132234514 15:100209196-100209218 CAGCAAAGCCCATTCTTTGGGGG + Intronic
1132667244 16:1087463-1087485 TAGCTCAGCTCAGTGGTGGGTGG - Intergenic
1132827980 16:1914373-1914395 CAGCGAGGTCCCGTGGTGGGGGG - Intronic
1133314067 16:4871212-4871234 CAACAAAGCCCAGGCTTGGGAGG + Exonic
1133947616 16:10362282-10362304 CAGAAAAGCCCACTGAGGGGGGG + Intronic
1135754709 16:25087389-25087411 CAGCAAAGTCTGGTGTTGGGGGG - Intergenic
1136079861 16:27844862-27844884 CAGCTCAGCCCAGTGGGGTGGGG - Intronic
1137520808 16:49193935-49193957 CAGCAAAGCCCTGAGGAGTGAGG + Intergenic
1137841721 16:51646859-51646881 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1138274255 16:55720345-55720367 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1138296414 16:55889304-55889326 CAGCAAATCCCACAGGTTGGGGG + Intronic
1138419385 16:56889381-56889403 GCCCAAACCCCAGTGGTGGGCGG + Intronic
1138553211 16:57758382-57758404 CAGCACGGCCCCGTGGCGGGAGG + Exonic
1141174593 16:81710638-81710660 CAGAAACGCACAGTGGTGGGTGG - Exonic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142250350 16:88989137-88989159 GAGCAAAGCCGTGCGGTGGGAGG + Intergenic
1142796054 17:2307797-2307819 AAGCCAAGCACAGTGGTGGCAGG + Intronic
1143008553 17:3852954-3852976 CAGGAAAGGCCTGTGGTGAGTGG - Intergenic
1144747759 17:17626994-17627016 CAGCAAAGACCAAGGCTGGGAGG - Intergenic
1144852755 17:18252271-18252293 CAGCCAGCCCCAGAGGTGGGTGG - Intronic
1145124255 17:20287033-20287055 CAGCAGAGCCCAGGGGAGGCAGG - Intronic
1146058185 17:29591441-29591463 CAGCAAAGCCCAGGAGTCCGAGG - Intronic
1146670676 17:34735369-34735391 CAGAGCAGCCCAGTGGTGGCAGG + Intergenic
1146902899 17:36599897-36599919 CAGAGAAGCTCAGTGGTGGGAGG + Intronic
1149169237 17:53790934-53790956 CAGTAATGGCCAGTCGTGGGTGG + Intergenic
1150451179 17:65270491-65270513 CAGCAAAGACCAGCGGTAGCTGG + Intergenic
1151938978 17:77281245-77281267 CAGCGCAGCGCAGGGGTGGGCGG + Intronic
1152085139 17:78213507-78213529 GGGGAAAGCCCAGTGGAGGGTGG - Intergenic
1152218475 17:79048118-79048140 CAGCACAGCGCAGGGGTGGAAGG - Exonic
1152233594 17:79126899-79126921 CTGCAAAGCCCGGTGCCGGGTGG - Intronic
1152366757 17:79860826-79860848 CAGCAAAGCCAAGGGATGGGAGG - Intergenic
1153166393 18:2266452-2266474 ATTCAATGCCCAGTGGTGGGGGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153463119 18:5359179-5359201 CAACAGGGCCTAGTGGTGGGTGG - Intergenic
1153693453 18:7616572-7616594 CAGAAAGGCCCAGTGTTGTGCGG + Intronic
1153978152 18:10287461-10287483 CATCACAGCCCAGTGGTAGGTGG + Intergenic
1154169015 18:12037425-12037447 CAGCAAAATGGAGTGGTGGGAGG - Intergenic
1154270284 18:12912424-12912446 CGGCACAGCGCAGGGGTGGGAGG - Intronic
1155240090 18:23856674-23856696 GAGGAAAGCACAGTGGGGGGTGG - Intronic
1156003429 18:32412113-32412135 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1158669376 18:59461251-59461273 CAGCAAGGGCCAGTGGTGGCGGG - Intronic
1159007054 18:63022621-63022643 CAGCACGGCCCAGTGGCAGGAGG + Intergenic
1159777386 18:72619308-72619330 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1161316667 19:3620523-3620545 CAGCAGAGCCGAGAGGTGGAGGG + Intronic
1161662273 19:5554211-5554233 GACCAAGGCCCAGTGGTGGCAGG + Intergenic
1161767197 19:6214309-6214331 CAGCAAGGCCCATTGGCTGGGGG - Intronic
1161968389 19:7561588-7561610 CAGCCCAGTCCAGGGGTGGGAGG - Exonic
1162057631 19:8074230-8074252 CAGCAAAGGCCAATGGTCTGTGG + Intronic
1162600662 19:11665968-11665990 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1162653537 19:12110342-12110364 CAGCAAAGCCCACTCGTCTGGGG - Intronic
1163196254 19:15723263-15723285 CAGGAAAGCTCAGGGATGGGCGG - Intergenic
1163234704 19:16023618-16023640 CAGCACTGCCCAGTGGGAGGGGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165059143 19:33196223-33196245 GAGCAAAGCCCCTTGGTAGGGGG + Intronic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1165095143 19:33406097-33406119 CAGGAAAGCACAGTGGGGTGAGG + Intronic
1166286239 19:41831016-41831038 CAGCCACGCACAGTGGTGGCAGG + Intergenic
1166597974 19:44067656-44067678 CAGCATACCCCAGTGGTCGTGGG + Exonic
1167010533 19:46804011-46804033 CACCAAAGCCCCGTGGTGGGGGG + Intergenic
1167340566 19:48913476-48913498 CAGCCAAGCCCAGTTGAAGGAGG + Exonic
1167411622 19:49347483-49347505 CAGTCAGGCCCAGTGCTGGGTGG - Intronic
1167520566 19:49952062-49952084 CTGCAGAGCCCAGTGGGGTGGGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925819828 2:7789310-7789332 CATAAAAGTCCACTGGTGGGTGG - Intergenic
927886362 2:26721153-26721175 CAGCACAGGCCTGGGGTGGGAGG - Intronic
927897284 2:26791746-26791768 CTGCAAAGCCCAGAGGAGGGCGG + Intronic
928418315 2:31115644-31115666 CAGCAAAGCCCAGTAATTAGGGG + Intronic
928471520 2:31580863-31580885 CAGCAGAGCCCAGTGCTGGCAGG - Exonic
929366025 2:41157634-41157656 TAGCCAAGCACAGTGGTGGCAGG + Intergenic
929562984 2:42967473-42967495 CAGCCCAGCCCAGTATTGGGAGG - Intergenic
929592068 2:43153911-43153933 CCGCAGAGCCCATGGGTGGGTGG + Intergenic
929804886 2:45136388-45136410 CAGCAAGGGCTAGTGGTAGGTGG - Intergenic
931190722 2:59997610-59997632 CAGCAAGGAGAAGTGGTGGGAGG + Intergenic
931578833 2:63751584-63751606 CAACCAAGCACAGTGGTGGCAGG - Intronic
932404796 2:71505860-71505882 CTACGAAGCCCAGTGGTGTGTGG + Intronic
932705377 2:74020604-74020626 CAGCAGAGACCAGTGGGGGCAGG - Intronic
934564072 2:95328852-95328874 CAGCAAAGGCCAGAGCTCGGAGG - Intronic
934732882 2:96670426-96670448 CACCAAATCCCGGTGGTTGGGGG + Intergenic
934739206 2:96707034-96707056 CAGCATTGCCCTGGGGTGGGTGG + Exonic
934996645 2:98967621-98967643 CAGCAAAGCAATATGGTGGGTGG + Intergenic
935253092 2:101282826-101282848 GGGCACAGCCCAGTGGAGGGAGG - Intronic
935433085 2:102999127-102999149 CTCCACAGCCCAGTGGTTGGGGG - Intergenic
935515725 2:104036031-104036053 CAGAAACGCCCAGTTGTCGGGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936229864 2:110691156-110691178 CTGAAAAGCCCAGAGGTAGGTGG + Intergenic
936238378 2:110766480-110766502 CAGCTCAGCCCAGTGGGGAGGGG - Intronic
936662951 2:114562327-114562349 TACTAAAGCCTAGTGGTGGGAGG - Intronic
936864404 2:117059900-117059922 CTGCAAAGTCCAGAGGTGGGGGG - Intergenic
940460742 2:153959827-153959849 CAGTAAAGTCCATTGGTGGGGGG - Intronic
941806867 2:169718493-169718515 CTGCATAGCCCAGTGATGGCGGG + Intronic
942045777 2:172098537-172098559 AAGCAGAGCCCAGTGGTGTGTGG + Intergenic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
942274472 2:174309914-174309936 CAGCCAAGCACGGTGGTGGCAGG - Intergenic
943955869 2:194188397-194188419 CAGCCAAACACAGTGGTGGCAGG + Intergenic
944573100 2:201064130-201064152 CAGCCAAGCACAGTGGTGGCAGG + Intronic
944868430 2:203884882-203884904 CACCAAAGCCCAGTGAGGGCAGG - Intergenic
946275196 2:218626415-218626437 CTGCACAGCCCAGTGGTGCAGGG + Intronic
946401170 2:219469094-219469116 CAGCCCAGCCCTGGGGTGGGAGG + Intronic
947638231 2:231691394-231691416 CAGCAAATCCGAGTACTGGGAGG + Intergenic
948304761 2:236938372-236938394 CAGCTAAGCCCTGATGTGGGAGG + Intergenic
948388377 2:237595609-237595631 CAGCCAAGCCGGGTTGTGGGAGG + Exonic
948996302 2:241581305-241581327 CATCAAAGCCCACTGGATGGAGG + Intergenic
949070102 2:242019340-242019362 GAGTAAACCCCAGTGGTGAGAGG + Intergenic
1169268802 20:4183459-4183481 CAGAAAAGCCAAGAGGAGGGAGG - Intronic
1169880391 20:10341182-10341204 CAGCAATGCCCAGGAGTGTGGGG - Intergenic
1170412826 20:16108888-16108910 CAGGATGGCCCATTGGTGGGAGG - Intergenic
1171971386 20:31567162-31567184 CAGCAAAGCTCTGTGGTCTGAGG + Intronic
1173155332 20:40603761-40603783 CATCAAAGGCCAGTGGTGACTGG + Intergenic
1173310500 20:41892519-41892541 CCACACAGCCCAGTGGTGGTGGG - Intergenic
1173371691 20:42442072-42442094 CAGCAAAGCTGAGGGATGGGAGG + Intronic
1173597845 20:44271327-44271349 CAGCAAAGCCCACTGAGGAGTGG + Intronic
1173779766 20:45745630-45745652 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1175339699 20:58220628-58220650 CAGCACAGCTCTGTGGTGGATGG - Intronic
1176130452 20:63494607-63494629 GAGCAAAGCCCGGTGCTGAGGGG + Intronic
1177026609 21:15928272-15928294 CAGCAGAGCTCACTGGAGGGTGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177336086 21:19729564-19729586 CAGCCAGGCTCAGTGGTGGGCGG - Intergenic
1178627086 21:34227313-34227335 AAGGAAGACCCAGTGGTGGGTGG + Intergenic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1180102002 21:45592370-45592392 AAGAAAAGCCCAGTGTGGGGGGG - Intergenic
1180480473 22:15749227-15749249 CAGCAAAGGCCAGTGGTTTGTGG + Intergenic
1181164130 22:20974367-20974389 GTGCAAAGCCCTGTGGTGGGAGG + Intronic
1181443523 22:22951168-22951190 CACCAAGGCCCAGTGGTGAGCGG - Intergenic
1181789487 22:25253257-25253279 CAGAAAAGCCCCAGGGTGGGAGG + Intergenic
1182421488 22:30250741-30250763 CTGCAAAGCCCCGGGGTTGGGGG + Intergenic
1183386576 22:37518781-37518803 CGCCAAGGCGCAGTGGTGGGTGG + Intronic
1183704043 22:39466077-39466099 CAGCCAGGCCCAGGGGTGGCAGG + Intronic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184849761 22:47113402-47113424 CAGCCATGCCTGGTGGTGGGAGG + Intronic
1184944763 22:47795377-47795399 GAGCTATGCACAGTGGTGGGTGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950638806 3:14334593-14334615 CAGCATAGCCCAGTGGTCAAGGG - Intergenic
950666325 3:14497491-14497513 GTGCAAAGCCCTGTGGTGGGGGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951837248 3:26996923-26996945 CAGGAGAGTCCAGTGGTGGTGGG + Intergenic
952358933 3:32610569-32610591 GTGCAAAGCCCTGTAGTGGGAGG + Intergenic
953050360 3:39336018-39336040 CAACAAAGCATAGTGGTGGCAGG + Intergenic
953282471 3:41572421-41572443 TAGAAGATCCCAGTGGTGGGGGG - Intronic
953369159 3:42372657-42372679 CAGCCATGACCACTGGTGGGTGG - Intergenic
953928914 3:46996400-46996422 CAGCCAAGCCCTGTGGAGGCTGG - Exonic
954295682 3:49673597-49673619 AAGCAAAGCCCTGGGGTGCGGGG - Intergenic
955387330 3:58490460-58490482 CAACAAAACCCAGTGGGGTGGGG + Intergenic
955664760 3:61338446-61338468 CAGCAAATCCATTTGGTGGGAGG + Intergenic
956920896 3:73928033-73928055 TAGGAAAGCCAAGGGGTGGGTGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957252534 3:77792232-77792254 CAGCAAAGACCTGTGGAAGGTGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957729230 3:84110976-84110998 CAGGACAGCACAGTGATGGGGGG + Intergenic
959668188 3:108944560-108944582 CTGCATGGCCCAGTGGTGGCGGG - Intronic
960782039 3:121330450-121330472 GAGCAAAGCCAGGTGGTGGCTGG - Intronic
961369668 3:126421804-126421826 CAGCATGCCCCAGTGGTGGCTGG - Intronic
961446028 3:126982282-126982304 CAGGAAAACCCCGTCGTGGGAGG - Intergenic
961529541 3:127532132-127532154 CAGCACTGCACAGTGGTGGTGGG + Intergenic
961654783 3:128435280-128435302 CAGGAAAGGCCAGTGGAAGGTGG + Intergenic
963664509 3:148166236-148166258 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
963969393 3:151413158-151413180 CAGCAGAGCCCTCTGGTGGGCGG + Exonic
965520219 3:169663036-169663058 CAGCAAAGACTAGGGGTGGGAGG - Intronic
967332940 3:188310092-188310114 CAACAAAACCCAGTGCTGTGAGG + Intronic
969112166 4:4851004-4851026 CCGCAGAGCCCAGTGGGGTGAGG + Intergenic
969247392 4:5944619-5944641 CAGCACAGGCCAGGCGTGGGGGG - Intronic
969846206 4:9922303-9922325 CACCAGAGCCCATTGGGGGGTGG + Intronic
971227984 4:24772504-24772526 CAGCCAAGCACTGTGGTGGCAGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975038387 4:69712555-69712577 CCACATAGCCCAGTGGTGGCGGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975794065 4:77987759-77987781 CAGCCAAGCACGGTGGTGGCAGG - Intergenic
976433859 4:84994508-84994530 AAGCAAAGCCAAGTTGTGGGTGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976551959 4:86406823-86406845 CTGCACAGCCCAGTGGTGGCAGG + Intronic
977994098 4:103481901-103481923 CACCACAGCTCAGTGCTGGGTGG + Intergenic
978126150 4:105137509-105137531 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
979679536 4:123444465-123444487 CAGGGAGGCCCAGTGGTGGGGGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980305823 4:131060304-131060326 CATTTAAGCCCAGTGGTTGGAGG - Intergenic
980320485 4:131266753-131266775 CAGCCAAGCCCTGTGGGGGGCGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980729286 4:136805945-136805967 AAGCAAAACCCATGGGTGGGGGG - Intergenic
985028667 4:185766284-185766306 CAGCAGAGCCAAGTGTTGGAAGG - Intronic
985550918 5:533272-533294 AAGCAGAGCCCAGTGGTGCTGGG + Intergenic
985570237 5:640851-640873 CGGCACTGCCCAGTGGTGGAGGG - Intronic
985700555 5:1369438-1369460 CAGCAGAGCCAAGTGGTTGGGGG + Intergenic
987250817 5:16099873-16099895 CAGAAAAGCAGAGAGGTGGGTGG + Intronic
988578472 5:32448240-32448262 ATGCAAAGCCCCCTGGTGGGAGG - Intergenic
989208955 5:38841222-38841244 CACCAAAGCCTACTGGAGGGAGG - Intergenic
989694931 5:44189441-44189463 CCACATGGCCCAGTGGTGGGAGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
992808120 5:80358976-80358998 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
993164946 5:84340882-84340904 CAACAAAGCCCTGTGGCAGGAGG - Intronic
995774256 5:115708981-115709003 CAGCAGAGTTCAGTGATGGGAGG + Intergenic
996987758 5:129587772-129587794 CAGTAAAATCCAGTGCTGGGTGG + Intronic
997140823 5:131378980-131379002 CAGCAAAACCCAGGGGTGCCAGG - Intronic
997214287 5:132097435-132097457 CAGCAAATCTCAGTGGTGTGGGG + Intergenic
997638418 5:135432362-135432384 CAGCAAAGGCCAGAGGCAGGAGG + Intergenic
997759350 5:136429940-136429962 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
997818783 5:137044549-137044571 CCTGAAAGCCCAGTGTTGGGAGG - Intronic
1002040205 5:176507922-176507944 CAGGAAAGCCCAGGGCTGGGGGG - Exonic
1002808753 6:604749-604771 AAGCAGAGGCCAGCGGTGGGTGG - Intronic
1003379335 6:5609126-5609148 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005255896 6:24002508-24002530 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1005610934 6:27524424-27524446 CAGCCAAGCCCAGTGGTGGAAGG + Intergenic
1006204265 6:32326257-32326279 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1006522087 6:34576663-34576685 CAGCGAAGACCAGCGGTGGTCGG + Intergenic
1007423720 6:41734487-41734509 CGGGACAGCCCAGGGGTGGGCGG + Intronic
1008142082 6:47843648-47843670 CAGCAAATCACAGTGGAGAGAGG - Intergenic
1013174030 6:107662289-107662311 CAGCAAAAGCCAGAGTTGGGAGG - Intergenic
1013354053 6:109332004-109332026 CAGAACAGCCCAGTGGAAGGCGG + Intergenic
1014597564 6:123364087-123364109 CAGCAAAGCCTCGTGGTGGAAGG - Intronic
1014685171 6:124488586-124488608 AAGCAAAGCACAATGGTGGAGGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015770919 6:136767437-136767459 TATCACAGCCCAGCGGTGGGTGG - Intronic
1016306975 6:142694951-142694973 CACCAAAGCCAAGTGGCTGGAGG + Intergenic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1017862410 6:158411307-158411329 CAGCACAGACCTGTGGGGGGTGG + Intronic
1018581152 6:165309349-165309371 GCGCAAAGCACAGAGGTGGGGGG - Intronic
1018890172 6:167977243-167977265 CAGGGAAGTCCAGGGGTGGGAGG - Intergenic
1020040287 7:4996383-4996405 CAGCAAAGCACTGTGGTGAGGGG + Intronic
1020530556 7:9328735-9328757 CAGAAAAGCCCACTGGGGTGGGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1022018400 7:26376011-26376033 CAGCAAAGACAAGCGGTGTGGGG - Intergenic
1022381149 7:29861093-29861115 CAGCAAAGCCCAGAGGTAGATGG + Intronic
1022472376 7:30689599-30689621 CAGCAAAGCTGGGTGGGGGGTGG + Intronic
1023021963 7:36018971-36018993 CACCAAGGCCCACTGGTAGGAGG - Intergenic
1023907210 7:44531373-44531395 AAGGAAAGCCCCGTGGTTGGAGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025038970 7:55622816-55622838 CAAAAAAGCCTAGTGGGGGGAGG - Intergenic
1025104953 7:56163116-56163138 CAGCGAAGACCAGCGGTGGTCGG - Intergenic
1027964210 7:84984588-84984610 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1028164522 7:87522501-87522523 CAGACAAGCACAGTGGTGGCAGG + Intronic
1031112477 7:117628985-117629007 CAGCAAAGCAAAGGGGTGGCAGG - Intronic
1033451015 7:141462503-141462525 CTGGAAAGACCAGTGGAGGGTGG + Intronic
1033951782 7:146793652-146793674 CAGCAAAACCCAGGGTTTGGGGG + Intronic
1034533543 7:151712561-151712583 GAGCCAAGCCCAGGGATGGGAGG + Intronic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034960107 7:155359617-155359639 GTGCAAAGCCCAGGGATGGGGGG - Intronic
1035389148 7:158494234-158494256 CAGCGACGCCCAGAGATGGGAGG - Intronic
1035474379 7:159131554-159131576 CAGCAAAGTCCTGTGGGGAGAGG - Intronic
1035644245 8:1206236-1206258 CAGGAGTGCCCAGTGGTGCGTGG - Intergenic
1035721671 8:1797493-1797515 AAGCAAAGCCCTGGTGTGGGTGG - Intergenic
1035851572 8:2924343-2924365 CAGCACAGCCACGTGGTGGAAGG + Intergenic
1036386262 8:8284557-8284579 CAGCAGACCCCAGTGCTGGGTGG - Intergenic
1036634688 8:10540845-10540867 CAGGCAGGCCCAGTGGAGGGTGG + Intronic
1036640967 8:10583497-10583519 CAGGAAAGCCCTGTTGGGGGTGG - Intergenic
1036699558 8:11002956-11002978 CACCAAAGCCCAGAGAAGGGGGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039469236 8:37803284-37803306 CAGCAAAGTCCAGAGAGGGGAGG + Intronic
1040663564 8:49604129-49604151 CAGCAGGGCCCAGTGGTGTGTGG + Intergenic
1040828618 8:51651855-51651877 CAGCACAGCCAAGTGGTGCCTGG - Intronic
1043395548 8:79832199-79832221 CAGGAAAGGCCAGGGGTGGGGGG + Intergenic
1043488671 8:80725168-80725190 CAGCAAAGTACTGTGGTAGGAGG + Intronic
1043589284 8:81808812-81808834 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1043628236 8:82291523-82291545 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1043878034 8:85508750-85508772 ATGCAAAGCCCTGTGGTAGGAGG - Intergenic
1045504713 8:102770212-102770234 CAGGACAGCCCAGCAGTGGGTGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1046424572 8:114030113-114030135 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047286328 8:123490348-123490370 CAGCATAGCACAGTGGTGAGGGG - Intergenic
1048032228 8:130643378-130643400 CAGGACAGCCCAGTGGTTGAGGG + Intergenic
1048317953 8:133375739-133375761 ATGCAGAGCCCAGTGGGGGGAGG + Intergenic
1048513260 8:135081127-135081149 CAGCAAGGCCAGCTGGTGGGAGG + Intergenic
1049275214 8:141716919-141716941 CAGGACAGGCCACTGGTGGGAGG + Intergenic
1049636833 8:143693589-143693611 CAGCAAAGCCCAGAGGAGGCCGG - Intronic
1050373229 9:4944569-4944591 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051783146 9:20712511-20712533 TAGCTGAGCCCAGTGGTGGTGGG + Intronic
1052143347 9:25017057-25017079 AAGGAATGCCCAGTGATGGGTGG + Intergenic
1053346377 9:37381509-37381531 CAGCAGGCCCCAGTGGTGGGAGG - Intergenic
1055056445 9:72028606-72028628 CAGCAAATCCCCCTGGTAGGTGG + Intergenic
1055335477 9:75229294-75229316 CTGCACAGCCCAGTGATGGTGGG - Intergenic
1056412451 9:86344289-86344311 CAGCAATGGCCAGTGGGGGTTGG + Intronic
1056556690 9:87695401-87695423 CCCCAGAGGCCAGTGGTGGGCGG + Intronic
1056645759 9:88410428-88410450 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056739602 9:89243012-89243034 CAGCAAAGCCGTGTGTTGTGGGG - Intergenic
1059247216 9:112858731-112858753 CAGAGAAGCCCAGGGGTGGTAGG - Intronic
1060477024 9:123994535-123994557 TATGAAAGCCCTGTGGTGGGAGG + Intergenic
1060800575 9:126542547-126542569 TAGCCAGGCGCAGTGGTGGGTGG + Intergenic
1060952202 9:127611682-127611704 AAGCAATGCCCAGTGATTGGAGG + Intergenic
1060974399 9:127755752-127755774 CAGTAAAGCCCAGTGGTTAGAGG + Intronic
1061516480 9:131093207-131093229 CAGCAAAGCCCTCTAATGGGAGG - Intronic
1061706184 9:132455179-132455201 CAGCAGAGCCCAGTAGTGTGGGG + Intronic
1062041067 9:134404571-134404593 TAGCAAAGCCTCCTGGTGGGAGG + Intronic
1062121744 9:134837525-134837547 CAGCAAAGCCCACTTCTGCGAGG + Intronic
1062340630 9:136092493-136092515 AAGCAAAGCCCTGTGGTGTGAGG - Intronic
1062459397 9:136656614-136656636 CCGCAAGGCACAGTGGTGGGGGG - Intergenic
1185431666 X:14827-14849 CATCCCAGCCCAGTGGAGGGCGG + Intergenic
1185440990 X:227546-227568 CATCCCAGCCCAGTGGAGGGCGG + Intergenic
1185791172 X:2929022-2929044 CAGCAGAGCCCAGGGATGGGGGG - Intronic
1186458252 X:9727794-9727816 CAGCAAGGCCCATGGGTGGAGGG - Intronic
1186875907 X:13817439-13817461 CAACAAAGTCACGTGGTGGGAGG - Intronic
1187188921 X:17014278-17014300 CAGCAGAGCCCAGTGGATTGTGG + Intronic
1187338584 X:18401954-18401976 CAGCTAACCCCAGAGATGGGAGG - Intergenic
1187685448 X:21811427-21811449 GAGAAATTCCCAGTGGTGGGAGG - Intergenic
1188833762 X:34932104-34932126 CAGCAAAGCAATGTGGGGGGTGG - Intergenic
1189551922 X:42102111-42102133 CAGCAAATCCCTGTGGTGACAGG - Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191641686 X:63433930-63433952 CGGCCAAGCCCAGTGCTCGGAGG + Intergenic
1191942994 X:66499914-66499936 CAGGAAAGCTGAGTGGAGGGTGG - Intergenic
1192046347 X:67678127-67678149 CCACAAAGCCCTGGGGTGGGGGG + Intronic
1192656443 X:72999801-72999823 GAGGAAGGCGCAGTGGTGGGTGG - Intergenic
1192665677 X:73083200-73083222 GAGGAAGGCGCAGTGGTGGGTGG + Intergenic
1192801799 X:74472914-74472936 TAGCAAAGCACAGTGGTGGCAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193264740 X:79454998-79455020 CACCAGAGCCTAGTGGAGGGTGG + Intergenic
1193663584 X:84287640-84287662 CTGCATGGCCCAGTGGTGGTGGG - Intergenic
1194634115 X:96322945-96322967 AAGCAATATCCAGTGGTGGGTGG + Intergenic
1195023753 X:100855187-100855209 CAGCCAAACACAGTGGTGGCAGG - Intronic
1195026981 X:100887534-100887556 CAGCCAAGCACAGTGGTGACAGG - Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196763475 X:119221823-119221845 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1198277745 X:135112551-135112573 CAGACAAGCCCTGTGGAGGGAGG + Intergenic
1198433108 X:136587756-136587778 AAGCAAAGCCCCGTGATAGGTGG - Intergenic
1199948206 X:152683869-152683891 CAGCCAGGGCCAGTGGAGGGTGG + Intergenic
1199961473 X:152784585-152784607 CAGCCAGGGCCAGTGGAGGGTGG - Intergenic
1200018622 X:153183330-153183352 CAGCCAAGGCCAGTGGGAGGGGG + Exonic
1200167519 X:154047463-154047485 CAGCTTAGCGCAGTGGTGGTGGG + Intronic
1200232147 X:154449454-154449476 CAGCAAAGCTCTCTGGTGGGAGG - Intronic