ID: 1165096177

View in Genome Browser
Species Human (GRCh38)
Location 19:33411088-33411110
Sequence CACGACAAGGAGATGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165096177_1165096182 3 Left 1165096177 19:33411088-33411110 CCTGCCCACATCTCCTTGTCGTG 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1165096182 19:33411114-33411136 TCTATGAAGAACTGTGAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 192
1165096177_1165096183 18 Left 1165096177 19:33411088-33411110 CCTGCCCACATCTCCTTGTCGTG 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1165096183 19:33411129-33411151 GAGCACGGCACATCGTGCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165096177 Original CRISPR CACGACAAGGAGATGTGGGC AGG (reversed) Intronic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903143326 1:21353561-21353583 AACGGCAAGGAGTTGTGGGGTGG - Intergenic
903231818 1:21926973-21926995 CAGGACCAGGAGGTGGGGGCCGG + Intronic
904440704 1:30527667-30527689 GAGGACAGGGAAATGTGGGCAGG - Intergenic
906530010 1:46518327-46518349 CATGAGAAGGAGGTGGGGGCAGG + Intergenic
908244739 1:62218945-62218967 AAAGACAAGGACACGTGGGCTGG - Intergenic
910288263 1:85577312-85577334 CAAGCCAAGGGGATGGGGGCGGG + Intronic
912871258 1:113309304-113309326 AAAGACAAAGAGATGTGGGATGG - Intergenic
914447734 1:147764105-147764127 CACGAGAAGGAGCACTGGGCCGG - Intronic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
915612987 1:157010035-157010057 CAAGACAAGAATATCTGGGCTGG + Intronic
915904730 1:159869440-159869462 CACAACAGGCACATGTGGGCAGG + Intronic
916362191 1:163983039-163983061 GACGAGGAGGAAATGTGGGCAGG + Intergenic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
922714585 1:227860353-227860375 CACAACCTGGAGATGTGAGCTGG + Intergenic
923855985 1:237846202-237846224 TACCACATGGAGATGAGGGCAGG - Intergenic
924205878 1:241710898-241710920 CACGACAATGGGATTTGGGTTGG + Intronic
924441325 1:244087782-244087804 CGTGCCAAGGAGATGTGGGTGGG - Intergenic
924712851 1:246545100-246545122 CACAATAAGAAAATGTGGGCCGG - Intronic
924722585 1:246637359-246637381 GAGGACAAGGAGGTGTCGGCAGG + Intronic
1068040749 10:51820989-51821011 AACTACAAGGAGATTTGGGAGGG - Intronic
1069894390 10:71671601-71671623 CATGACAAGCAGATTGGGGCTGG + Intronic
1072689830 10:97564858-97564880 TAAGATAAGGAGTTGTGGGCTGG - Intronic
1073057383 10:100711091-100711113 CACTACAAGGACATGCTGGCAGG - Intergenic
1076469439 10:130708378-130708400 CACGACAAGGAGATGCTCCCTGG - Intergenic
1077555170 11:3222501-3222523 CACGAGAAGGGGCTGTGGGAGGG - Intergenic
1078267546 11:9766287-9766309 CACTCCAAGGAGAGGTGGGATGG - Intergenic
1078452438 11:11450217-11450239 GCCAACAAGGGGATGTGGGCAGG - Intronic
1081487365 11:43542016-43542038 CATTACAAAGAAATGTGGGCTGG + Intergenic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1085252545 11:75153126-75153148 CACCAGAATGGGATGTGGGCAGG - Intronic
1085413228 11:76303932-76303954 CACAGTAAGAAGATGTGGGCTGG + Intergenic
1085740530 11:79074710-79074732 CACCAGGAGGAGATGGGGGCAGG + Intronic
1087706075 11:101493346-101493368 CACCCCAAGGACATGTGGGTTGG - Intronic
1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG + Intronic
1089775322 11:120831758-120831780 GAAGGCACGGAGATGTGGGCTGG - Intronic
1091370779 11:135056331-135056353 CTAGACAAGGAGATGGGGTCAGG - Intergenic
1091517684 12:1200852-1200874 TAAGAAAAGGAAATGTGGGCCGG - Intronic
1092055324 12:5504089-5504111 CCCAACAAGGAGAGGTGGGGAGG + Intronic
1092386660 12:8040715-8040737 GAAGACAAGAGGATGTGGGCCGG - Intronic
1093874086 12:24328568-24328590 CACTACAGGGAGATGTGTGGAGG - Intergenic
1094604006 12:31934955-31934977 CAAGACAAAGGGATCTGGGCCGG - Intergenic
1098175148 12:67782318-67782340 CACGGGAGGAAGATGTGGGCTGG - Intergenic
1100200656 12:92294622-92294644 AACGACAAGGGGATATGGCCAGG - Intergenic
1101659485 12:106753219-106753241 CAAGACAACCACATGTGGGCTGG - Intronic
1102490641 12:113287891-113287913 TACTGCAAGGAGATGTGGCCTGG + Intronic
1102572466 12:113835473-113835495 CACGAAAAGGAGAGGTGTGGGGG + Intronic
1104391603 12:128395815-128395837 CACCACAAGGAGGTCTAGGCAGG - Intronic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1105740504 13:23318015-23318037 CATGACAAAAAGATGTAGGCTGG - Intronic
1105820186 13:24073792-24073814 CACCTCAGGGAGATGTGGGAGGG + Intronic
1115738285 14:36359028-36359050 CATGACAAAGAAATGTGGACAGG + Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1117479168 14:56125913-56125935 CCCCACATGGAGATGTGGCCAGG + Intronic
1122774273 14:104110335-104110357 CAAGACCAGGGGTTGTGGGCCGG - Intronic
1123049647 14:105534789-105534811 CAAGACAGGGGGAGGTGGGCAGG + Intergenic
1125460277 15:39899803-39899825 CAAGATAAGGAAATATGGGCTGG + Intronic
1127092981 15:55484802-55484824 CACGAGCAAAAGATGTGGGCTGG + Intronic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1129358834 15:75011794-75011816 CAGGACAAAGAGGTGTGGGCAGG + Exonic
1129704193 15:77785240-77785262 CAAGAGAGGGAGATGTGGGAGGG - Intronic
1133392159 16:5419357-5419379 CACGAGAGAAAGATGTGGGCTGG + Intergenic
1139834474 16:69827015-69827037 AAGGACAAGTAGATGTGTGCTGG - Intronic
1143454007 17:7054082-7054104 AATGGCATGGAGATGTGGGCAGG - Intergenic
1143753138 17:9045660-9045682 CCAGAAAAGGAGATGGGGGCAGG + Intronic
1144144157 17:12381008-12381030 TAAGATAAGGAGTTGTGGGCCGG - Intergenic
1147914017 17:43876063-43876085 CACACCAACGAGATGGGGGCAGG + Intronic
1150571144 17:66388160-66388182 CATAACAAGGATATGTGGGTGGG + Intronic
1150843154 17:68628196-68628218 CACCCCAAGGAGAGGTTGGCAGG - Intergenic
1152060967 17:78074929-78074951 CACGGCAAGGGGATGGGGGTTGG - Intronic
1154141735 18:11830109-11830131 CCCGTCAAGGAGATGAGGGTTGG - Intronic
1159355909 18:67337357-67337379 CAGGGCCAGGAGCTGTGGGCTGG - Intergenic
1161586009 19:5106175-5106197 CACAACAGGGAGGTGTGCGCTGG - Intronic
1163745000 19:19041128-19041150 CACGAAAAGGAGCTGGGGCCAGG - Intronic
1165096177 19:33411088-33411110 CACGACAAGGAGATGTGGGCAGG - Intronic
1165593919 19:36995475-36995497 CACTACAAGAAGAGGTTGGCAGG - Intronic
1166395333 19:42435534-42435556 TAAGAAAAGGAGATTTGGGCTGG + Intronic
1166540028 19:43599069-43599091 CAGGACAAGGGAAGGTGGGCTGG - Exonic
1168401490 19:56088207-56088229 CACTCCACGCAGATGTGGGCCGG + Exonic
1168435476 19:56313997-56314019 CACGACCAGGAGCTAGGGGCTGG + Intronic
925181254 2:1818285-1818307 CACGACAAAGAGCTGCGGGTGGG + Intronic
928653464 2:33425624-33425646 CATGGTCAGGAGATGTGGGCTGG + Intergenic
928979305 2:37121810-37121832 CACGACATGGAGATGGAGGTGGG + Intronic
930494479 2:52124300-52124322 AAAGACAAGGAGATGGGGGAAGG - Intergenic
932591117 2:73068346-73068368 CAGGACACAGAGATGTGGGCTGG + Intronic
933796965 2:85927440-85927462 CAGGACAAGGCTATGTGGGATGG + Intergenic
935219642 2:101001711-101001733 CACGACAGGGAGATCTGAGGAGG - Intronic
935339704 2:102048776-102048798 AACGACAAGGTGAAGTGGCCGGG - Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
935835688 2:107050691-107050713 CACTACCAGGGGATGTGGGAAGG + Intergenic
938012256 2:127838249-127838271 AACAACAAAAAGATGTGGGCTGG - Intergenic
940189867 2:151029221-151029243 CAGGACAAGGAAGTGTGGTCTGG + Intronic
943153087 2:184138586-184138608 CACTACAAGTAGCTGTGGCCAGG + Intergenic
947538131 2:230953869-230953891 CACGGCCAGGAGATGAAGGCTGG + Intronic
947860426 2:233354299-233354321 CACGGCCCGGAGAGGTGGGCGGG + Intergenic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
947876627 2:233471834-233471856 CACCACAAGGGGACCTGGGCCGG - Exonic
948217102 2:236239970-236239992 CACAGCAAAGGGATGTGGGCTGG - Intronic
948651029 2:239443945-239443967 GACAACAAGGAGCTCTGGGCAGG - Intergenic
948662977 2:239518138-239518160 CACGACAAAGTGCTTTGGGCTGG + Intergenic
1168752176 20:290444-290466 GGGGCCAAGGAGATGTGGGCGGG + Intronic
1169971148 20:11270756-11270778 AATGACAAGGGGATGTGGGCGGG + Intergenic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1174258905 20:49278814-49278836 CACGAGAAGGAGATTAGGGCTGG - Intergenic
1175487577 20:59356454-59356476 CACGCTAACCAGATGTGGGCGGG + Intergenic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1176184440 20:63770724-63770746 CATGACGAGGAGAACTGGGCAGG + Intronic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1181553418 22:23653843-23653865 CACCCCAAGGAGATGGTGGCAGG + Intergenic
1184664706 22:45982146-45982168 CACTTCAAGGAGACCTGGGCAGG - Intergenic
1184680074 22:46067194-46067216 CTGGGCAAGGAAATGTGGGCAGG - Intronic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
951709914 3:25576945-25576967 GACCACAAAGAGATGTTGGCCGG + Intronic
955555860 3:60136525-60136547 CATGAAACGGAGTTGTGGGCAGG - Intronic
956642556 3:71428746-71428768 CCCTACAATGAGATGTGGCCTGG + Intronic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
959226463 3:103594693-103594715 CACGAGAGGAAGATGTAGGCTGG + Intergenic
960224836 3:115157228-115157250 GAAGACAAGAAGATGTGGGAAGG + Intergenic
960389513 3:117059550-117059572 CACTTGAGGGAGATGTGGGCAGG + Intronic
964244373 3:154633601-154633623 CACGGCAAGGGGATGGGGGAGGG + Intergenic
966314036 3:178625285-178625307 CAGGACAAGGGGGTGGGGGCGGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
969656531 4:8501897-8501919 CTCAACAGAGAGATGTGGGCAGG - Intergenic
969850050 4:9948819-9948841 CCTGAGATGGAGATGTGGGCAGG - Intronic
973844045 4:54892786-54892808 TAAGACAAGGAGATGTGGTCAGG - Intergenic
973874423 4:55202007-55202029 CACGACAGAAAGATGTAGGCTGG - Intergenic
974916702 4:68186641-68186663 AAAGGCAAGGAGATGGGGGCAGG + Intergenic
975321183 4:73011552-73011574 AACTGCAAGGAGGTGTGGGCAGG + Intergenic
976127276 4:81847448-81847470 CCTGAGGAGGAGATGTGGGCAGG - Intronic
976990737 4:91362012-91362034 AACCATAAGGATATGTGGGCAGG + Intronic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
997212440 5:132085394-132085416 AAAGACAAAGAGAAGTGGGCAGG - Intergenic
997585071 5:135039208-135039230 CACCCCCAGGAGAAGTGGGCAGG - Intronic
999571760 5:152926645-152926667 CAAGACCAGGAGAGGTGGGAAGG - Intergenic
1002638582 5:180619904-180619926 GAAGACAAGGAGAGGTGGACAGG + Intronic
1005672849 6:28124744-28124766 CGCGACAGGGAGGTGTGGGGAGG - Intronic
1006360423 6:33584251-33584273 AAGGACAGGGAGATGTGGGTGGG + Intergenic
1008759613 6:54837916-54837938 TAGGACAAGGAGAGGTGGGAGGG + Intergenic
1011391389 6:86857754-86857776 AAGGACAAGGATATGTGGACTGG + Intergenic
1012506458 6:99951895-99951917 CCTGACAGGGAGATGAGGGCAGG + Intronic
1013503197 6:110772444-110772466 CAAGACGAGGAGATATGGGTGGG + Intronic
1013896592 6:115096226-115096248 AGAGAAAAGGAGATGTGGGCTGG + Intergenic
1017106784 6:150895310-150895332 CACGGAAGGGAGAGGTGGGCAGG + Intronic
1018049021 6:159991663-159991685 CACTAAAAGGAAATGTGGGCTGG - Intronic
1019377472 7:700889-700911 CACCAAAAGGACAGGTGGGCAGG + Intronic
1023023496 7:36031357-36031379 TACGCCAAGGAGAGGTGTGCTGG - Intergenic
1024431381 7:49291981-49292003 CACGAGAGGGAGATGAAGGCTGG + Intergenic
1029245024 7:99193037-99193059 CAAGGCTAGGAGATGTGGGATGG + Exonic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030206242 7:106954992-106955014 CACAGCAAGGCAATGTGGGCAGG - Intergenic
1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG + Intronic
1031077948 7:117230962-117230984 CCTGAGAAGGAGATGTGGCCAGG - Intergenic
1032540504 7:132699167-132699189 CACCACAAGCAGATGTGAGTGGG - Intronic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1036821961 8:11948045-11948067 CTTGACAAGGAGATTTGGGATGG + Intergenic
1038142595 8:24862987-24863009 CAGGACAAGGACATGTGCTCCGG - Intergenic
1038334469 8:26635120-26635142 CACGCCAAGGCGGGGTGGGCAGG + Intronic
1041539788 8:58970626-58970648 CAGTAGAAAGAGATGTGGGCTGG - Intronic
1041603969 8:59758181-59758203 TAGGACAAGGAGCTGTGGGACGG + Intergenic
1043506876 8:80911123-80911145 GAGGACAAGGAGATGTTGACGGG + Intergenic
1043658799 8:82708420-82708442 CACTACAAGGAAATATGGGAAGG - Intergenic
1044461589 8:92451438-92451460 GACCTCAAGGTGATGTGGGCTGG + Intergenic
1047236443 8:123046150-123046172 GAAGAAAAGGAGATTTGGGCTGG + Intronic
1048267655 8:133001670-133001692 GACGACAGGGAGACGTGAGCTGG + Intronic
1050171009 9:2816644-2816666 TGAGACAAGGAGATGTGGGAGGG - Intronic
1050377842 9:4991693-4991715 CTAGAAAAGGAGATGTGGGGTGG - Intronic
1052857382 9:33415687-33415709 CACAACAAAGGCATGTGGGCTGG - Intergenic
1056203138 9:84295720-84295742 GACCACAAAGAGCTGTGGGCTGG + Intronic
1057486356 9:95487568-95487590 CACTTCTAGGGGATGTGGGCTGG - Intronic
1057502053 9:95603766-95603788 AATGTCAAGGAGGTGTGGGCAGG - Intergenic
1062617082 9:137402608-137402630 GAAGACAAGAAGATGTGGGAAGG - Intronic
1186439363 X:9572280-9572302 GATCACAAGGGGATGTGGGCTGG - Intronic
1186699468 X:12074341-12074363 CAACACAAGGAGATGAGGGCTGG - Intergenic
1187569900 X:20490229-20490251 AATGCCAAGGAGATATGGGCAGG - Intergenic
1190887585 X:54543174-54543196 GAGGACCAGGAGATGAGGGCAGG - Intronic
1193167997 X:78303283-78303305 CACTGCTAGGAGATGTGGGAGGG + Intronic
1195541534 X:106068261-106068283 CACTGCAAGCAGATGTGGTCAGG + Intergenic
1195706603 X:107742133-107742155 CACCAGCAGGTGATGTGGGCTGG + Intronic
1196519854 X:116660834-116660856 CACGGCAAGCAGGTGTGGCCAGG - Intergenic
1199616918 X:149663470-149663492 CCCGACAAAGAAATGTGAGCAGG + Intergenic
1199625723 X:149739778-149739800 CCCGACAAAGAAATGTGAGCAGG - Intergenic
1201433981 Y:13936887-13936909 CAAATCAAGGAGATATGGGCAGG - Intergenic