ID: 1165099456

View in Genome Browser
Species Human (GRCh38)
Location 19:33430231-33430253
Sequence CAACTTTTCTAGATGGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165099451_1165099456 -4 Left 1165099451 19:33430212-33430234 CCCAGCCGTGAAGGGAGAACAAC 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 152
1165099453_1165099456 -9 Left 1165099453 19:33430217-33430239 CCGTGAAGGGAGAACAACTTTTC 0: 1
1: 0
2: 2
3: 24
4: 256
Right 1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 152
1165099449_1165099456 1 Left 1165099449 19:33430207-33430229 CCAGCCCCAGCCGTGAAGGGAGA 0: 1
1: 0
2: 0
3: 20
4: 248
Right 1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 152
1165099450_1165099456 -3 Left 1165099450 19:33430211-33430233 CCCCAGCCGTGAAGGGAGAACAA 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 152
1165099452_1165099456 -5 Left 1165099452 19:33430213-33430235 CCAGCCGTGAAGGGAGAACAACT 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 152
1165099448_1165099456 2 Left 1165099448 19:33430206-33430228 CCCAGCCCCAGCCGTGAAGGGAG 0: 1
1: 0
2: 3
3: 37
4: 255
Right 1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 152
1165099445_1165099456 13 Left 1165099445 19:33430195-33430217 CCAGACACTAACCCAGCCCCAGC 0: 1
1: 0
2: 3
3: 59
4: 433
Right 1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165099456 Original CRISPR CAACTTTTCTAGATGGCACT GGG Intronic
904621827 1:31780178-31780200 CAACTTTTCTAGAAGGCCACTGG + Intergenic
911923896 1:103802328-103802350 CAACTTTTTTAAGTGGCATTGGG - Intergenic
913067033 1:115265538-115265560 GAACTTTTCTACAAAGCACTTGG + Intergenic
919612045 1:199757641-199757663 CATCATTTCAAGATGGCACAAGG + Intergenic
921428587 1:215035356-215035378 GAACTATTCTGTATGGCACTGGG - Intronic
923397440 1:233581251-233581273 CAGCCTTTCCAGATGGCATTAGG + Intergenic
1062781426 10:213275-213297 CACCTTTTCTAGTTTGCACATGG + Intronic
1064324390 10:14334958-14334980 CAACTTATATAGATGGCAGTGGG - Intronic
1068411417 10:56660500-56660522 CAATTTTTCTAGACACCACTTGG - Intergenic
1068726723 10:60311517-60311539 AAAATTTTCTAGAAGGAACTAGG - Intronic
1074944269 10:118266018-118266040 CCAGTTTTGCAGATGGCACTTGG - Intergenic
1077036943 11:499831-499853 CAGCTTTTCCAGGCGGCACTGGG + Exonic
1079364603 11:19798366-19798388 CATCTTATCTAGATGACATTTGG + Intronic
1079663625 11:23074727-23074749 CATCTTATCTGGAAGGCACTAGG - Intergenic
1081147920 11:39586197-39586219 CAACTTAGCTTGATGGCATTTGG - Intergenic
1081157241 11:39708731-39708753 CAGATTTTCTACTTGGCACTGGG + Intergenic
1083209520 11:61174451-61174473 CAGCTTATCTACATGGCCCTGGG - Intergenic
1086092876 11:83021435-83021457 CAGCTTTCCCAGCTGGCACTGGG - Intronic
1086385859 11:86306446-86306468 GAAATTTTGAAGATGGCACTTGG - Exonic
1088129312 11:106467871-106467893 CAATTTTTCTAGTTGACAATTGG - Intergenic
1090018067 11:123103373-123103395 CAACTTTCATAGCTGGCTCTTGG - Intronic
1091098612 11:132848110-132848132 AAACTTTTTAAGATGGCAGTAGG + Intronic
1097011612 12:55957306-55957328 CAACTTCTGTAGTAGGCACTTGG + Exonic
1097432054 12:59521845-59521867 CAACTTTTCTAAAGGTCAGTGGG - Intergenic
1098056589 12:66512858-66512880 CAACTTTTCTGGAAGACAATTGG + Intronic
1098397058 12:70030346-70030368 AAACTTTTGTATGTGGCACTGGG + Intergenic
1098506739 12:71261208-71261230 CAACTTTTCTAGTTATCACCTGG - Intronic
1100788543 12:98105246-98105268 CAACTTTAATAGACAGCACTAGG + Intergenic
1101030245 12:100651238-100651260 CAACTTTTCTAAATGGTTCAAGG + Intergenic
1102395936 12:112585847-112585869 CTACTTATCTAGAGGGCTCTTGG - Intronic
1102798173 12:115707560-115707582 CAACTTTTGTGGATGACATTTGG + Intergenic
1105923391 13:24985192-24985214 CATTTTTTCTAGATGGCTGTGGG - Intergenic
1106930748 13:34661832-34661854 CAACTTTTCTAGTGGACACCAGG - Intergenic
1107314113 13:39112704-39112726 CAACTTATCTAGATTGGATTTGG + Intergenic
1107443154 13:40446310-40446332 CAAATATTCAAGAGGGCACTGGG - Intergenic
1107714811 13:43189573-43189595 CTATTTTTCTTCATGGCACTTGG + Intergenic
1107826920 13:44337092-44337114 CAACTTTTCCTGAGGGCACATGG - Intergenic
1107902290 13:45029247-45029269 CAACTTTTCTTCATTGCACAGGG - Intronic
1109862312 13:68216340-68216362 CAATGTGTCTAGATGTCACTGGG + Intergenic
1110083608 13:71348000-71348022 CAACTTTTCTAAATGGCTGCAGG + Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1115031579 14:28802099-28802121 CAACTTTGCCAGCAGGCACTGGG + Intronic
1116779636 14:49222385-49222407 CAAGTTTTCTGAATGGCATTGGG + Intergenic
1117132995 14:52704934-52704956 CAATTTTTCTAAATGTGACTGGG - Intergenic
1120376147 14:83709740-83709762 GCACTATTCTAGATGGGACTGGG + Intergenic
1125107857 15:35995072-35995094 CAATTTTTCCAGATGGCTCCAGG + Intergenic
1127871834 15:63080379-63080401 CACCTCTTCTGGATGCCACTGGG - Intergenic
1127992625 15:64132097-64132119 CAAGATTCCTAGATGGCATTTGG + Intronic
1128332796 15:66766764-66766786 AAACAGTTCTAGAAGGCACTTGG + Intronic
1129621337 15:77149559-77149581 CAAGTATTTTAGATGGCATTTGG - Intronic
1130617543 15:85426265-85426287 CAACTTTCCTAATTAGCACTTGG - Intronic
1138016117 16:53430253-53430275 CAACTTTTTTAGATGTGACTTGG - Intergenic
1138213222 16:55180442-55180464 AGACTTTTCTAGATGGCTCTGGG - Intergenic
1139134720 16:64188202-64188224 TTACTTTTCTAAATAGCACTGGG + Intergenic
1140591089 16:76353581-76353603 CAATTTATCTAGGAGGCACTAGG - Intronic
1141662568 16:85449298-85449320 CGACTTTTCTGGATGGTTCTGGG + Intergenic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150597638 17:66620435-66620457 CAACTTTTCTAGAAGTGTCTAGG + Intronic
1156010286 18:32489355-32489377 CAAGTTTTCTAGGTGGCAGGAGG - Intergenic
1156700735 18:39821290-39821312 GAACTTTTCTAGAGAGAACTGGG + Intergenic
1156759333 18:40568553-40568575 CCACTATTCTACATGGCTCTGGG + Intergenic
1162466132 19:10841950-10841972 GAAATTTTGAAGATGGCACTTGG - Intronic
1162938353 19:13993408-13993430 CAAGGTTTCTGGATGGGACTTGG - Intronic
1164462107 19:28457706-28457728 CCACTTTTCTGAATGGCACTTGG - Intergenic
1164726386 19:30468563-30468585 CGACTTGTCCAGATGTCACTTGG + Intronic
1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG + Intronic
1165691955 19:37870512-37870534 AAAATTTTCTAAATGGCAGTTGG + Intergenic
1166192997 19:41188149-41188171 CAACTTTTTTAGCTTCCACTTGG - Intergenic
925372495 2:3356922-3356944 CACCTTTTCTGCATGGCAGTAGG + Intronic
925682441 2:6436793-6436815 CAACTTTTCAATATGTTACTAGG + Intergenic
926607928 2:14915908-14915930 CATCTTATGTAGATGGCAGTAGG - Intergenic
927413261 2:22850821-22850843 CCACTGTTCTAGATGGGACATGG - Intergenic
928760669 2:34578044-34578066 CAAGTTTTCTTTATTGCACTAGG - Intergenic
929231115 2:39561099-39561121 CAACTTATCTAGATTGAACCAGG - Intergenic
930368789 2:50477761-50477783 AAACTTTTATAAATGGCATTTGG + Intronic
932501544 2:72187152-72187174 CAGCTTTCCTGGATGGCACCAGG + Intronic
936479957 2:112877044-112877066 CAACTTTTCCAAATGACAATGGG + Intergenic
940341817 2:152589409-152589431 CAACTTTTATAGTTGGCAAAGGG - Intronic
941351856 2:164447819-164447841 TAACCTTTCTAGATGGCTCATGG - Intergenic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
943622121 2:190160304-190160326 CTACCTGTCTGGATGGCACTAGG + Intronic
947120781 2:226812272-226812294 CAACTTCTCTGTATGGCAATGGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1170873150 20:20226682-20226704 CTTGTTTTCTAGATGGCACGTGG - Intronic
1170883570 20:20318668-20318690 GAACTTTTCAAGGTGGCACTAGG - Intronic
1173721034 20:45258393-45258415 CAACTTTAATAAATGGCATTGGG - Intergenic
1173764105 20:45590810-45590832 CCACTTTTATATATGGCACTGGG + Intergenic
1174099809 20:48118671-48118693 CAAGCTTTCTAGAGGGCAATTGG - Intergenic
1174148141 20:48466864-48466886 CAACCTTTCTAGAGGGCAATTGG - Intergenic
1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG + Intergenic
1176267148 20:64215942-64215964 CAACTTTTCTATCTGCCACTGGG + Intronic
1178884736 21:36476242-36476264 CACTTTTTCTAGATGGCAGAAGG - Intronic
1183127558 22:35799241-35799263 ATACTTTTCTAAATGGCAGTGGG - Intronic
949646402 3:6100208-6100230 CAGCTTTTATAGAAAGCACTAGG - Intergenic
949929468 3:9067348-9067370 CAACTTTTCTTCATGGGTCTTGG + Intronic
954056108 3:48027307-48027329 CTAGTTTTCTAGATGGCTTTTGG - Intronic
955091490 3:55755735-55755757 CAACATTTTTAGAGGTCACTAGG - Intronic
959743614 3:109750184-109750206 CAACTTTTCTAGTGGACACCAGG + Intergenic
959746606 3:109782393-109782415 CATCTTTTCTTGGTGACACTGGG + Intergenic
960402146 3:117214103-117214125 CAAATATTGTAGATGGCATTTGG + Intergenic
963557483 3:146811142-146811164 CTTCTTATCCAGATGGCACTTGG - Intergenic
963562272 3:146880825-146880847 TAACTTTTCTAGATGTCCCTGGG + Intergenic
963961765 3:151317061-151317083 CATGTTTTCTAGATAGCAATAGG - Intronic
964746305 3:160015926-160015948 CAACTGTTCTAGAATACACTAGG - Intergenic
964825865 3:160827569-160827591 CTACTTTTAAAGATGACACTTGG + Intronic
967852317 3:194091412-194091434 CAACTTTTCTAGGTGACTCATGG - Intergenic
970311579 4:14787783-14787805 CAAGTTCTCCACATGGCACTAGG - Intergenic
972930933 4:44071110-44071132 CAGCTTTGCTGGCTGGCACTGGG + Intergenic
980606929 4:135104422-135104444 CAATTTTTTTAGATGGCAGTAGG - Intergenic
982855938 4:160383120-160383142 CATCTTATATAGATGGCAGTAGG - Intergenic
983270572 4:165557017-165557039 CAACTTTTCTACATACCAGTGGG - Intergenic
983529961 4:168800178-168800200 CAACTTTTGTATATAGCACAAGG - Intronic
989344114 5:40409922-40409944 CAGCTTTACTCGAAGGCACTAGG - Intergenic
990275315 5:54189618-54189640 TAACTTTTGTATATGGCATTAGG - Intronic
990330772 5:54723360-54723382 AAACTTTTCTTCATAGCACTAGG - Intergenic
993363392 5:87005036-87005058 CAGCTTTTATAGCTGGCATTAGG - Intergenic
995163046 5:109004126-109004148 CAACTTTTCTGAATGACAGTTGG + Intronic
997250213 5:132382841-132382863 CATCTATTATAGAGGGCACTTGG - Intronic
999626350 5:153524629-153524651 GTGCTTTTCTAAATGGCACTAGG + Intronic
1002837237 6:875147-875169 CACCTTTTCTAGAGTGCAGTGGG - Intergenic
1002883298 6:1271866-1271888 CAAGTTTTGCAGATGGCCCTTGG + Intergenic
1002893131 6:1355027-1355049 CAACCTTTCTAGATAAAACTGGG + Intergenic
1005834568 6:29698256-29698278 GAACTGTTGTAGATGGTACTAGG - Intergenic
1006892232 6:37438495-37438517 CAACATTTCTAGATTTCCCTAGG + Intronic
1008042965 6:46821369-46821391 AAACTTTTCTGGATTGGACTGGG - Intronic
1008805655 6:55424226-55424248 AAACTTTTCTAACTGGCACAAGG + Intergenic
1008956462 6:57221767-57221789 CACCTTCTCTAGCTGGAACTTGG + Exonic
1009852218 6:69211466-69211488 GAACTTTTTTAGATGTTACTTGG - Intronic
1010021829 6:71169354-71169376 CAATTTTTCCAGACAGCACTTGG - Intergenic
1013023554 6:106245161-106245183 CAACATCTCTAGATGGCTTTTGG + Intronic
1015507384 6:134003266-134003288 CTGCTTTTCTAGCTGGCACAGGG + Intronic
1020386299 7:7606757-7606779 CAACTTTTCAAAATGGCATTTGG - Intronic
1020782449 7:12533905-12533927 CAACTTTCATAGGTGTCACTGGG + Intergenic
1023129848 7:36991888-36991910 CCACTTTACTAGATGGCAACTGG - Intronic
1023144691 7:37138501-37138523 CAACTTTTCTAGATTAAACCAGG + Intronic
1024276455 7:47680940-47680962 CAATTTTTCTAATTGGCAATTGG - Intergenic
1028529604 7:91824474-91824496 AAACTTTTCCAGGTGACACTAGG - Intronic
1029095318 7:98080582-98080604 AAAATATTCCAGATGGCACTAGG - Intergenic
1031129086 7:117810454-117810476 CATGTTTTCTAGAAGGCACTAGG + Intronic
1031332002 7:120476914-120476936 CAACCTTTCTTGCTGGCATTTGG - Intronic
1033711576 7:143951504-143951526 CAATTTTTATATTTGGCACTAGG - Intergenic
1036155650 8:6339724-6339746 CAACTTTTCTGGAAGGAACTTGG - Intergenic
1041091270 8:54303200-54303222 CAACTTTTGTAGGTGACAGTGGG + Intergenic
1042770927 8:72381507-72381529 AAAGTTTTCTATATGCCACTCGG + Intergenic
1045950871 8:107850345-107850367 CCACTTTTAAAGATTGCACTTGG - Intergenic
1046775623 8:118160658-118160680 CAACTTTTGTATATGGCTCAAGG - Intergenic
1050500282 9:6290869-6290891 AAACTTTTCTAATTGGAACTTGG - Intergenic
1052106146 9:24519106-24519128 CAGTTTTTCTAAATGGCCCTAGG - Intergenic
1055453316 9:76450485-76450507 CAAACTTTCTAGAAGGCATTTGG - Intronic
1055938737 9:81628270-81628292 CACCATTTATAGATGGGACTAGG + Intronic
1057135161 9:92682351-92682373 ATACTGTCCTAGATGGCACTTGG + Intergenic
1057574310 9:96229508-96229530 CAACTTTTCTAGAAATCACTTGG + Intergenic
1058800779 9:108542815-108542837 CACCTCTTCTAGGTGGCAGTGGG + Intergenic
1203793095 EBV:161954-161976 CAACTTTTCCAGGCGGCGCTCGG - Intergenic
1185981139 X:4780224-4780246 AAACATTTCTAGAAGGCAGTTGG - Intergenic
1187827900 X:23351091-23351113 GAAATTTTGAAGATGGCACTTGG - Intronic
1188845312 X:35065189-35065211 CAACATTTCTTGATGACCCTGGG + Intergenic
1189125788 X:38444758-38444780 CAACTTTTTTAGCTCGCACATGG + Intronic
1190926250 X:54908088-54908110 GAACTGTTCTATATGGCATTGGG - Intergenic
1192283281 X:69706670-69706692 CAATTTTTCTAATTGGCAATTGG + Intronic
1193342111 X:80360987-80361009 CAAATATTGTATATGGCACTTGG - Intronic
1194330695 X:92580486-92580508 CTACTTCTTTAGATGGGACTAGG - Intronic
1195120848 X:101750530-101750552 CAACTTTTCTTGTTGGCAGGCGG + Intergenic
1195222061 X:102754406-102754428 CAACTTTTCTAGTTGTCAGTTGG - Intergenic
1195726375 X:107921606-107921628 CACATTTTCAAGTTGGCACTTGG + Intronic
1196781687 X:119389251-119389273 CACCTTTTCTGGATGGCAGATGG + Intergenic
1196941492 X:120780848-120780870 CCACATTTCTAGATGGGAATAGG - Intergenic
1197818730 X:130524636-130524658 CAAGTGTTCTACATGGGACTGGG - Intergenic
1200639400 Y:5699556-5699578 CTACTTCTTTAGATGGGACTAGG - Intronic