ID: 1165100174

View in Genome Browser
Species Human (GRCh38)
Location 19:33434577-33434599
Sequence CAGGATTCCCCGCAGGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165100165_1165100174 15 Left 1165100165 19:33434539-33434561 CCCTGGCAGGGCAGGCGGGAATG 0: 1
1: 0
2: 2
3: 25
4: 274
Right 1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1165100163_1165100174 19 Left 1165100163 19:33434535-33434557 CCATCCCTGGCAGGGCAGGCGGG 0: 1
1: 1
2: 1
3: 45
4: 392
Right 1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1165100157_1165100174 30 Left 1165100157 19:33434524-33434546 CCTCCACTGCACCATCCCTGGCA 0: 1
1: 0
2: 2
3: 54
4: 440
Right 1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1165100159_1165100174 27 Left 1165100159 19:33434527-33434549 CCACTGCACCATCCCTGGCAGGG 0: 1
1: 0
2: 4
3: 49
4: 391
Right 1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1165100166_1165100174 14 Left 1165100166 19:33434540-33434562 CCTGGCAGGGCAGGCGGGAATGG 0: 1
1: 0
2: 1
3: 22
4: 374
Right 1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165100174 Original CRISPR CAGGATTCCCCGCAGGACGA GGG Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
902741961 1:18445089-18445111 CAGGAGTCCCCTTAGGAAGAAGG + Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
919817247 1:201449197-201449219 CAGGCTGCCCAGCAGGACAAGGG - Intergenic
1064309065 10:14195669-14195691 CATGATTCCCAGCAGGAAGGTGG + Intronic
1067213751 10:44283114-44283136 CAGGGCTCCCCACAGGACGGCGG - Intergenic
1067441702 10:46312365-46312387 CAGGGTTCCCCTCAGCAAGATGG - Intronic
1067567025 10:47346740-47346762 CAGGCTTCCCAGCAGGGCTAAGG + Intergenic
1069920270 10:71811941-71811963 CACGATTCCCTGCAGGGAGAAGG - Exonic
1073540673 10:104314516-104314538 AAGGCTTCGCTGCAGGACGAAGG + Exonic
1076724102 10:132405347-132405369 CAGCAGGCCCCGCAGGACGACGG + Exonic
1080062662 11:27973642-27973664 CATGATTCTCCCCAGCACGATGG + Intergenic
1080411488 11:32029141-32029163 CAGAATTCCTCTCAGGAAGAGGG + Intronic
1083256997 11:61502755-61502777 CAGCATTCCTCCCAGGAGGAAGG + Intergenic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1096385253 12:51191006-51191028 CAGGATTCTCCACAGGATGCTGG + Intronic
1099284711 12:80703229-80703251 CAGGCTAGCCCTCAGGACGAAGG - Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1117745604 14:58866387-58866409 CAGGTTTCCCAGCAGGGAGAAGG - Intergenic
1121733888 14:96204900-96204922 CAGGCTGCCCCGCAGTACCAGGG + Exonic
1121920003 14:97871971-97871993 CAGAATTCCAGGCAGGAAGATGG - Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1123110997 14:105866775-105866797 CAGGGTTCCAGGCAGGACGGGGG + Intergenic
1128261753 15:66237528-66237550 TAGGCTTCCCCACAGGACGGTGG - Intronic
1128542630 15:68546422-68546444 CAGGACTCCCCGCAGGTCCCTGG - Intergenic
1131484653 15:92809589-92809611 CGGGATTCCCCGCAGGGCCTGGG - Intronic
1132207141 15:99993927-99993949 CAGGATTCCCAGCAGCAAGAAGG + Intronic
1132586269 16:706882-706904 CAGGCTTCCCATCAGGACGCTGG - Intronic
1132710574 16:1265353-1265375 CAGGATTCCCCGGAGGCTGAGGG + Intergenic
1136466813 16:30449959-30449981 CAGGGTTCCCCACAGGGCGGAGG - Intergenic
1145006864 17:19343234-19343256 CAGGCTGCCCCTCAGGCCGATGG + Exonic
1147883344 17:43668294-43668316 CAGCATTCCACACAGCACGAAGG + Intergenic
1150651456 17:67012995-67013017 CAGGATTCCCTTAATGACGATGG + Intronic
1151898903 17:76998734-76998756 CAGGATTTACAGCAGGATGAAGG - Intergenic
1152077524 17:78168657-78168679 CAGGAAGCGCCGCAGGTCGAAGG - Exonic
1152233935 17:79128712-79128734 CAGGAGTCCCCACAGGAGCAGGG - Intronic
1157331718 18:46708795-46708817 CAGGAGGCCCTGCAGGACCATGG - Intronic
1157801852 18:50627298-50627320 AAGGATTCCCCTCAGGGGGAAGG + Intronic
1160899748 19:1421738-1421760 CAGGAGTCCCAGCAGGACCTTGG - Intronic
1161055323 19:2188085-2188107 CTGGATCCTCCGGAGGACGAAGG - Intronic
1161759277 19:6159366-6159388 CAGCATTCCCAGCTGGAAGAAGG - Intronic
1163156043 19:15440395-15440417 CAGGGATCCCCCCAGGACGCAGG - Intronic
1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG + Intronic
1166218550 19:41351786-41351808 CTGCATTCCCCGCAGGATGCAGG - Intronic
925929165 2:8693736-8693758 CAGCATGCCCCCCAGGATGAGGG - Intergenic
928035822 2:27822180-27822202 CAGTCTTCCCAGCAGGACTATGG + Intronic
948151294 2:235747131-235747153 CAGGATTCCAGGCAGGACCCTGG - Intronic
1170764079 20:19275293-19275315 CAGCATTCCCTGCAAGAGGATGG + Intronic
1175282115 20:57810958-57810980 CTGCATTCCACGCAGGAGGAGGG + Intergenic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1181396609 22:22627506-22627528 CAGCATTCCCCTCAAGGCGACGG - Intergenic
1181704735 22:24643063-24643085 CAGCATTCCCCTCAAGGCGACGG - Intergenic
1181939784 22:26466225-26466247 GAGGATGCCCCGCAGGAACATGG - Exonic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
953028443 3:39159384-39159406 CAGAATTCCCCTCAGGACTATGG - Intergenic
953577866 3:44127743-44127765 CAGTATTCCCCCAAGGACAAGGG - Intergenic
961522354 3:127474032-127474054 CAGGAGTCCCAGCAGGGCCAAGG - Intergenic
969536267 4:7757666-7757688 CAGGAGACCTGGCAGGACGAAGG - Intergenic
980173156 4:129313452-129313474 CAGGATTCTGGGCAGGAAGAGGG - Intergenic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
1002764615 6:228204-228226 CAGGCTGCCCCGCAGGATGGTGG + Intergenic
1004253639 6:14043203-14043225 CAGGAGTCCCTGCATGAGGATGG + Intergenic
1013181258 6:107718695-107718717 CAGGATTTCCAGCAGTAAGAGGG - Intronic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1020099902 7:5388883-5388905 GAGGCTGCCCGGCAGGACGAGGG - Exonic
1023780353 7:43649608-43649630 CTGTATTCCCCTCAGGACCAAGG - Exonic
1035390083 7:158497813-158497835 CAGGTGTCCCCGCAGGAACAGGG - Intronic
1043008996 8:74858337-74858359 GAAGATTCCCTGCAGGACAATGG + Intergenic
1049537248 8:143188120-143188142 CAAGATCCCCCGCAGGACAGGGG - Intergenic
1060835477 9:126752475-126752497 CAAGATTACCCTCAGGACCAAGG + Intergenic
1062500798 9:136851211-136851233 CAAGATGCCCTGGAGGACGATGG - Intronic
1187871077 X:23766043-23766065 CAGGATTCCACGCCTGCCGAGGG + Intronic
1198268910 X:135035673-135035695 CAGGATTCCCCTGAGAACCAAGG - Intergenic
1198795610 X:140391042-140391064 CAGGCAACCCCGCAGGAAGAAGG - Intergenic
1200231032 X:154444007-154444029 CGGGAGTCCACGCAGGACCAGGG + Intergenic