ID: 1165100313

View in Genome Browser
Species Human (GRCh38)
Location 19:33435142-33435164
Sequence GGCAGAGGAGAGCAAAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 850
Summary {0: 1, 1: 2, 2: 6, 3: 91, 4: 750}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165100306_1165100313 -1 Left 1165100306 19:33435120-33435142 CCTCATCCATCCGGCATCTCCAG 0: 1
1: 0
2: 1
3: 9
4: 147
Right 1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG 0: 1
1: 2
2: 6
3: 91
4: 750
1165100303_1165100313 27 Left 1165100303 19:33435092-33435114 CCAAATGAGGTGGCTGAGACGGT 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG 0: 1
1: 2
2: 6
3: 91
4: 750
1165100305_1165100313 0 Left 1165100305 19:33435119-33435141 CCCTCATCCATCCGGCATCTCCA 0: 1
1: 0
2: 1
3: 23
4: 183
Right 1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG 0: 1
1: 2
2: 6
3: 91
4: 750
1165100308_1165100313 -7 Left 1165100308 19:33435126-33435148 CCATCCGGCATCTCCAGGCAGAG 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG 0: 1
1: 2
2: 6
3: 91
4: 750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165100313 Original CRISPR GGCAGAGGAGAGCAAAGGCC TGG Intronic
900127418 1:1074661-1074683 GGCAGCAGTGAGCAAAGGGCAGG - Intergenic
900824468 1:4914742-4914764 GGCAGAGGAGAGGAAGGACAGGG + Intergenic
901490280 1:9593178-9593200 GGCAGAGGCAAGCATAGGCTAGG + Intronic
901936325 1:12629676-12629698 GGCTTAGGAGAGCAGAGGGCTGG - Intergenic
902098490 1:13965991-13966013 GGCAGAGGACAGCAAAAAGCAGG + Intergenic
902185247 1:14720104-14720126 GGGAGAGCAGAGCCCAGGCCTGG + Intronic
902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG + Intergenic
902557261 1:17254264-17254286 GGCAGAGGAGACCAAGACCCAGG - Intronic
902627575 1:17685397-17685419 GGCACAGCAGTGCAAAGGCCCGG - Intronic
903169167 1:21541514-21541536 GGCAGAGGCCGGCACAGGCCGGG - Intronic
903259306 1:22122722-22122744 GGCAGCCGAGAGCACAGGCCTGG - Intronic
903502808 1:23810959-23810981 GGCAGTAGAGAGCAATGGCAGGG + Intronic
903996337 1:27307440-27307462 GGCAGAGGGGAGGAGAGGCCTGG - Exonic
904539363 1:31222467-31222489 GGCAAAGGAAAGTGAAGGCCTGG - Intronic
905035926 1:34918403-34918425 GGCAGGGGTGGGCCAAGGCCTGG - Intronic
905091214 1:35432857-35432879 GACAGAGGAGAACTCAGGCCCGG - Intergenic
905572114 1:39014325-39014347 GGCAGAGCAGACCAGAGGCAGGG + Intergenic
905581969 1:39089076-39089098 GACAGAAGGGAGAAAAGGCCGGG + Intronic
905816199 1:40952849-40952871 GGCAGTGGAGAGCCAAGTGCGGG - Intergenic
905971378 1:42144916-42144938 GGCAGATGTCAGCAAAGGGCTGG + Intergenic
906199944 1:43953512-43953534 GACTGGGGAGAGCAAGGGCCAGG - Intronic
906725915 1:48044093-48044115 GGCAGAGGAAAGGAACGGCACGG + Intergenic
906876207 1:49541694-49541716 GGCTGAGGAGTGCAACGGCGAGG + Intronic
906917403 1:50025774-50025796 GGCAGAGGAGACGAAAAGCCTGG + Intergenic
907340982 1:53736180-53736202 GGCAGAGGAGAATAAAGGGATGG - Intergenic
908229377 1:62088377-62088399 GGCAGAAGAGAGCAAATTCAGGG - Intronic
908414296 1:63897973-63897995 GACAGAGGAGAGGGAAGGCGTGG + Intronic
908443951 1:64183662-64183684 GGCAGAGGAGAGCAAAGTCCGGG - Intergenic
908504895 1:64787350-64787372 GGCAGAGGGAAGCTAAAGCCTGG + Intronic
908960881 1:69695675-69695697 GGCACAGGGCAGCAAGGGCCTGG - Intronic
909499725 1:76320544-76320566 GTCAGAGGATTGCAGAGGCCTGG - Intronic
909541135 1:76792771-76792793 GGGAAAGGAGGGCAAGGGCCAGG - Intergenic
910258593 1:85274925-85274947 GACAGAGAAGAACAAAGACCTGG + Intronic
910333122 1:86098345-86098367 AGCAGAGGAGAGGAAAGGAAAGG + Intronic
911074974 1:93864338-93864360 GGCAGAGGAGAGAAATACCCTGG + Intergenic
911083644 1:93958020-93958042 GGCAGAGCAGAACAGAGGCAAGG - Intergenic
912366820 1:109140527-109140549 GGGAGAGGGGAGCAAAGCACGGG + Intronic
912403396 1:109415795-109415817 GGCAGAGGTGAAAAGAGGCCAGG - Intronic
912438975 1:109683944-109683966 GGCAGAGGAGAACAAAGGAAGGG - Intronic
912441497 1:109702389-109702411 GGCAGAGGAGAACAAAGGAAGGG - Intronic
914422091 1:147538573-147538595 GGCAGAGGACAGAGAATGCCAGG - Intergenic
914428291 1:147599212-147599234 GGCGGAGGAGAGCGCAGTCCTGG + Intronic
915406047 1:155660392-155660414 GGCAGAAGAGAGCAAAGTCTGGG + Exonic
915419208 1:155766188-155766210 GGCAGAAGAGAGCAAAGTCTGGG + Exonic
915838443 1:159196844-159196866 AGCTCAGGAGAGCATAGGCCAGG - Intronic
916693696 1:167216255-167216277 GGCAGAGGGAAGCACAGGACTGG - Intergenic
916824185 1:168428500-168428522 TGCAGAGGGGAGAAAAGGGCAGG + Intergenic
916997307 1:170314808-170314830 GGCAGAAGAGAGCACAGGGAGGG - Intergenic
917077379 1:171219520-171219542 GGCAGAGGAGAACAAAGGAAGGG - Intergenic
917199162 1:172497332-172497354 AGGAGAGGAGAGAAAATGCCCGG - Intergenic
919942775 1:202299771-202299793 GACAGAGGTGAGCAGAGTCCAGG + Intronic
920030038 1:203031593-203031615 CGCAGAGGAGAGAAGAGGACGGG - Intronic
920171919 1:204077240-204077262 ATCAGAGGAGAGCCAAAGCCTGG + Intronic
920232579 1:204480489-204480511 TGCAGGGGAGAGCACAGGGCTGG - Intronic
920516538 1:206588517-206588539 GGCAGAGGATAGCAAAGAAATGG - Intronic
921054193 1:211531793-211531815 GGCTGGGGTGAGCAAAGGCCTGG + Intergenic
921928652 1:220734731-220734753 GAAAGTAGAGAGCAAAGGCCAGG - Intergenic
924033582 1:239912274-239912296 GGCAAAGGAGAGCAGAGCCGAGG - Exonic
1062914290 10:1235504-1235526 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914314 10:1235576-1235598 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914321 10:1235600-1235622 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914328 10:1235624-1235646 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914343 10:1235672-1235694 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914459 10:1236263-1236285 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914474 10:1236311-1236333 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914556 10:1236635-1236657 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914587 10:1236731-1236753 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914594 10:1236755-1236777 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914627 10:1236852-1236874 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914651 10:1236924-1236946 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914666 10:1236972-1236994 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914673 10:1236996-1237018 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914687 10:1237044-1237066 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914748 10:1237235-1237257 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914790 10:1237356-1237378 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914813 10:1237428-1237450 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914827 10:1237476-1237498 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914834 10:1237500-1237522 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914850 10:1237548-1237570 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914873 10:1237620-1237642 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914946 10:1237836-1237858 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914977 10:1237932-1237954 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062914984 10:1237956-1237978 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915009 10:1238029-1238051 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915047 10:1238146-1238168 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915059 10:1238191-1238213 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915066 10:1238215-1238237 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915106 10:1238335-1238357 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915141 10:1238452-1238474 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915157 10:1238501-1238523 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915189 10:1238597-1238619 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915224 10:1238714-1238736 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915231 10:1238738-1238760 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915271 10:1238858-1238880 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915306 10:1238977-1238999 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915321 10:1239025-1239047 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915335 10:1239073-1239095 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915342 10:1239097-1239119 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915401 10:1239271-1239293 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915416 10:1239319-1239341 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915449 10:1239416-1239438 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915463 10:1239464-1239486 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915477 10:1239512-1239534 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915501 10:1239584-1239606 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915524 10:1239656-1239678 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915565 10:1239776-1239798 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915620 10:1239944-1239966 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915634 10:1239992-1240014 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915651 10:1240040-1240062 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915666 10:1240089-1240111 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915689 10:1240162-1240184 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915706 10:1240210-1240232 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915713 10:1240234-1240256 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915720 10:1240258-1240280 GGCAGAGGGGAGTAAACACCGGG - Intronic
1062915735 10:1240306-1240328 GGCAGAGGGGAGTAAACACCGGG - Intronic
1063222236 10:3979858-3979880 TGGAGAAGAGAGCCAAGGCCAGG + Intergenic
1063368621 10:5507034-5507056 TGCAGAGGAGAGCAAGTGCCGGG - Intergenic
1063559671 10:7114418-7114440 GGAAGAGGTGAGCAAAGCGCCGG - Intergenic
1063866799 10:10373884-10373906 TGGAGAGGAGGGCAGAGGCCGGG + Intergenic
1063951188 10:11224896-11224918 AGCTGGGGAGAGCCAAGGCCAGG + Intronic
1064049214 10:12045668-12045690 CACAGACGAAAGCAAAGGCCAGG + Intergenic
1065134124 10:22651436-22651458 GGGAGAACAGAGCAAAGGCCGGG - Intronic
1065287801 10:24202364-24202386 GGGAGAGGAGAGCAAAGCTCAGG + Intronic
1065522894 10:26589114-26589136 GGCATAGGAAAGCAAACTCCAGG - Intergenic
1065528818 10:26648385-26648407 GGCATAGGAAAGCAAACTCCAGG - Intergenic
1066718648 10:38313914-38313936 GCCAGTGGAGACCAAAGGCTTGG - Intergenic
1067232836 10:44424292-44424314 AGCAGAGAAGTGCAAAGGTCAGG + Intergenic
1067684409 10:48458097-48458119 GGGAGAGGAAACCAAAGCCCAGG + Intronic
1068534028 10:58220216-58220238 GGCAGAGGAGAGAAGAGGAAGGG + Intronic
1068904064 10:62302958-62302980 GGCAGAGGGGAGAAAAGGCGTGG - Intergenic
1068930178 10:62581619-62581641 GGCAGAGCAGAGGAAGGGCAAGG - Intronic
1069039985 10:63685358-63685380 GGCAGAGGACAGTATAGGCCAGG - Intergenic
1069709856 10:70481237-70481259 GCCAGCGGACAGCAGAGGCCAGG + Intronic
1069888237 10:71637282-71637304 GGCAGAGAAGGGCAAAGGCTTGG - Intronic
1069999547 10:72366135-72366157 GCCAGAGAAGAACAGAGGCCTGG - Intergenic
1070385133 10:75917408-75917430 GTCAGTGGAGAACACAGGCCTGG - Intronic
1070727771 10:78803809-78803831 GGAGGAGATGAGCAAAGGCCAGG - Intergenic
1070931517 10:80264376-80264398 GACAGAGGAGGTCAAAGCCCAGG - Intergenic
1071498589 10:86188009-86188031 GGCAGGGCAGGGCAAAGGCCTGG - Intronic
1072635707 10:97176514-97176536 TGCAGAGGAGAGGACAGGCATGG - Intronic
1072966367 10:99976470-99976492 GACAGAGGAGAGCAGAGGGTAGG - Intronic
1073099735 10:101000220-101000242 GGCTGAGGAGAGCAGAGGGCTGG - Exonic
1073104942 10:101027219-101027241 GGCAGAGGAAAGCCCAGGCAGGG - Intronic
1073242006 10:102065343-102065365 GGATGAGGTGAGCAGAGGCCGGG - Intergenic
1073649875 10:105346988-105347010 GCCTGAGGAAAGGAAAGGCCAGG + Intergenic
1074104461 10:110377917-110377939 GGCAGAGGAGAGTCAAAGTCAGG + Intergenic
1074769214 10:116722617-116722639 GGCAGAGGAGGGCTCAGGACAGG - Intronic
1074846114 10:117399543-117399565 GGTGGAAGAGAGCAAAGGGCTGG - Intergenic
1074915504 10:117951162-117951184 GGCAGAGATGAGCAAGGGCCAGG + Intergenic
1075067939 10:119302356-119302378 GGCAGAGGAGCCCAAGGGCAGGG + Intronic
1075273534 10:121074098-121074120 GGCAGAGGAGGGCACAGTTCGGG + Intergenic
1075469451 10:122677210-122677232 GGCAGGTGTGAGCAAAGGCAAGG - Intergenic
1075605449 10:123802108-123802130 GGGACAGGGGAGCAGAGGCCAGG + Intronic
1076252117 10:128993377-128993399 GGCAGAGCAGAGGACATGCCAGG + Intergenic
1076410384 10:130244956-130244978 GGCCCAGAAGAGCAAGGGCCTGG - Intergenic
1076975083 11:165926-165948 GACAGAGGAGAGGAAGGGGCAGG + Intergenic
1076996012 11:297958-297980 AGCAGCAGAGATCAAAGGCCTGG + Intergenic
1077108805 11:853209-853231 GGCACAGGAGAGCAAAGCTAAGG - Intronic
1077145132 11:1041220-1041242 GGCAGCGGACAGCACAGGGCTGG - Intergenic
1077228614 11:1448954-1448976 GACAGAGAAGAGTAAAAGCCCGG - Intronic
1077230226 11:1455357-1455379 GGCAGTGGTGAGCACAGGGCAGG - Intronic
1077493117 11:2871218-2871240 AGCAGTGGCGGGCAAAGGCCTGG - Intergenic
1077516922 11:3007604-3007626 GGCAGAGGTGAGCACAGTCTTGG - Intronic
1078545955 11:12247129-12247151 GACACAGGAGAGCACTGGCCTGG - Intronic
1080033009 11:27681969-27681991 TCCAGGTGAGAGCAAAGGCCTGG - Intronic
1080652814 11:34236083-34236105 GGAAGAGAAGGGTAAAGGCCAGG + Intronic
1080874428 11:36263207-36263229 TGCAGACGAGAGCACTGGCCTGG - Intergenic
1081531047 11:43959609-43959631 GGCAGAGTAGAGCCAGGGCTAGG - Intergenic
1081534909 11:43989532-43989554 GGCAGAGGAAGGCCAAGGTCAGG - Intergenic
1081983149 11:47282626-47282648 GGCAGAGCGGAGCAGAGGGCAGG - Intronic
1082941625 11:58711202-58711224 GGCAGAGGAGAACAAAGGAAGGG - Intronic
1083425302 11:62581330-62581352 GACACAGGAGAGCAAAGGCCAGG + Intronic
1083544511 11:63538512-63538534 GGCAAAGGAGAGCAGACCCCAGG + Intronic
1083611957 11:64008546-64008568 GGCAGAGGAGCGCTCGGGCCCGG + Intronic
1083614960 11:64021696-64021718 GGAAGAGGAGAATGAAGGCCAGG - Intronic
1083791504 11:64989144-64989166 AGCAGAGGAGAGCAGAGGAAAGG + Exonic
1083791505 11:64989149-64989171 AGGAGAGCAGAGGAAAGGCCAGG + Exonic
1083796986 11:65022617-65022639 GGCAGAGGGGATCACAGGACAGG + Intronic
1083991077 11:66246138-66246160 GGCTGGTGAGAGGAAAGGCCAGG + Intergenic
1084039439 11:66532823-66532845 GACAGAGCAGAGCCAGGGCCAGG + Exonic
1084218168 11:67662812-67662834 TAGAGGGGAGAGCAAAGGCCTGG + Exonic
1084524015 11:69684799-69684821 GGCAGAGGAGAGGAAAAGCCAGG - Intergenic
1084554527 11:69868073-69868095 GGAACAGAAGAGCAAAGCCCAGG + Intergenic
1084792741 11:71485109-71485131 GGCAGAGGAAAAGAGAGGCCGGG + Intronic
1084898877 11:72294936-72294958 GGGAGAGGAGAGGAAACGTCAGG + Intronic
1085079773 11:73624560-73624582 GGGAGAGGAGAGGAGAGGACAGG + Intergenic
1085363423 11:75914554-75914576 GGCAGAAGTGAGCCAAGGTCGGG - Intronic
1085459003 11:76681828-76681850 GGCAGTGGTGAGCAGAGGCAGGG + Intergenic
1085496159 11:76971741-76971763 GGGAAAGAAGAGGAAAGGCCTGG + Intronic
1086414218 11:86572425-86572447 GGCAGTGGAAAGCAAAGGGAGGG - Intronic
1086966431 11:93032793-93032815 GGATGTGGAGAGCACAGGCCAGG + Intergenic
1088458115 11:110053835-110053857 GACAGAGGAGATCACAGGACTGG + Intergenic
1088638443 11:111847495-111847517 TGCTGAGGAGTGCACAGGCCTGG - Intronic
1088764747 11:112963553-112963575 GGCAGCGGAGACCCAGGGCCAGG - Intronic
1088825692 11:113491960-113491982 GGGTGAGGAGAGCTAAGCCCAGG - Intergenic
1088974238 11:114801338-114801360 GGCAGAGATGAGCAAATGCAAGG + Intergenic
1089576577 11:119448550-119448572 GTCACAGTAGAGCCAAGGCCGGG + Intergenic
1089777970 11:120852261-120852283 GGAAGAGGAAGGCAGAGGCCAGG - Intronic
1089810258 11:121125802-121125824 GGCACACAAGAGCATAGGCCTGG - Exonic
1089846435 11:121462314-121462336 GGCAGGGCAGAGCAGAAGCCAGG - Intronic
1090028621 11:123188469-123188491 GGCAGAGGAGAAGAAAGGAGAGG - Intronic
1090180707 11:124696787-124696809 GGCAGAGGAGAGAAAGGTCTGGG - Exonic
1090471906 11:126988551-126988573 GGCACAGGTGGGCATAGGCCTGG + Intronic
1090801078 11:130172710-130172732 GGAAGAGGACAGCAATGGCCGGG - Intronic
1090992046 11:131826626-131826648 AGGAAAGAAGAGCAAAGGCCAGG + Intronic
1091229921 11:133981576-133981598 GGCGGAGGGAAGGAAAGGCCAGG - Intergenic
1091283667 11:134396402-134396424 GACAGAGGAGAGCAAAGAGGTGG - Intronic
1091322696 11:134663236-134663258 TGGGGAGGAGAGCAAGGGCCAGG + Intergenic
1091677529 12:2502071-2502093 GGCTGAGGGGGGCAAGGGCCAGG - Intronic
1091697683 12:2638978-2639000 GGCAGAGGAGCGGAGAGGCCTGG + Intronic
1092024855 12:5231951-5231973 GGGACAGGAGTGCAAACGCCAGG + Intergenic
1092144512 12:6205203-6205225 GGGAGAGGTGAGCTGAGGCCAGG + Intronic
1092942233 12:13420590-13420612 AGCAGAGGAGAGCAAGGCACAGG - Intergenic
1093126173 12:15331005-15331027 GGTAGAGGAGATGGAAGGCCTGG + Intronic
1094026926 12:25969067-25969089 GGCTGGGGGGAGCAAAGGGCTGG + Intronic
1094597100 12:31875344-31875366 GGAAGAGGTGAGGAAAGGCAAGG + Intergenic
1096207550 12:49735547-49735569 GGCAGAGGCAAGGAAAGACCAGG + Intronic
1096558856 12:52421834-52421856 GGAACAGGAGAACAAAGTCCTGG - Intergenic
1096561701 12:52440146-52440168 TGCAGTGAACAGCAAAGGCCTGG - Intergenic
1096787815 12:54027730-54027752 GGCAAAGGAGAGCAGATGCGTGG + Intronic
1096994014 12:55827950-55827972 GGCAGATAAGCGCAAAGGCCTGG - Exonic
1098626666 12:72679389-72679411 AGAAGAGGAGGGGAAAGGCCTGG - Intergenic
1098848455 12:75566530-75566552 GGCAAAGGAGAGAGCAGGCCTGG - Intergenic
1100853508 12:98738135-98738157 GCCAGAGGACTTCAAAGGCCTGG - Intronic
1101085022 12:101226913-101226935 GGGAGTGGATAGCGAAGGCCTGG - Intergenic
1101522966 12:105502056-105502078 GGGAGAGGATAGCTAAGGCAGGG + Intergenic
1101851137 12:108403426-108403448 GGGAGAGGAGAGGAAAAGACAGG - Intergenic
1102498019 12:113332893-113332915 GGAAGTGGAGAGTAAGGGCCAGG - Exonic
1102962629 12:117102496-117102518 GCCAGAGGAGGGCAGAGCCCGGG - Intergenic
1102975131 12:117201412-117201434 GGGAAAGGAAAGCTAAGGCCGGG - Intergenic
1103132081 12:118478269-118478291 GGCAGAGGAAAGAGAAGGTCCGG - Intergenic
1103433836 12:120909018-120909040 GACAGAGGGGAGAAATGGCCTGG - Intergenic
1103480853 12:121248875-121248897 GGCAGGGGTGAGCAAAGGGGCGG + Intronic
1103930267 12:124446444-124446466 GGGAGAGGAGGGCACAGGCCAGG - Intronic
1104059010 12:125252260-125252282 TGCAGAGGGAAGCAAAGCCCAGG - Intronic
1104112475 12:125716906-125716928 GGCACAGCAGAGCGAAGGCCAGG + Intergenic
1104485746 12:129150093-129150115 CCCAGAGGACAGCACAGGCCAGG + Intronic
1104881206 12:132071729-132071751 TGCAGAGGGGTGCACAGGCCAGG - Intronic
1104982412 12:132579686-132579708 AGCACAGGAAAGTAAAGGCCAGG - Intronic
1105533076 13:21237551-21237573 GGCAGAGGTGATCTGAGGCCTGG + Intergenic
1106133373 13:26957636-26957658 GGCAGAAGAGATGAAAGACCTGG - Intergenic
1106187336 13:27421022-27421044 GGCAGAGGTAAGGAGAGGCCTGG + Intergenic
1109203494 13:59456303-59456325 GACAGAGATGAGCAAATGCCAGG + Intergenic
1110561159 13:76911941-76911963 GGTAGAGGAGAGCATAGTCCAGG - Intergenic
1110721705 13:78769109-78769131 GGCAGAGGACAGCACAGCTCAGG - Intergenic
1111559443 13:89925747-89925769 AACAGAGGACAGCAAAGGGCAGG - Intergenic
1111585879 13:90284310-90284332 GGCAGAGAAGGAAAAAGGCCAGG + Intergenic
1111622856 13:90746738-90746760 GGAAGAGGAGAGCAAAGAGGAGG - Intergenic
1112781246 13:102903349-102903371 GCCACAGGAGAGCAGAGGCAAGG + Intergenic
1113543786 13:111130927-111130949 GGGAGTGGCGAGGAAAGGCCTGG + Intronic
1113770701 13:112906648-112906670 GCCAGGTGAGAGCAGAGGCCTGG + Intronic
1113909645 13:113836166-113836188 ACCAGAGGAGAGCAAAGGCAGGG + Intronic
1114035910 14:18626970-18626992 GGGCGAGGCGAGCACAGGCCTGG + Intergenic
1114459879 14:22879479-22879501 GGAAGAGAAGAGCAAAGGAGAGG - Exonic
1114538996 14:23441007-23441029 TGGAGAGAAGAGGAAAGGCCTGG + Intergenic
1114569097 14:23653485-23653507 GGCAGGGGAGAGGAAAGGTGAGG - Intergenic
1114592929 14:23884732-23884754 GGTAGAGAAGAGGAAAGGCATGG + Intergenic
1114866188 14:26597923-26597945 GGCAGAGGAGGGCAGGAGCCGGG + Intergenic
1115140838 14:30169078-30169100 GGCATAGGACAGCAGAGCCCTGG + Intronic
1115407061 14:33029082-33029104 GGCAGAGTAGAGGAAAGGCCTGG + Intronic
1115645987 14:35368819-35368841 GGGGCAGGAGAGCAAATGCCTGG + Intergenic
1117141242 14:52792320-52792342 GGCACAGGTGAGTAGAGGCCGGG + Intergenic
1117278995 14:54219496-54219518 GGCTGCGGAGAGCAAGGGTCAGG - Intergenic
1117659208 14:57986598-57986620 GGCTTTGGAGTGCAAAGGCCTGG - Intergenic
1117796468 14:59399183-59399205 GTCACAGTAGAGCAAAGACCTGG - Intergenic
1118031182 14:61819747-61819769 GGTGGAAGAGAGCACAGGCCTGG + Intergenic
1119196024 14:72717128-72717150 GGCAGAGGAGAGCACAATCATGG - Intronic
1119399983 14:74356834-74356856 AGCAGTGGAGTGCGAAGGCCTGG + Exonic
1119441511 14:74631595-74631617 GGCAGGGGAGAGCCGAGGGCTGG + Intergenic
1119871762 14:78023889-78023911 GGCAGAGGAGATGAAAACCCAGG + Intergenic
1120664128 14:87285735-87285757 GGCCCATGAGAGCAACGGCCAGG - Intergenic
1120708601 14:87770758-87770780 GGCACTGGAGAGCAAGAGCCAGG - Intergenic
1120868346 14:89315433-89315455 TGCACAGGAGATCAAAGGCAAGG + Intronic
1121020280 14:90575651-90575673 GGCTGGGGAGAACACAGGCCAGG + Intronic
1121118908 14:91363789-91363811 CGCGGGGGAGGGCAAAGGCCTGG - Intronic
1121273324 14:92651972-92651994 GGGAGAGGTGGGCAAAGGACAGG - Exonic
1121319819 14:92985654-92985676 GACAGAGGGGAGCAAATGCCTGG + Intronic
1121320034 14:92986896-92986918 GACAGAGGGCAGCAAATGCCTGG + Intronic
1121410828 14:93747116-93747138 GGGAGAAGAGGGCCAAGGCCTGG + Intronic
1121805850 14:96821805-96821827 GCCAGGGGAGAGCAATGGCTGGG - Intronic
1123131685 14:105991771-105991793 GGGAGAGAAGAACAAAGCCCAGG + Intergenic
1123581916 15:21722962-21722984 GGAAGAGAAGAACAAAGCCCAGG + Intergenic
1123618565 15:22165562-22165584 GGAAGAGAAGAACAAAGCCCAGG + Intergenic
1123987679 15:25659425-25659447 GGGAGAGGAGAGCCAGGCCCCGG - Intergenic
1124029782 15:25999958-25999980 GGAAGAGAAGAGAAAAGGCCTGG - Intergenic
1124385422 15:29204417-29204439 GGCAGAGCAGGGCAGAGGGCTGG + Intronic
1124418059 15:29490861-29490883 GGCTGAGGAGAGCAGGCGCCTGG - Intronic
1124420208 15:29514592-29514614 TGCAGAGGAAAGGAAAGGCATGG - Intronic
1124633463 15:31350342-31350364 GGCAGAAGAGAGCTAAGGCGAGG - Intronic
1126437310 15:48648422-48648444 TGCCGGGGAAAGCAAAGGCCAGG - Intergenic
1126634371 15:50766630-50766652 GGCCCACCAGAGCAAAGGCCGGG - Intergenic
1127266615 15:57367383-57367405 GACAGAGGCCAGCAAAGCCCAGG - Intergenic
1127503666 15:59578069-59578091 GGCACAGGGGACCATAGGCCGGG - Intergenic
1127725449 15:61745041-61745063 GGCAAAGGAGAGAAAAAGCTGGG - Intergenic
1128124930 15:65185296-65185318 GGCAGAGAAGCGTGAAGGCCTGG - Exonic
1128449141 15:67792015-67792037 GGCAGAGGAGGGGCAGGGCCAGG + Intronic
1128497752 15:68207839-68207861 TGCAGAGGAGGGCAGGGGCCCGG + Exonic
1129116479 15:73368030-73368052 GGCAGCGGACAGCGAAGGGCCGG - Exonic
1129260720 15:74365778-74365800 GGCAGAGGCCAGCAGAGGCGAGG + Intronic
1129316729 15:74749783-74749805 GGCAGAAGATGGCAGAGGCCAGG - Exonic
1129413200 15:75361017-75361039 GCTAAAGGAGAGCCAAGGCCTGG + Intronic
1129708773 15:77809603-77809625 GGGAGAGCAGAGGGAAGGCCTGG + Intronic
1130877676 15:88028561-88028583 GGGAGAAGAGAGGAAAGGGCGGG + Intronic
1130992234 15:88882435-88882457 GCCAGAGGACAGCACAGCCCTGG + Intronic
1130997302 15:88911151-88911173 GGCAGAGGAGTGAAAAGGAAGGG + Intronic
1131222258 15:90594801-90594823 GGGAGGGGAGAGCACAGGCTGGG - Intronic
1131279693 15:91010645-91010667 CGCAGAGGAGAGCTAAGGACAGG + Intronic
1131826343 15:96324658-96324680 GGGAGGGGAGAGAAAAGGCCAGG + Intergenic
1131844434 15:96473579-96473601 GGCAGAGGTGAGGACAAGCCAGG + Intergenic
1132239717 15:100248438-100248460 GGAAGAGGAACGCAAAGGGCAGG + Intronic
1132477048 16:145019-145041 GGCCGGGGAGGACAAAGGCCGGG - Intergenic
1132627810 16:900236-900258 GTCAGAATCGAGCAAAGGCCAGG - Intronic
1132933317 16:2469455-2469477 GACAGTGGAGAGAAAAGCCCAGG - Intergenic
1133177378 16:4025509-4025531 GGCGGCGAAGAGCACAGGCCAGG + Intronic
1133317256 16:4892456-4892478 TGCTGAGGACAGCACAGGCCCGG - Intronic
1135173098 16:20203879-20203901 GACCCAGGAGTGCAAAGGCCTGG - Intergenic
1135281668 16:21158533-21158555 GGCAAAGGCGCGCCAAGGCCCGG - Exonic
1135665672 16:24333857-24333879 GGGAGAGGAGAGGAGAGGACAGG + Intronic
1135668991 16:24359140-24359162 GGCAGAGGAGAGAAAAAACATGG + Intronic
1135907007 16:26521412-26521434 GGCAGAGGTCAGCAGAAGCCAGG + Intergenic
1136345393 16:29672212-29672234 GTCAGAGGAGAGATAGGGCCAGG - Intronic
1136387900 16:29941475-29941497 AGCAGAGAAGAGGAAAGGCAGGG - Intronic
1136392852 16:29976260-29976282 GGCAGAAGGGAGAAAAGGGCCGG + Intronic
1136395198 16:29988671-29988693 GGATGAGGAGACCAAGGGCCTGG - Intronic
1136397514 16:30001228-30001250 GACTGAGGAGAGCAAAGCCCAGG + Intronic
1137513072 16:49118191-49118213 GCAACAGGAGAGAAAAGGCCAGG + Intergenic
1138228975 16:55324179-55324201 GGTGGAGGAGAGCAGAGGCCCGG - Exonic
1138353845 16:56362327-56362349 AGCAGAGGAGGGGAAAGTCCAGG - Exonic
1138393115 16:56684336-56684358 CACAAAGGAGAGCCAAGGCCAGG - Intronic
1138492534 16:57384665-57384687 AGCAGGGGAGTGCAGAGGCCAGG - Exonic
1138851560 16:60635571-60635593 GGGAGAGAAGAGAAAAGGCATGG + Intergenic
1139195900 16:64918280-64918302 GACAGAGGACAGCATAGGACTGG - Intergenic
1139563913 16:67761000-67761022 GGCAGGGAAGGGCAGAGGCCAGG - Intronic
1139925337 16:70482914-70482936 GGGAGAGGAGAGGAAAGGGATGG - Intronic
1140126929 16:72125484-72125506 GGCAGAGGACAGGAAGGGACTGG - Intronic
1140212126 16:72978608-72978630 GGCCTAGGAGAGCATCGGCCGGG + Intronic
1141126193 16:81402811-81402833 GGCAAAAGAGAGCACTGGCCTGG + Intergenic
1141437046 16:84005827-84005849 GGCAGAGGAGAGCACTGGCAGGG + Intergenic
1141477972 16:84286580-84286602 AGCAGAGGAGATGAGAGGCCCGG + Intergenic
1141745538 16:85923534-85923556 GGCAGAGGAGAGAACAGACATGG - Intergenic
1141955238 16:87366468-87366490 AGCAGAGCAGTGCAGAGGCCTGG + Intronic
1141992817 16:87620262-87620284 GGAAGAGTACAGCAGAGGCCAGG + Intronic
1142077560 16:88128856-88128878 GGCAGAGCAGAGCGCAGGGCAGG + Intergenic
1142122642 16:88394618-88394640 GGCAGAGGAGATGCCAGGCCTGG - Intergenic
1142194127 16:88731787-88731809 GCCAGAGGCGGGCAATGGCCTGG + Exonic
1142222471 16:88862300-88862322 GGCAGACGAGAGCCATGTCCTGG + Exonic
1142308014 16:89296323-89296345 GGCAGAGGAGAGAGCAGGGCAGG - Intronic
1142328006 16:89430877-89430899 GGAAGAGGAGAGCACAGGCAGGG - Intronic
1142483331 17:231641-231663 GGCAGAGGCTAGCATGGGCCAGG + Intronic
1143096610 17:4481600-4481622 GGCAGAGGGCAGCAGAGCCCAGG + Intronic
1143151437 17:4809469-4809491 TGCAGAGGAAAACAAAAGCCCGG - Intronic
1143381024 17:6496438-6496460 GGCAGTGGAGAGAAGAGCCCAGG - Intronic
1143515444 17:7417364-7417386 AGTAGAGGGCAGCAAAGGCCAGG - Exonic
1143738118 17:8928200-8928222 GGGAGAGGAGAAAGAAGGCCGGG + Intronic
1143767772 17:9148935-9148957 GGTAGAGGGGAACAAAGGGCTGG + Intronic
1143814916 17:9505080-9505102 GCCAGAGGAGACCAGAGGCTTGG - Exonic
1143873382 17:9974009-9974031 GGCAGAGGAGAGGCAGGACCTGG - Intronic
1144012446 17:11162505-11162527 GGTTGAGGAAACCAAAGGCCAGG + Intergenic
1144051618 17:11501861-11501883 GGAAAAGGAGAGAAAAGGGCAGG + Intronic
1144057897 17:11558336-11558358 GGCAGAGCAGAGCGGGGGCCGGG + Exonic
1144710147 17:17396162-17396184 AGCAGAGGACAGCACAGGCAGGG - Intergenic
1144789000 17:17847253-17847275 GGCAGAGGTGAGCACAGGGCGGG + Exonic
1144809650 17:17990514-17990536 AGCAGAGGAGAGCACATTCCTGG - Intronic
1145001236 17:19306191-19306213 CTCAGAGCAGAGCCAAGGCCAGG + Intronic
1145305208 17:21670271-21670293 GGCATGGGAAAGCAAGGGCCTGG + Intergenic
1145913483 17:28556301-28556323 GGCAGAGCTGTGCAAGGGCCTGG - Intronic
1146079114 17:29761308-29761330 GCCGGAGCAGAGCAGAGGCCAGG - Intronic
1146095829 17:29929812-29929834 GGCAGCCGAGTGCCAAGGCCTGG + Intronic
1146259737 17:31413547-31413569 GGGAGAGGGTAGCCAAGGCCAGG - Intronic
1146263475 17:31436410-31436432 GGCAGAGTGGAGCCGAGGCCTGG + Intronic
1146713225 17:35061059-35061081 TGGAGAGGAGAGAAATGGCCAGG + Intronic
1147161417 17:38571503-38571525 GGCAGAGGGCAGGAAGGGCCAGG + Intronic
1147324760 17:39664929-39664951 GGCAGAGGAGAGCACAGCCAGGG + Exonic
1147327302 17:39675581-39675603 GGCGGAGATGAGGAAAGGCCAGG + Intronic
1147648657 17:42049643-42049665 GGCAGAGGGGTGCAAAAGCAAGG + Intronic
1147913600 17:43873211-43873233 TGCAAAGGAGGGCAAAGTCCTGG - Intergenic
1148552043 17:48556203-48556225 GGAAGAGGTGAGCAAAGGCAAGG + Intronic
1149048067 17:52270654-52270676 GGGAGAGGAGAGCCGAGGCCAGG + Intergenic
1149949543 17:60971222-60971244 GGCAGATGAGACCACTGGCCAGG + Intronic
1149960566 17:61105246-61105268 GTCTGAGGAAAGCAAAGGCCAGG - Intronic
1150101112 17:62424252-62424274 GGCGGCGGAGAGAAAAGTCCAGG + Exonic
1150219585 17:63488598-63488620 AGCAGAGGTGAGCTAAGGGCTGG + Intronic
1150272105 17:63873298-63873320 GGCAGAGCAGGGCAAAAGCCAGG + Exonic
1150273459 17:63881478-63881500 GGCAGAGCAGGCCAAAAGCCAGG + Exonic
1150275653 17:63896194-63896216 GGCAGAGCAGGGCAAAAGCCAGG + Exonic
1150277785 17:63910883-63910905 GGCAGAGCAGGGCAAAAGCCAGG + Exonic
1150279071 17:63918465-63918487 GGCAGAGCAGGCCAAAAGCCAGG + Exonic
1150284339 17:63946798-63946820 GGCAGAGGTAAGCTAAGGGCGGG + Intronic
1150382034 17:64728599-64728621 GGCATTGGAGAGCAAACTCCAGG + Intergenic
1150641512 17:66952918-66952940 GTCTGAGGAGCCCAAAGGCCAGG + Intergenic
1150774233 17:68066254-68066276 GGCATTGGAGAGCAAACTCCAGG - Intergenic
1150906814 17:69347022-69347044 GGAAGAGGAGAGCAGAGGAGAGG + Intergenic
1151460347 17:74250436-74250458 GGCCGAGGGGAGCGATGGCCTGG + Intronic
1151890668 17:76948979-76949001 GGCAGAGGAGAGCCGTGCCCGGG + Exonic
1152228450 17:79103260-79103282 AGCAGAGGAGAGGGAAGGACAGG + Intronic
1152356630 17:79810620-79810642 GGCGGAGGAGCGGGAAGGCCCGG + Intergenic
1152404247 17:80087416-80087438 GACAGAGGAGAGGAGAGGACAGG - Intronic
1152502195 17:80719614-80719636 CTCAGAGGAGGGCAAAGGACAGG + Intronic
1152521279 17:80858293-80858315 GGCACAGGAGAGCCAATGCGGGG - Intronic
1152570407 17:81119104-81119126 GGCAGAGGAGAGCCGAGTGCAGG + Intronic
1152731887 17:81976696-81976718 GAGAGAGGAGTGCCAAGGCCCGG + Intergenic
1152813404 17:82392856-82392878 AGCTGAGGAGATCAAATGCCCGG - Intronic
1153019657 18:615584-615606 GGAAGAGCAGAGCAGAGTCCTGG - Intronic
1153536867 18:6110988-6111010 GGCAGAGGAGAGATAGGACCTGG - Intronic
1153854562 18:9133372-9133394 GGCAGAGGTGAGCAATTACCTGG + Intronic
1154167055 18:12023579-12023601 GGCAGAGATGAGCACAGGGCGGG - Intronic
1154175752 18:12086672-12086694 AGCAGATCAGAGCCAAGGCCGGG - Intergenic
1154297438 18:13162890-13162912 AGCAGGAGAGAGGAAAGGCCGGG + Intergenic
1155605929 18:27606063-27606085 GGCAGAGGGGAGGATGGGCCTGG + Intergenic
1156035962 18:32769333-32769355 GGCAGATGGGGCCAAAGGCCAGG - Intronic
1156352761 18:36315332-36315354 GGCTGAGGCCAGGAAAGGCCTGG - Intronic
1157485505 18:48084239-48084261 GGCAGTGGGGAGCAAAGATCAGG + Intronic
1157504790 18:48218674-48218696 GGCCAAGGAGAGCAGAGTCCAGG - Intronic
1157823342 18:50790078-50790100 AGCAGAGAAAAGCCAAGGCCAGG + Intergenic
1158242150 18:55389359-55389381 GCCAGAGAAGGGCAAAGGCTAGG - Intronic
1158481414 18:57824697-57824719 GGAAGAGGAGTGCAGAGGCTGGG - Intergenic
1158971766 18:62674730-62674752 CACAGAGGTGAGAAAAGGCCTGG - Intergenic
1160652035 19:236109-236131 GACAGAGGAGAGGAAGGGGCAGG + Intergenic
1161391509 19:4023635-4023657 GCAGGAGGAGAGCAAGGGCCGGG + Intronic
1161522355 19:4731817-4731839 GCCAAAGGAGAGAAAAGGCCTGG + Intergenic
1161967063 19:7554763-7554785 GGCACGGGAGGGCAAAGGACGGG - Intronic
1162079986 19:8212067-8212089 TGCAGAGGAGAGAAACTGCCAGG + Intronic
1162782154 19:13012021-13012043 GGGAGAGGACAGCACATGCCTGG + Intronic
1163035317 19:14566168-14566190 GGCAGAGTTGGCCAAAGGCCAGG - Exonic
1163314251 19:16531567-16531589 GGCTCAGGGGAGCAAGGGCCTGG + Intronic
1163415572 19:17184545-17184567 TGCAGAGGAGAGGGACGGCCAGG + Intronic
1163513137 19:17747895-17747917 GGCTGCGGAGGGCAAAGGCGCGG + Intronic
1164431869 19:28196009-28196031 GGCAGAGGAGATCAGAGGGAAGG - Intergenic
1164530061 19:29041768-29041790 TGCAGAGCAGAGCAAAGGAAGGG + Intergenic
1164787328 19:30943965-30943987 GGCAGAGGAAAACAAGGTCCTGG + Intergenic
1165091410 19:33390008-33390030 GGCAGAGGCGAGCATGGGCGCGG - Intronic
1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG + Intronic
1165754168 19:38282384-38282406 GGCAGAGGTGGGTGAAGGCCAGG + Intronic
1165805853 19:38580214-38580236 GGCTGAGGAGGGGCAAGGCCAGG + Intronic
1165929753 19:39349454-39349476 GGGAGAGGAGAGGAGAAGCCAGG - Intronic
1166089626 19:40499895-40499917 GGCAGTGAAGAATAAAGGCCAGG + Intronic
1166342109 19:42144391-42144413 GGGAGAAGAAGGCAAAGGCCAGG + Intronic
1167319513 19:48787638-48787660 GGCAGAGGAGAACAAAGGAAGGG + Intergenic
1167608581 19:50494946-50494968 GGCAGAGGAGAGGATACGCAGGG + Intergenic
1167649853 19:50723339-50723361 AGCAGAGGAGACCAACGGACCGG + Exonic
1167718067 19:51156980-51157002 AGTAGCTGAGAGCAAAGGCCAGG - Intergenic
1168064162 19:53909763-53909785 GGCTGGGGAGGGCAGAGGCCGGG + Intronic
925012876 2:498840-498862 GGAAGAAGAGAGAAATGGCCTGG + Intergenic
925054383 2:845940-845962 TTCAGAGCAGAGCAAAGGGCAGG - Intergenic
925313307 2:2903260-2903282 GGCAGAGGACAACAGATGCCAGG - Intergenic
925588345 2:5485544-5485566 GGCCCAGGATAGCAAAAGCCAGG + Intergenic
925735342 2:6958765-6958787 GGCAGAGGAGGACATGGGCCTGG + Intronic
926445040 2:12931268-12931290 GAGAGAGGTGAGCAAAGTCCTGG + Intergenic
926450850 2:13002007-13002029 GGCAGAGGAGAGTAGAAGACTGG + Intergenic
926847874 2:17161875-17161897 GGCAGTGCAGAGCAAAGGGAAGG + Intergenic
927438446 2:23090574-23090596 AGGAGAGGAGAGCAAAGGGGAGG + Intergenic
927471895 2:23383913-23383935 AGCCAAGGAGAGCAGAGGCCTGG + Intergenic
927645128 2:24872731-24872753 GGAAGAAGAGAGAAAAGGCCAGG + Intronic
927868175 2:26606379-26606401 GACAGAGGGGAGCAAAGCCGAGG + Intronic
927871910 2:26629245-26629267 GGCAGAGGAGTGCAAGGACATGG - Intronic
928394115 2:30931083-30931105 AGCAGTGGGGAGCAAAGGCAGGG - Intronic
928862986 2:35882661-35882683 AGAAGAAGAGAGTAAAGGCCTGG - Intergenic
929002589 2:37362806-37362828 GGCAGAGGTGAGGAAGGGGCTGG + Intronic
929460316 2:42098506-42098528 GGCAGAGGAGAGGGAAGGGAAGG - Intergenic
929756223 2:44767933-44767955 AGCTCAGGAGAGCAAAGGCTTGG + Intronic
929787737 2:45004359-45004381 GGAAGAGGAGAGAAAAGACAGGG - Intergenic
930118261 2:47738604-47738626 GGAAAAGGAGAGCAAAGGTCTGG + Intronic
930243873 2:48963590-48963612 TGCAGAGATCAGCAAAGGCCAGG + Exonic
930384642 2:50678783-50678805 GGGAGAGGAGAGAGAAAGCCAGG + Intronic
930421089 2:51153440-51153462 TGCTGAGGAGAGCACAGGCTGGG + Intergenic
931616778 2:64167387-64167409 TGAAGAGGTGAGCAGAGGCCAGG - Intergenic
931777947 2:65556205-65556227 GGGAGGGGAGAGAAGAGGCCTGG + Intergenic
932279863 2:70481248-70481270 GGAAGAGTAGAGCACAGGCTGGG - Intronic
932411035 2:71547983-71548005 GCCCGAGGAGAGCAGTGGCCAGG - Intronic
932490052 2:72114677-72114699 AGCTATGGAGAGCAAAGGCCTGG - Intergenic
932596305 2:73095803-73095825 GACAGAGGCCAGTAAAGGCCTGG + Intronic
933789607 2:85873268-85873290 GGCAGAGCTGAGCAAAGCCATGG - Intronic
936457810 2:112688758-112688780 GTGAGTTGAGAGCAAAGGCCAGG + Intergenic
936919586 2:117674165-117674187 GGCAGAGGAGACCAGGGGCAAGG - Intergenic
937325315 2:120986608-120986630 GGAAGTGGTGAGTAAAGGCCTGG + Exonic
937816746 2:126259120-126259142 AGCAGATGAGAGCACAGGCATGG + Intergenic
937820769 2:126308132-126308154 GTCAGAGGAGAGCCCGGGCCAGG - Intergenic
938139097 2:128782099-128782121 AGCAGAGGAGGGGAAAGGACAGG + Intergenic
938235050 2:129699165-129699187 GGGAGGGGAGGGCAAAGGGCAGG + Intergenic
938305892 2:130253765-130253787 GACAGAGGAGAGGTAAGGTCTGG - Intergenic
938980647 2:136522943-136522965 GCCAGAGGAGAGCACAGGCCTGG + Intergenic
939251668 2:139688702-139688724 GGCAGAGGCGGGCAGAGGTCAGG - Intergenic
939346803 2:140976261-140976283 GGGAGAGGAGAGGAAAGGACAGG - Intronic
939651507 2:144768110-144768132 GGCAAAGGAGAGCAGAGAGCTGG - Intergenic
939987785 2:148849041-148849063 GCCAGAGGAAAGCACAGGCTTGG - Intergenic
940812390 2:158259780-158259802 GGCAGAGAAGGACAAAAGCCTGG - Intronic
941080601 2:161056457-161056479 GGCAGAGAAGAACAAAGGAAAGG - Intergenic
941383322 2:164822494-164822516 GGCAGTGGATTGCAAGGGCCAGG - Intronic
941843005 2:170107768-170107790 GGCAGAGGAGACAAAAGGTCAGG - Intergenic
942371735 2:175293108-175293130 GAAGGAGGGGAGCAAAGGCCTGG + Intergenic
942498564 2:176564482-176564504 CTCAGAGGAGAGAAAAGGGCTGG + Intergenic
942600870 2:177639677-177639699 GGCAGAGAAACACAAAGGCCAGG - Intronic
942677509 2:178443866-178443888 GGAAAAGGAGACCAAAGGACTGG + Intronic
943614844 2:190081353-190081375 GGGAGAGGAGAGGAAAGGCATGG - Intronic
944932489 2:204534284-204534306 GGCAGTGGAGAGAAATTGCCTGG + Intergenic
946183909 2:217965995-217966017 GAGAGAGGAGAGGAAAGTCCTGG - Intronic
946347867 2:219125681-219125703 GGCAGAGAAGAGCATAGCCTGGG - Intronic
947185170 2:227448567-227448589 GGAAGAGGAAAGGAAAGGCTAGG - Intergenic
947622202 2:231597937-231597959 GAGAGAGAAGGGCAAAGGCCTGG + Intergenic
947941885 2:234064103-234064125 GGCAGAGGGGAGGGGAGGCCAGG - Intronic
947947826 2:234121554-234121576 GGCAGGGGAGAGCAGAGGAGAGG - Intergenic
947967361 2:234292338-234292360 ACAAGAGGAGAGCAAAGGACAGG + Intergenic
948008717 2:234633375-234633397 GGGAGAGGAGAGAACAGGCAGGG + Intergenic
948432817 2:237930832-237930854 GTCAGAGGCCAGCAAAAGCCAGG - Intergenic
948694070 2:239724420-239724442 GGCAGAGCAGAGCAAAGCACGGG - Intergenic
949020519 2:241738589-241738611 GGCAGAGGAGAGGAAGAGCGTGG - Intronic
1168960614 20:1866890-1866912 GGCAGAGGAGAGGAAAAGACAGG - Intergenic
1169752819 20:9012268-9012290 GGGAGAGGAGAGCAGAAGACAGG - Intergenic
1171062297 20:21977684-21977706 GGCAGATTCGAGCAAAAGCCTGG - Intergenic
1171382051 20:24741747-24741769 GGCTCATGCGAGCAAAGGCCAGG + Intergenic
1172107445 20:32525113-32525135 GGAAGTGCAGAGCAAAGGGCTGG + Intronic
1172193389 20:33075797-33075819 GGAAGAGCCGTGCAAAGGCCTGG - Intergenic
1173187004 20:40848041-40848063 GGCAGCTGTAAGCAAAGGCCTGG + Intergenic
1173224513 20:41154439-41154461 GAAAGAGAAGAGCAAAGGCAGGG - Intronic
1173556463 20:43969627-43969649 GGCAGAGGTGGGCAAAGAACAGG + Intronic
1173658185 20:44715417-44715439 GGCAGAGGAGGGAGAAGGCCAGG - Exonic
1173737268 20:45371027-45371049 TGCAGTGGAGTGCAAAGTCCTGG + Intronic
1173850606 20:46215729-46215751 GGCAGAGCAGAGAGGAGGCCAGG - Intronic
1173990031 20:47295091-47295113 GGGATATGAAAGCAAAGGCCAGG + Intronic
1174180350 20:48670451-48670473 AGCAGGAGAGAGCAGAGGCCAGG - Intronic
1175107847 20:56627328-56627350 GGGAAAGGAGAGCCAGGGCCTGG + Intergenic
1175188840 20:57198046-57198068 GGGAGAGGAGAGGAGAGGCAAGG - Intronic
1175230825 20:57472088-57472110 GGCAGGGGACAGCAAGGGCCTGG - Intergenic
1175683253 20:61006653-61006675 GGCAGCTGAGAGCAAGGCCCTGG - Intergenic
1175707330 20:61190161-61190183 CGCACAGGAGGCCAAAGGCCGGG - Intergenic
1176666050 21:9688661-9688683 GGCAGAGGAGTGGTCAGGCCGGG - Intergenic
1178050881 21:28745860-28745882 GGCAGCGGAGAGCTAAGGTTTGG - Intergenic
1179294809 21:40052165-40052187 GCCTCAGGAGAGAAAAGGCCAGG - Intronic
1179487024 21:41716969-41716991 GGCAGAGAAGAGCAAGGGGAGGG - Intergenic
1179715123 21:43282414-43282436 GGCAGAGGCGGGCACAGGCAAGG + Intergenic
1179799647 21:43804917-43804939 GGCCAAGGAGAGGGAAGGCCAGG + Exonic
1179801696 21:43814308-43814330 AGCAGCGGAGAGAAAAGGACAGG - Intergenic
1180127158 21:45800580-45800602 GGCAGCTGAGAGCAGAGGGCAGG - Intronic
1180220406 21:46354872-46354894 GCCAGAGAAGGGCAAGGGCCCGG + Intronic
1180222738 21:46369809-46369831 GGCAGAGAGGACCAAAGCCCTGG + Intronic
1180460033 22:15554024-15554046 GGGCGAGGCGAGCACAGGCCTGG + Intergenic
1180783923 22:18536499-18536521 GACAGAGGTGACCAAAGGACAGG + Intergenic
1180835074 22:18925732-18925754 GGAGGGGGAGAGCAAAGGTCAGG + Intronic
1181027439 22:20134112-20134134 GGCAGAGGTCAGCATAGGCCAGG - Intronic
1181127490 22:20710548-20710570 GACAGAGGTGACCAAAGGACAGG + Intronic
1181240822 22:21475851-21475873 GACAGAGGTGACCAAAGGACAGG + Intergenic
1182299754 22:29330925-29330947 GGGAGGGGAGATCCAAGGCCTGG - Intronic
1182360513 22:29743868-29743890 GGGAGGGGAGAGGCAAGGCCTGG + Intronic
1183188417 22:36305914-36305936 GGCAGAGGTGAGCCAGGGCCCGG - Exonic
1183467126 22:37985401-37985423 GGCAGAGGAGGGAAGAGGCAGGG - Intronic
1183468139 22:37990396-37990418 CTCAGAAGAGAGCAGAGGCCAGG - Intronic
1183472450 22:38016880-38016902 GAAAGAGCAGAGCAAGGGCCTGG + Intronic
1183553288 22:38505920-38505942 GGGGGAGGAGAGGAGAGGCCTGG - Intronic
1183724096 22:39578868-39578890 GGCAGAGGAGGGGAAAGGCTGGG - Intronic
1184038089 22:41928006-41928028 GCCAAAGGGGAGCAAAGGCTTGG + Intergenic
1184067851 22:42130404-42130426 GGAAGAGTAGGGCAAGGGCCTGG - Intronic
1184070586 22:42144076-42144098 GGAAGAGTAGGGCAAGGGCCTGG - Intergenic
1184072478 22:42154636-42154658 GGAAGAGTAGGGCAAGGGCCTGG - Intergenic
1184692336 22:46122990-46123012 GGCAGAGGATAGCAGAGCCCAGG - Intergenic
1184692675 22:46124294-46124316 GGCAGTGGCGAGCCAAGGACGGG - Intergenic
1184915084 22:47563659-47563681 GCCAGGGCAGAGCAGAGGCCTGG + Intergenic
1185360747 22:50405273-50405295 GGCAGGCGAGTGCGAAGGCCTGG + Intronic
1185360772 22:50405391-50405413 GGCAGACGAGTGTGAAGGCCTGG + Intronic
1185360791 22:50405490-50405512 GGCAGACGAGTGTGAAGGCCTGG + Intronic
1185363618 22:50424081-50424103 GGCTGAGGAGAGGAAGGGGCAGG + Intronic
1185414172 22:50700757-50700779 GGCAGAGCAGAGCAATGGAGAGG + Intergenic
1203285163 22_KI270734v1_random:151031-151053 GGAGGGGGAGAGCAAAGGTCAGG + Intergenic
950014064 3:9743867-9743889 GGCAGAGGAGAGCAGCAGCCAGG + Exonic
950660882 3:14466419-14466441 GGCAGAGGGGAGCACTGGTCAGG - Intronic
950988186 3:17399726-17399748 CTGAGAGGAGAGCAAAGGCCAGG - Intronic
951728812 3:25787881-25787903 GCAGGAGGAGAACAAAGGCCTGG - Intronic
952218681 3:31302806-31302828 GACAGAGAAGAGGAAAGGGCAGG - Intergenic
952906017 3:38139535-38139557 GGCAGATGTGAGCAAGGGGCTGG - Intronic
953232130 3:41074643-41074665 GGAAGAGGAGAACAAAGCCAGGG - Intergenic
954687448 3:52378508-52378530 GGCACAGCACAGCAAAGGCAAGG + Intronic
954798270 3:53172455-53172477 GGCGGAGGAGACCAAGGCCCAGG - Intronic
954846780 3:53566329-53566351 GGAAGAGGAGAGCAAATGCTTGG - Intronic
955082776 3:55673287-55673309 GACAAAGGGGAGCAGAGGCCGGG + Intronic
956468032 3:69537911-69537933 GACAGAGGACATCAAAGGGCTGG - Intronic
956900411 3:73709525-73709547 GGAAGAGAAGAGCAAGGGCAAGG + Intergenic
960263449 3:115593834-115593856 GGCAGAGAAGGGAAAAGGTCTGG - Intergenic
960337672 3:116437676-116437698 GGGAGAGGAGAGAAAAGGAGAGG + Intronic
961527026 3:127510716-127510738 GACAGAGAAGAGGAAAGACCTGG + Intergenic
961554634 3:127689581-127689603 GTGAGAGGAAGGCAAAGGCCAGG - Exonic
961580242 3:127875030-127875052 GGCAGAGGGCAGCAGGGGCCTGG - Intergenic
961674039 3:128554359-128554381 GGCTGAGCAGAGGTAAGGCCTGG - Intergenic
961779196 3:129311668-129311690 TGCAGAGGAGAGCTCAAGCCTGG + Intergenic
962484703 3:135831154-135831176 GGGAAAGAAGAGCATAGGCCGGG - Intergenic
963810939 3:149775800-149775822 GAAAGAGGAAAGCAAAAGCCAGG + Intronic
964430971 3:156605785-156605807 AGCAGAGGAGAGAAGTGGCCGGG - Intergenic
964492877 3:157255618-157255640 GACAAAGGAGAGCACAGGCAGGG + Intergenic
964567502 3:158073541-158073563 GGGAAGAGAGAGCAAAGGCCGGG + Intergenic
964993689 3:162847151-162847173 GGCAGATGAGAAAAAATGCCTGG - Intergenic
967893358 3:194378890-194378912 AGCAGGGCTGAGCAAAGGCCTGG + Intergenic
967942570 3:194777461-194777483 GGCAGAGGAAAGGAAGGACCTGG + Intergenic
967968661 3:194983749-194983771 GGCAGAGGGGATCAAAGCACAGG - Intergenic
967996619 3:195171679-195171701 GGAAGAGGAGAGAAAGGGCAGGG - Intronic
968049340 3:195643384-195643406 GGCACAGAAGCGCAAAGGCCTGG + Intergenic
968098062 3:195946240-195946262 GGCACAGAAGTGCAAAGGCCTGG - Intergenic
968106567 3:196005756-196005778 GGTACAGAAGTGCAAAGGCCTGG - Intergenic
968305277 3:197646548-197646570 GGCACAGAAGCGCAAAGGCCTGG - Intergenic
968851603 4:3084116-3084138 GGCAGAGGAGAGAAAAGAGAGGG + Intronic
969665055 4:8552699-8552721 GGCAGTGGAGAGCGGAGGCTGGG - Intergenic
969707255 4:8818755-8818777 GGCAGGGGAGAGCAAGGGTAAGG + Intergenic
970246253 4:14067164-14067186 GGCAGAGGAGAACAATGACCTGG + Intergenic
970298780 4:14659898-14659920 GGCAGAGAAGAGAAAAGGCAAGG + Intergenic
972350470 4:38231833-38231855 GGCAGATGAGGCCAAAGGCCAGG + Intergenic
973602730 4:52558000-52558022 GGCAGAGGAGAGGAAAGGAAGGG + Intergenic
973620705 4:52722578-52722600 GGAGGAGGAGAGGAAACGCCTGG + Intergenic
973784268 4:54320617-54320639 GGCAGAGGAGAGAATAGGTATGG + Intergenic
974827934 4:67153032-67153054 GACAGAGGAGAGCCAGGGCATGG - Intergenic
975285336 4:72611139-72611161 GCCACTGGAGAGCAAAGGACAGG + Intergenic
975672940 4:76800025-76800047 GGCAGAAAAGAGCAAAGGAAGGG + Intergenic
976845914 4:89489586-89489608 GGAACAGGAGAGCCTAGGCCAGG + Intergenic
978413135 4:108446856-108446878 GGCTGAGGAGGGCAAGGGCTCGG + Intergenic
979068422 4:116168804-116168826 GGCAAAGGAGAGGCAAGGCAAGG + Intergenic
979474410 4:121138205-121138227 GACAGAGGAAACCAAAGGCTCGG - Intronic
979955629 4:126950600-126950622 GGTAGAGGAGAAAAAAGGTCTGG - Intergenic
980451411 4:132977346-132977368 TGAAGAGGAGAGAAAAGGACAGG + Intergenic
980689948 4:136281985-136282007 GGGAGAGAAGAGAAAAGGCATGG + Intergenic
981074443 4:140577354-140577376 GGCAGGGGAAAGCAAAAGACTGG + Intergenic
981098544 4:140806323-140806345 GATAGAGGATAGCAATGGCCAGG + Intergenic
981865528 4:149413438-149413460 GGCAGGGGAGTGCAAATGCCAGG + Intergenic
982108563 4:152032544-152032566 AGGAGACGAGACCAAAGGCCAGG + Intergenic
982177552 4:152720220-152720242 GGCCGAGGTGGGCAGAGGCCAGG + Intronic
982216467 4:153086717-153086739 GGCAAAGAAGAGCAGAGACCGGG - Intergenic
983758714 4:171377500-171377522 GGAATAGGAGGGTAAAGGCCTGG - Intergenic
984563158 4:181294951-181294973 GGGAGAGGTGCCCAAAGGCCAGG - Intergenic
985248094 4:187996708-187996730 GGCAGAGGAGATGAAATGCAGGG - Intronic
985408970 4:189663678-189663700 GGCAGAGGAGTGGTCAGGCCGGG + Intergenic
985505901 5:280224-280246 GGCACAGCAGGGCAAAGGCCTGG + Intronic
985673578 5:1218902-1218924 GGCCGTGGAGGGCACAGGCCTGG + Exonic
985742296 5:1625702-1625724 GGCACAGCAGGGCAAAGGCCTGG - Intergenic
985867844 5:2529270-2529292 GGCAGAGCAGAGGAAAAGCTGGG - Intergenic
985877235 5:2609498-2609520 GTCAAAGAAGAGCAGAGGCCAGG + Intergenic
985926518 5:3023694-3023716 GGGAGAGGTGAGCAGAGGGCAGG + Intergenic
986062669 5:4206468-4206490 AGCAGAGGAAAGAAGAGGCCTGG + Intergenic
986329063 5:6704172-6704194 GGCACAGAAGCACAAAGGCCAGG - Intergenic
987087352 5:14483324-14483346 GGTAGAGAAGAGCAGAGGGCAGG + Intronic
987286785 5:16465470-16465492 GGAGGAGGAGAGCAAGGGCTCGG - Exonic
988739706 5:34058343-34058365 GGAAGAGCAGAGCAAAGGTGTGG + Intronic
988842698 5:35098246-35098268 GGCAGTGGAGAACAAAAGCAAGG - Intronic
988856579 5:35233355-35233377 GCCAGAGGATGGCAGAGGCCTGG - Intergenic
989105799 5:37861964-37861986 TGCCGTGGAGAGAAAAGGCCTGG + Intergenic
989131507 5:38111736-38111758 GACAGAGGAGACCAAAAGTCTGG - Intergenic
989425795 5:41294053-41294075 GGTAGAGGAGAGCAAAGAAATGG - Intergenic
989715046 5:44453214-44453236 GGGAGAGAAGAGAAAAGGCATGG + Intergenic
990006779 5:50953607-50953629 GGGAGAGGAGAGGAGAGGACAGG - Intergenic
990242959 5:53834160-53834182 GTTAGTGGAGACCAAAGGCCCGG + Intergenic
990303433 5:54472247-54472269 GGCAGAGAAGATCAGAGGTCAGG - Intergenic
990417464 5:55599832-55599854 GTCAGAGGAGACCATTGGCCAGG + Intergenic
990450527 5:55928443-55928465 CGCAGTGGAAAGCAAAGCCCAGG + Intergenic
990494093 5:56329473-56329495 GGAAGAGGGGAGAAAAGGCATGG - Intergenic
990986184 5:61642915-61642937 GCCAGAGGAGAGCTGCGGCCAGG + Intronic
991001051 5:61783605-61783627 GGCTGAGGAGAGGAAAGGTGGGG - Intergenic
991484502 5:67120355-67120377 TGCAGAGGGGAGCAAAGAGCTGG + Intronic
991629835 5:68645377-68645399 CAAACAGGAGAGCAAAGGCCTGG - Intergenic
991684077 5:69165979-69166001 GGCAGAGGAGAGCAAGGGTAAGG + Intergenic
991996113 5:72388817-72388839 GGCAGAGGAGAGCAAGGCAGAGG + Intergenic
992092203 5:73327147-73327169 GGTAGATGAGAACAGAGGCCTGG + Intergenic
992907367 5:81359285-81359307 GGCAGAGGAGGGGCAAGGGCGGG + Intronic
993219496 5:85072778-85072800 TGCAGAGGTGAGCAGAGGGCAGG - Intergenic
993453533 5:88101108-88101130 AGCAGAGGAGAGAAAAGGGTGGG - Intergenic
993824098 5:92659756-92659778 GGCAGAGGAAAGAAATGGCATGG + Intergenic
994497764 5:100535421-100535443 AGCAGAGGTGACCAAACGCCAGG - Exonic
995027693 5:107443375-107443397 GTCAGAGGACAGCAAGTGCCTGG - Intronic
996492268 5:124111747-124111769 AGCAGAGGAAAGCAAAGGAAAGG - Intergenic
996818897 5:127603557-127603579 GTCAGAGGAGAACAAAGGATGGG - Intergenic
997697515 5:135873163-135873185 GGCTGAGGGGACCAGAGGCCAGG + Intronic
997893227 5:137693711-137693733 AGCAGCTGAGAGCAAAGGCCTGG - Intronic
998502658 5:142646785-142646807 AGAAAAGGAGAGAAAAGGCCGGG - Intronic
998530856 5:142883210-142883232 GCCAGAGGTGAGAAAAGGCCAGG - Intronic
998957751 5:147454217-147454239 GGCAGAGGAGAGCGGGTGCCGGG - Intronic
999015613 5:148101009-148101031 GGCAGATTAAAGCAAAGGCTTGG + Intronic
999957014 5:156713429-156713451 GGGAGAGAGGAGGAAAGGCCTGG + Intronic
1000157134 5:158563037-158563059 TGGAGAGGAAAGCAAGGGCCAGG + Intergenic
1000450603 5:161382182-161382204 GGCAGAGGAAAGCAAATGTCAGG + Intronic
1001583979 5:172820404-172820426 GGCAGAGGAGCGCACAGGGGTGG + Intergenic
1001838235 5:174850680-174850702 GTCAGAGGAGAGCAAAGTTTTGG - Intergenic
1001927717 5:175650679-175650701 GGGAGAGGAGAGGAAAGGAGAGG - Intergenic
1002451403 5:179320936-179320958 CACAGAGGAGAGCAAAGCCAAGG + Intronic
1002481008 5:179500729-179500751 GGCAGAGGAGCGTACAGACCAGG - Intergenic
1002847626 6:961963-961985 GGCATAGGAGAGGGATGGCCTGG - Intergenic
1003672745 6:8174574-8174596 GACAGAGGACGGCAGAGGCCCGG + Intergenic
1003966730 6:11259047-11259069 GGCAGAGCAGCACAAAGGTCAGG - Intronic
1004953079 6:20696164-20696186 GGCATAGGAGAGCAAAGCATGGG + Intronic
1005834948 6:29702088-29702110 GGGAAAGGAGAGCTAAGGGCAGG - Intergenic
1006363083 6:33598240-33598262 GGCAGAGAGGAGCAAGGGGCAGG + Intergenic
1006669088 6:35718495-35718517 GGCAGAGGAAGGCAAAGAACAGG - Intronic
1006730389 6:36231661-36231683 GGCAGGGCAGAGCGCAGGCCAGG - Exonic
1006812522 6:36829175-36829197 GGGACAGGAGAGCCAAGGTCAGG + Intronic
1006943101 6:37765874-37765896 GGCAGAGGAAAGGGAAGACCGGG + Intergenic
1007260919 6:40562446-40562468 GGCAGTGAAGAGCAAAGGGAGGG + Intronic
1007287354 6:40757258-40757280 GGAAGAGATGAGAAAAGGCCAGG + Intergenic
1007376228 6:41458532-41458554 GGCAGAGGAGAGCAGTGACATGG - Intergenic
1007580277 6:42954622-42954644 GGCAGAGGAGAACAAAGGAAGGG - Intergenic
1008052275 6:46912501-46912523 GGGTGAGGTGAGCAGAGGCCAGG + Intronic
1008461502 6:51779282-51779304 GGCAGAGGGGGGCAGAGGCAAGG - Intronic
1008535722 6:52504817-52504839 TGCAGGGGAGAACAAGGGCCAGG + Intronic
1010042161 6:71397639-71397661 GTCAGAGGTAAGCAAAGGCCAGG - Intergenic
1011068846 6:83359796-83359818 TGCAGAGGAGAGCAAGTGCAAGG - Intronic
1011811072 6:91132960-91132982 GGAAGAGAAGGGCAAAGGCAGGG + Intergenic
1012513924 6:100036747-100036769 GGAAGAGGAAAGCAAAGTCCTGG - Intergenic
1012894284 6:104931126-104931148 GGGAGAGGGGAGGAAAGGCATGG - Intergenic
1013490239 6:110639846-110639868 GGCAGAGTAGAGGAAGGGCAAGG + Intronic
1015189544 6:130457805-130457827 GCAGGAGGAGAGCAAGGGCCTGG - Intergenic
1015555620 6:134458820-134458842 GGCAGTGGAAAGCAGAGGCCTGG + Intergenic
1015868888 6:137755666-137755688 GGCAGAGGAGGGTATAGGCTAGG + Intergenic
1016034695 6:139374013-139374035 GGCAGAGGCGAGCAAAAGTGGGG - Intronic
1017492448 6:154956294-154956316 GGCAGGAGAGAGCCAAGGCCTGG + Intronic
1017635158 6:156436325-156436347 GGCAGGGGAAAGGAAAGGCCAGG + Intergenic
1018118473 6:160612094-160612116 GGCAGAGGAGGGGAAAGACATGG + Intronic
1018120875 6:160634285-160634307 GGCAGAGGAGGGGAAAGACATGG + Intronic
1018633551 6:165841235-165841257 GGCAGAGGTGAGAACAGGGCAGG + Intronic
1018932101 6:168247692-168247714 CTCAGAGGAGAGCAAAATCCTGG + Intergenic
1019511412 7:1419468-1419490 GGTGGAGAAGAGCAGAGGCCGGG - Intergenic
1019526415 7:1482430-1482452 GGCAGAGGAGAAGACTGGCCGGG - Intronic
1019565915 7:1678984-1679006 GGCAGAGGAGAGGAGAGGCCTGG + Intergenic
1019632614 7:2057979-2058001 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632637 7:2058066-2058088 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632648 7:2058107-2058129 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632666 7:2058184-2058206 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632677 7:2058225-2058247 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632688 7:2058266-2058288 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632699 7:2058307-2058329 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632710 7:2058348-2058370 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632769 7:2058584-2058606 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632836 7:2058856-2058878 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632857 7:2058933-2058955 GCCAGAGGAGAGGAGAGGCGCGG + Intronic
1019632950 7:2059333-2059355 GCCAGAGGAGAGGAGAGGCATGG + Intronic
1019632976 7:2059446-2059468 GCCAGAGGAGAGAAGAGGCGTGG + Intronic
1019632987 7:2059487-2059509 GCCAGAGGAGAGGAAAGGTGCGG + Intronic
1019639173 7:2094042-2094064 GGCCAAGGAAAGCAGAGGCCAGG + Intronic
1019758535 7:2791319-2791341 AGCAGTGGACAGCAATGGCCAGG + Intronic
1020683949 7:11270530-11270552 GGGAGAGAAGAGGAAAGGCATGG - Intergenic
1020740936 7:12017404-12017426 GGCAGAGGACAGCTGAGGTCAGG + Intergenic
1021043371 7:15890888-15890910 GGCAGTGGAGTCCACAGGCCTGG + Intergenic
1021794988 7:24245538-24245560 GACTGTGGAGAGCAAAGGCTTGG + Intergenic
1022652205 7:32287674-32287696 TCCAGAGAAAAGCAAAGGCCAGG + Intronic
1023373527 7:39534396-39534418 GCCAGAGGAGAGCCAGAGCCGGG + Intergenic
1023448672 7:40258143-40258165 GGCAGAGGAGAGAAAAGGCCAGG - Intronic
1026082019 7:67230303-67230325 GGCAGAGGAAAGGAGAGGACTGG - Intronic
1026494818 7:70893115-70893137 GGCAGAGAAGAGCCCAGGCCAGG - Intergenic
1026695048 7:72583690-72583712 GGCAGAGGAAAGGAGAGGACTGG + Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1028681037 7:93532431-93532453 GGCAGAGTAGAGTAAAGTTCAGG + Intronic
1030203607 7:106930517-106930539 GGCTAAGAAGAGCAAAGGCCAGG - Intergenic
1031868535 7:127066806-127066828 AGCAGAGGCTAGCAAAGGCTGGG - Intronic
1032030264 7:128477115-128477137 GGCGGCGGAGAGAAAAGTCCAGG + Exonic
1032285547 7:130536306-130536328 GAAATAGGAGAGTAAAGGCCAGG + Intronic
1032513656 7:132491550-132491572 GCCAGAGGCTATCAAAGGCCTGG - Intronic
1032705202 7:134415261-134415283 GGCAGAGGAGAGCAGTGGCAGGG - Intergenic
1033234307 7:139626007-139626029 GGAAGAGGAGAGCACAGAGCTGG - Intronic
1033283858 7:140024522-140024544 GGCAGAGCAGGTGAAAGGCCTGG + Exonic
1033356060 7:140601465-140601487 GGGAGAGGAGGGCAGAGGCGGGG + Exonic
1034189978 7:149206578-149206600 AGCCACGGAGAGCAAAGGCCGGG + Intronic
1034256691 7:149728631-149728653 GACCGAGGAGAGCAGAGCCCAGG + Exonic
1034408281 7:150921176-150921198 ATCAGAGGAGAGCAACAGCCTGG + Intergenic
1034453812 7:151153287-151153309 GGCAGCAGAGAGCAAATGGCAGG - Intronic
1034567312 7:151925701-151925723 GGCAGAGCTGAGCAAACCCCAGG + Intergenic
1035063798 7:156091041-156091063 GACAGAAGGGAGGAAAGGCCGGG - Intergenic
1035649273 8:1252912-1252934 GGCAGAGGAGGACAGAGGACGGG + Intergenic
1035889951 8:3332415-3332437 GGAAGAGGAGAGGAGGGGCCTGG + Intronic
1036710306 8:11074282-11074304 GACAGAGGAGACCCAAGGCCGGG - Intronic
1037014868 8:13891449-13891471 AGGAGAGGAGAGAAAAGGCACGG - Intergenic
1037706693 8:21321448-21321470 GGCAGAAGAGGGGAAATGCCAGG + Intergenic
1037804737 8:22052969-22052991 GGCAGGAGAGAGCACAGGCCAGG + Intronic
1038149349 8:24928385-24928407 GCCAGAACAGAGCAAAGGACAGG + Intergenic
1038163502 8:25062827-25062849 GGTAGAAGAGAGTAAATGCCAGG - Intergenic
1039469272 8:37803409-37803431 GGGAGAGGAGGGAAATGGCCCGG + Intronic
1039829233 8:41199801-41199823 TGCAGAGCACAGGAAAGGCCAGG + Intergenic
1040061301 8:43105329-43105351 GGAAGGGTAGAGCAAAGGCGAGG - Intronic
1040284274 8:46092028-46092050 GGCAGAGGAGAGAAGAGGTGAGG + Intergenic
1040284626 8:46093527-46093549 GGCAGAGAAGAGAAGAGGCAAGG + Intergenic
1040285817 8:46099881-46099903 GGCAGAGGGGAGAAGTGGCCAGG + Intergenic
1040296795 8:46153022-46153044 GGCAGAGGAAAGAAGAGGCTAGG - Intergenic
1040318341 8:46276617-46276639 GGCAGAGGGGAGAAGAGGCAAGG - Intergenic
1040323298 8:46329120-46329142 GGCAGAGGGGAGAAGAAGCCAGG - Intergenic
1040337838 8:46425124-46425146 GGCAGAGGGGAGAAACGGCGAGG + Intergenic
1040515085 8:48127942-48127964 AGCTGAGGAGAGGAGAGGCCTGG + Intergenic
1041224520 8:55685296-55685318 TGGGGAGCAGAGCAAAGGCCTGG - Intergenic
1042009306 8:64222084-64222106 GGCTGTGGAGACCAAGGGCCAGG + Intergenic
1042512128 8:69623149-69623171 GGCAGAGGAGGGTTAAGGCAAGG - Intronic
1043478824 8:80631973-80631995 GGCAGATGAGGGCAAAGGGGAGG + Exonic
1044736681 8:95286048-95286070 GGCAGATGTGAGCAATGTCCTGG + Intergenic
1044953379 8:97455074-97455096 AGGAGAAGAGAGCAAGGGCCTGG + Intergenic
1045480416 8:102587083-102587105 GGCAGAGGAGAGCCCAGGCCTGG + Intergenic
1045758435 8:105573205-105573227 AGCAGATGAGAGCATAGGACAGG + Intronic
1046027369 8:108741232-108741254 TGCAGAGGAGAGAAAAGGGATGG + Intronic
1048448512 8:134511076-134511098 GGCAGAGGGAAGCACAGCCCAGG + Intronic
1048933444 8:139335803-139335825 ACCAGAGGAGACGAAAGGCCAGG + Intergenic
1049213985 8:141399353-141399375 GCCAGAGGGAAGCAAAGCCCGGG - Intronic
1049228222 8:141467838-141467860 GGCAGAGGACAGCAGAGGAGGGG - Intergenic
1049317908 8:141979383-141979405 AGCAGAGGCAAGGAAAGGCCGGG + Intergenic
1049554404 8:143274926-143274948 GGCAGAGGTGAGCTGATGCCAGG - Intronic
1049691911 8:143965218-143965240 GGCAGAGGAGACCCAGGACCAGG - Intronic
1049700817 8:144011488-144011510 GGGAGAGGATAGCGAAGTCCAGG - Intronic
1050038609 9:1463713-1463735 GGGAGGTGAGAGCATAGGCCCGG + Intergenic
1050085472 9:1960419-1960441 GGCAGAGGCGATCCCAGGCCTGG + Intergenic
1050277955 9:4019547-4019569 GGCAGTGGAGAGGAAAGGCAGGG + Intronic
1050985416 9:12076468-12076490 AGGAGAGGAGAGGAGAGGCCGGG - Intergenic
1052390360 9:27872101-27872123 GGCAGAGAAGGGCAAAGGGTGGG + Intergenic
1053287903 9:36861732-36861754 GGGAGAGGGGAGAGAAGGCCAGG + Intronic
1053691283 9:40588628-40588650 GGCAGAGTAGAGCCAGGGCAGGG - Intergenic
1054273519 9:63048857-63048879 GGCAGAGTAGAGCCAGGGCAGGG + Intergenic
1054302543 9:63389599-63389621 GGCAGAGTAGAGCCAGGGCAGGG - Intergenic
1054401315 9:64716099-64716121 GGCAGAGTAGAGCCAGGGCAGGG - Intergenic
1054434923 9:65200419-65200441 GGCAGAGTAGAGCCAGGGCAGGG - Intergenic
1054495466 9:65821262-65821284 GGCAGAGTAGAGCCAGGGCAGGG + Intergenic
1056648672 9:88437922-88437944 GGCTGAGGGGGGCAGAGGCCAGG + Intronic
1056775696 9:89510969-89510991 GACAGGGGAGGGCAGAGGCCTGG - Intergenic
1057130051 9:92648760-92648782 GGAGGAGGGGAACAAAGGCCAGG + Intronic
1057307485 9:93920654-93920676 GGCTCAGGAGAGCGGAGGCCCGG + Intergenic
1057570128 9:96198016-96198038 GACAGAGGAGCCCAAAGCCCTGG - Intergenic
1057923396 9:99119203-99119225 GGCAGAGGAGAGCAATACCTGGG - Intronic
1057992607 9:99786369-99786391 GCCAGAGGAGGGCAAAGAACAGG - Intergenic
1058998470 9:110323316-110323338 GCCAGAGGAGAGCATAGGGAGGG + Intronic
1059339821 9:113591414-113591436 GGAAGAGGAGCGCAGAAGCCAGG - Intronic
1059399502 9:114060056-114060078 GGCGGAGGGGAGAAAAAGCCAGG - Intergenic
1060208496 9:121696609-121696631 GGCAGAGCAGAGCAGAGGACTGG + Intronic
1060343876 9:122800320-122800342 AGCAGAGGTCAGCAAAGGACAGG - Exonic
1060422513 9:123479574-123479596 GACAGAGGGGAGCAGAGGGCTGG - Intronic
1060434865 9:123584712-123584734 GGCAGAGGCAACCACAGGCCTGG + Intronic
1060678736 9:125542100-125542122 GGCAGAGGAGAGCAATTGAATGG - Intronic
1061001872 9:127907268-127907290 GTGAGAGGAGAGCCAGGGCCAGG - Intergenic
1061374325 9:130215196-130215218 GGCAGAGGAGGGAACATGCCTGG - Intronic
1061374410 9:130215544-130215566 GGCAGAGGACAGGAGAGGCAGGG + Intronic
1061396402 9:130346173-130346195 GGCAGGTGAGAGCTAGGGCCAGG + Intronic
1061473245 9:130844108-130844130 GGCAGAAGAGAGCATGGGCTTGG - Intronic
1061656998 9:132099886-132099908 GGCAGAAGTCAGCAAAGGCTGGG + Intergenic
1061840631 9:133356738-133356760 GGCAGGGGAGAGGAGAGGGCAGG + Intronic
1061861491 9:133470766-133470788 GGCAGAAGGGAGCAGAGGGCAGG - Exonic
1062107434 9:134763669-134763691 TGCAGAGGAGAAAAAAGGCAAGG - Intronic
1062187991 9:135228829-135228851 TGCAGGTGAGAGCAAAGCCCAGG - Intergenic
1062422033 9:136487309-136487331 GGCAGAGGCTTGGAAAGGCCAGG - Intergenic
1062605955 9:137348959-137348981 GCGAGAGGGGAGCAAAGTCCTGG - Intronic
1203660048 Un_KI270753v1:33100-33122 GGCAGAGGAGTGGTCAGGCCGGG + Intergenic
1185469480 X:373957-373979 GGGAGAGGAGAGAAGAGGACCGG - Intronic
1186670625 X:11764219-11764241 GGGTGAAGAGAGCACAGGCCGGG + Intronic
1187224442 X:17362140-17362162 GGAAGCGGAGAGCCAGGGCCAGG - Intergenic
1187633167 X:21197333-21197355 GACAGAGGGGAGGAAGGGCCAGG + Intergenic
1188105233 X:26141105-26141127 GGGACTGGAGAGCAGAGGCCAGG + Intergenic
1188889191 X:35588893-35588915 GGAAAAGGAGAGGAAAGGACGGG - Intergenic
1188996830 X:36897015-36897037 GGCAGAGGAGTTCTAAGGGCTGG - Intergenic
1190424836 X:50325213-50325235 GGCAGAGGTGAAGAAATGCCAGG - Intronic
1190746839 X:53328882-53328904 GGCAGTGGAGAGCAATGGAACGG - Intergenic
1192567142 X:72174363-72174385 GGCAGAGGAGAGCACATTCCAGG + Intergenic
1193963369 X:87952338-87952360 TGCAGAGAAGAGCAATGTCCTGG + Intergenic
1197885160 X:131210671-131210693 GGAAGAGGAGAGCAGAGTCAAGG - Intergenic
1197897406 X:131330096-131330118 GGCAGATGACAGGAAAGGCAGGG + Intronic
1199284602 X:146042108-146042130 AGCAGAGGAGAGGAAAGGGAAGG + Intergenic
1201124413 Y:10900439-10900461 TGCAGTGGAGAGCAAAGGAGTGG - Intergenic
1201489167 Y:14523513-14523535 GGAAAAGGAGGGAAAAGGCCAGG + Intronic
1202337298 Y:23825621-23825643 GGCAGAGCAGAGCCAAGTCTTGG - Intergenic
1202533468 Y:25844450-25844472 GGCAGAGCAGAGCCAAGTCTTGG + Intergenic