ID: 1165102374

View in Genome Browser
Species Human (GRCh38)
Location 19:33446616-33446638
Sequence CTGGATGCACTGTGCAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165102374_1165102380 8 Left 1165102374 19:33446616-33446638 CCCTGTTTGCACAGTGCATCCAG 0: 1
1: 0
2: 0
3: 22
4: 144
Right 1165102380 19:33446647-33446669 TCGGTCCCCAGCCTTGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 113
1165102374_1165102381 9 Left 1165102374 19:33446616-33446638 CCCTGTTTGCACAGTGCATCCAG 0: 1
1: 0
2: 0
3: 22
4: 144
Right 1165102381 19:33446648-33446670 CGGTCCCCAGCCTTGAAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165102374 Original CRISPR CTGGATGCACTGTGCAAACA GGG (reversed) Intronic
900473421 1:2865345-2865367 CTGGTTGCACTTTCCAAGCAAGG + Intergenic
901808755 1:11753827-11753849 CGGGCTGCACTGTGCTAACGAGG + Intronic
902532827 1:17101455-17101477 CTGGATGCTGTGTGCATGCAAGG + Intronic
907170142 1:52455556-52455578 CGGGCTGGACTGTGCAATCATGG - Intronic
907891428 1:58640128-58640150 ATGTATGCTCCGTGCAAACAGGG + Intergenic
909342775 1:74550271-74550293 CTGTGTGACCTGTGCAAACATGG + Intergenic
910499464 1:87872911-87872933 CTGGCTGCTCTATGCAAAAAAGG - Intergenic
1062883571 10:998683-998705 CTGTCTGCACTGTCCAAACCGGG - Intronic
1063257351 10:4342849-4342871 CTGTATCCACTGTGAAAAAACGG + Intergenic
1065179601 10:23111457-23111479 CTGTATTCACAGTGCAAAGAGGG - Intronic
1067700638 10:48568875-48568897 CTGGAAACACTGTGCAACCCTGG - Intronic
1068851850 10:61751266-61751288 CTGCAAGCACTGGGCAAGCAGGG + Intronic
1070018562 10:72560262-72560284 CTGGATGCCCTGTTCCAACATGG - Intronic
1070312322 10:75282786-75282808 CTGCATCCATTGTGCAGACAAGG - Intergenic
1072219426 10:93315253-93315275 CTGGAAGCAGCGTGGAAACAGGG + Intronic
1072250692 10:93580109-93580131 GTGGATGGAGTGTGCAAGCAGGG + Intronic
1074010673 10:109475985-109476007 CTGGAAGCACTGGCCAAATAAGG + Intergenic
1075526234 10:123189486-123189508 CGGGATGCCCTGTCCACACAGGG + Intergenic
1075526258 10:123189608-123189630 CGGGATGCCCTGTCCATACAGGG + Intergenic
1077810956 11:5636425-5636447 CTGGATTTACTGTGCAATGACGG + Intronic
1079793774 11:24772716-24772738 CTGGATCCACAGTGTCAACAGGG + Intronic
1082984114 11:59152332-59152354 AAGGATGCACTGTGCAAGGATGG + Exonic
1084868954 11:72082788-72082810 CTGGTTGCAGTGCGCAAATATGG - Intronic
1084917744 11:72442232-72442254 CTAAATGCACTGTGTAATCATGG + Intergenic
1086662847 11:89443069-89443091 CTGGATGCACTCTACAAGCCTGG + Intronic
1087531292 11:99385787-99385809 CAGGATGCACTGTGGAAAGATGG - Intronic
1087566684 11:99868602-99868624 CTGGATGCACTCTTCAAAGTTGG - Intronic
1089073919 11:115721770-115721792 CTGGGGGCACTGTGCCAGCATGG + Intergenic
1091409972 12:232944-232966 CTGGGAGCTCTGTGCACACAGGG - Intronic
1093713414 12:22353859-22353881 CTGGCTGCAATGTGCTAAAAGGG - Intronic
1095457122 12:42400080-42400102 ATGGATGCTCTGTGAAAACAAGG + Intronic
1095504952 12:42886322-42886344 CTCAATGCCCTGTGCAAATAAGG + Intergenic
1096999816 12:55867187-55867209 CAAGGTGCACTGTGGAAACATGG - Intergenic
1102235549 12:111292283-111292305 ATGGATGAACTTTGAAAACATGG + Intronic
1103792083 12:123479047-123479069 CATGATGCACTGTGCAGACAAGG + Intronic
1104676061 12:130713358-130713380 CTGGTTGCCCTTTGCACACAAGG + Intronic
1106247261 13:27960913-27960935 CTTGCTCCACTGTCCAAACAGGG + Intergenic
1106855067 13:33842409-33842431 CTGGATCCACTGGACAAAGAGGG - Intronic
1107057713 13:36124958-36124980 CTTTATGCCCTGTTCAAACAGGG + Intronic
1117611171 14:57484849-57484871 CTGGCTGCAGTGTGGAAACTAGG + Intronic
1117741011 14:58819561-58819583 CCGGATGGACTGTGCACACTTGG - Intergenic
1120280000 14:82427379-82427401 CTAGCTGCTCTGTGCAAGCAAGG - Intergenic
1121572101 14:94954131-94954153 CTGTAAGCACTCTGCTAACAAGG - Intergenic
1126782359 15:52149709-52149731 CTGGCTGAGCTGTTCAAACACGG + Intronic
1130232833 15:82109689-82109711 CTGGCTGCTCCGTGTAAACATGG - Intergenic
1131190089 15:90307863-90307885 CTGGATGCACTGTGAGAAGCTGG - Intronic
1132112528 15:99112668-99112690 CTAGCTGCACTGTGCAATTACGG + Intronic
1132313193 15:100871989-100872011 CTGGCAGCACTGTGTAGACAAGG - Intergenic
1132726553 16:1341411-1341433 CTGGATGCACTTGGCAGGCAGGG - Exonic
1134124175 16:11605147-11605169 CTCTCTCCACTGTGCAAACAGGG + Intronic
1135146747 16:19969362-19969384 CTGGCTGCAGTGTGTTAACAGGG - Intergenic
1141024124 16:80528046-80528068 CTGTAGGCACCGTGCAAGCAAGG + Intergenic
1143086019 17:4416650-4416672 CTGGATGCTCTCTGTACACAGGG - Intergenic
1144783466 17:17819329-17819351 CTGGCACCACTGTGCAGACAGGG - Exonic
1146223331 17:31045422-31045444 CTTGATGAATTGTGCAAACTGGG - Intergenic
1146341661 17:32024548-32024570 CTTGATGAAGTGTGCAAACTGGG + Intronic
1146351140 17:32095074-32095096 CTTGATGAAGTGTGCAAACTGGG - Intergenic
1148173655 17:45545817-45545839 CTTGATGAATTGTGCAAACTGGG - Intergenic
1148275614 17:46299631-46299653 CTTGATGAATTGTGCAAACTGGG + Intronic
1148297724 17:46517199-46517221 CTTGATGAATTGTGCAAACTGGG + Intronic
1148362272 17:47021687-47021709 CTTGATGAATTGTGCAAACTGGG + Intronic
1148825703 17:50392397-50392419 GTGTAAGCAGTGTGCAAACAAGG - Exonic
1148830898 17:50430288-50430310 CCGGTTGCAGTCTGCAAACATGG - Intronic
1150404863 17:64892741-64892763 CTTGATGAATTGTGCAAACTGGG - Intronic
1150525840 17:65921247-65921269 CTGGCTGCCCTGTTCAAAGAAGG + Intronic
1150783954 17:68147664-68147686 CTTGATGAACTGTGCAAACTGGG - Intergenic
1151047498 17:70938522-70938544 CTGGCTCTCCTGTGCAAACACGG - Intergenic
1203166504 17_GL000205v2_random:101973-101995 CAGGATGCACTGAGCACACACGG + Intergenic
1153137137 18:1929798-1929820 CTGTATGCACTGTGCTATTAGGG - Intergenic
1153555513 18:6309236-6309258 CTGCATTCACTGTGGAAAGAAGG - Intronic
1153975732 18:10267333-10267355 CAGGAAGCACGGTGCAAAGAAGG - Intergenic
1160535802 18:79590693-79590715 CTGGACTCACTGTGCAGACAGGG + Intergenic
1164262556 19:23580770-23580792 AGGGATGTACTGTGCAGACAAGG + Intronic
1165102374 19:33446616-33446638 CTGGATGCACTGTGCAAACAGGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926154095 2:10441591-10441613 TTGGATGCTCTTTGAAAACATGG - Exonic
931776868 2:65548337-65548359 TTGGAAACACTGTGCAGACAAGG - Intergenic
932557263 2:72835575-72835597 CTGGTTGCCTTGTGCCAACATGG + Intergenic
933026720 2:77268960-77268982 CTGGAAGGCCTGTGCAAAAAAGG - Intronic
933676813 2:85064441-85064463 TTGGATGAACTTTGCAAACATGG + Intergenic
934146610 2:89100957-89100979 CTGCATGCATTGAGGAAACACGG - Intergenic
934157112 2:89213537-89213559 CTGCATCCACTTTGCAATCAGGG - Intergenic
934220937 2:90082171-90082193 CTGCATGCATTGAGGAAACATGG + Intergenic
934222655 2:90099617-90099639 CTGCATGCATTGAGGAAACACGG + Intergenic
934233574 2:90209410-90209432 CTGCATGCATTGAGGAAACACGG + Intergenic
934558532 2:95300265-95300287 CTGGATCCACAGTCCAAAAATGG - Intronic
934945417 2:98537709-98537731 CAGCATTCACTGTGCACACAGGG - Intronic
941113161 2:161440107-161440129 CTGGATGAACTGAGCAAGAAAGG - Intronic
942318080 2:174712776-174712798 ATGGCTGGACTGTGCAAAAAAGG - Intergenic
947634182 2:231671867-231671889 CTGGGTGCAAAATGCAAACATGG + Intergenic
948641981 2:239380948-239380970 CCGGATGCAAGGAGCAAACACGG + Intronic
1171435223 20:25116966-25116988 CTGGCTGCCCTGTGCTCACAGGG + Intergenic
1176335031 21:5588572-5588594 CAGGATGCACTGAGCACACACGG - Intergenic
1176392726 21:6232376-6232398 CAGGATGCACTGAGCACACACGG + Intergenic
1176405251 21:6357123-6357145 CAGGATGCACTGAGCACACACGG - Intergenic
1176431906 21:6631980-6632002 CAGGATGCACTGAGCACACACGG + Intergenic
1176468693 21:7083798-7083820 CAGGATGCACTGAGCACACACGG - Intronic
1176492254 21:7465576-7465598 CAGGATGCACTGAGCACACACGG - Intergenic
1176508388 21:7672807-7672829 CAGGATGCACTGAGCACACACGG + Intergenic
1176662791 21:9655399-9655421 TTGGATGGATTGTGCAAATATGG + Intergenic
1177633308 21:23753981-23754003 TTGGATGCTCTGGGCAAAGAAGG + Intergenic
1178440969 21:32597984-32598006 CTGGATGGACTGTGAGATCATGG - Intronic
1180623698 22:17179752-17179774 CTGTATGCCCTGTGGAGACATGG + Exonic
1182260329 22:29069461-29069483 CTGTTTGCACTGTGCAAGTAAGG - Intergenic
1184448890 22:44571166-44571188 CCCGGTGCCCTGTGCAAACATGG - Intergenic
1185299952 22:50074389-50074411 CAGAATGCACTGTGCAGACATGG + Intronic
950564997 3:13764030-13764052 CAGGATGCTCTCTGCAAACTGGG + Intergenic
954559209 3:51542204-51542226 CTCGATGCAATCTGCAAAGAAGG - Intronic
956684472 3:71811964-71811986 AAGGATGGAGTGTGCAAACATGG + Intergenic
962721689 3:138181552-138181574 CTGAAAGCTCTGTGAAAACAGGG + Intergenic
962960421 3:140306224-140306246 CTGGGAGCTCTGTGCACACAGGG + Intronic
964716054 3:159723026-159723048 CTGGAAGCACTGAGCACACATGG - Intronic
969466391 4:7359554-7359576 CTGGATGCGGGGTGCAGACAAGG - Intronic
973290612 4:48466618-48466640 CTGGAAGCCATGTGCACACATGG - Intergenic
973627077 4:52783617-52783639 CTGGATGCAGTGCACCAACATGG - Intergenic
973931820 4:55800975-55800997 TTGGAAGCGCTGTGCAAATAAGG - Intergenic
985128165 4:186715392-186715414 CTGAATGTACTCTGCAAACTTGG + Intronic
985619133 5:944481-944503 CTGGAAGCACAGGGCACACAAGG - Intergenic
985933126 5:3074601-3074623 CTGGATGCAGAGTGCAGACATGG - Intergenic
986025345 5:3845395-3845417 CCTGATGCAACGTGCAAACAAGG - Intergenic
990091819 5:52060820-52060842 CTGTATAAAATGTGCAAACATGG - Intronic
990549019 5:56853937-56853959 CTGGCTGCACTGTGAAATCTGGG + Intronic
991557065 5:67907654-67907676 CTGGTTGTACTGTGGAACCATGG - Intergenic
995067747 5:107881073-107881095 CTTGCTGCTCTGTGCAATCAGGG + Exonic
996030472 5:118699111-118699133 ATGCATTCACTGAGCAAACAAGG + Intergenic
1000373517 5:160559157-160559179 CAGGCTGCCCTCTGCAAACAAGG + Intergenic
1001407733 5:171487700-171487722 CTGGAGGCTCTGTCCACACAGGG - Intergenic
1005849544 6:29811406-29811428 CTGGTTGCCCTGTGAACACAGGG + Intergenic
1006644913 6:35509352-35509374 TTGGAAGCACTTTGCAAACCAGG - Intronic
1007944565 6:45813937-45813959 CTGGATGCAGGAAGCAAACAGGG + Intergenic
1008061441 6:47001355-47001377 CTGGATGAACTCTGAAAACATGG + Intronic
1012597379 6:101055620-101055642 CTGGATGCTCTGTGCAGCCTTGG - Intergenic
1015068036 6:129054536-129054558 TAGGATGGACTGTGCAGACAGGG + Intronic
1020990298 7:15187310-15187332 CCATATGCAATGTGCAAACAGGG - Intergenic
1024241002 7:47435779-47435801 CTGGCTGCACTCTCCAAACTGGG - Intronic
1027697534 7:81430765-81430787 ATGGATGCAATGTTAAAACAAGG - Intergenic
1031564293 7:123276156-123276178 CTGGAGACAGTGTCCAAACACGG - Intergenic
1033290096 7:140076238-140076260 CTAGATGCAATCTGCAAGCAGGG - Intergenic
1033813410 7:145044558-145044580 CTGGTTTCTCAGTGCAAACAAGG + Intergenic
1037127890 8:15372328-15372350 CTGGACTCACTTTCCAAACAAGG - Intergenic
1038938312 8:32276777-32276799 CTGGCTGCTCTGTGAAAATAGGG + Intronic
1041294400 8:56339590-56339612 CTGGTGGCAGTGTGCACACAGGG + Intergenic
1045400642 8:101813392-101813414 CATGATGAACTGGGCAAACATGG + Intronic
1045545626 8:103125694-103125716 CTGGAAGCAGTGAGCAAGCAGGG - Intergenic
1046191031 8:110794065-110794087 CTGGACGCACTCTGGAATCAAGG - Intergenic
1046983824 8:120365415-120365437 CTGGAGTCACTTTGCCAACAGGG - Intronic
1048140300 8:131787724-131787746 CTGGAGCCACTGTGCACAAAAGG + Intergenic
1049437193 8:142592199-142592221 CTGGATTCTCTGGGAAAACAGGG - Intergenic
1049758394 8:144320893-144320915 CTGCATGCTCTGTGGACACAAGG - Intronic
1049996482 9:1039953-1039975 CTGCATGAATTGTGCAAACTAGG + Intergenic
1050910827 9:11067789-11067811 CTCTATGCACTGTGTAGACATGG - Intergenic
1052972297 9:34384352-34384374 GTGCATCCACTGTGGAAACATGG - Intronic
1054758556 9:68983608-68983630 CTAGGTGCAGTGTGCATACATGG + Intronic
1059109291 9:111539710-111539732 CTGGATGCAATGTGCGATCTTGG - Intronic
1059588988 9:115637135-115637157 CTGGCTTCACTGTGGACACATGG + Intergenic
1060156773 9:121325753-121325775 CAGGATGCACTGAGCTAAGATGG - Intronic
1061869292 9:133511612-133511634 CTACATGCACTGTGAAAAGACGG - Intergenic
1062339050 9:136085850-136085872 CTGAACTCACTGTGGAAACAAGG + Intronic
1203426609 Un_GL000195v1:46344-46366 CAGGATGCACTGAGCACACACGG + Intergenic
1203439633 Un_GL000195v1:176728-176750 CAGGATGCACTGAGCACACACGG - Intergenic
1187069559 X:15874668-15874690 CTGGAGGCTCTTTACAAACAGGG + Intergenic
1187263204 X:17706245-17706267 CTGAATGCAATGTGCAATCCTGG + Intronic
1191995605 X:67092028-67092050 CTGGATACACTGTGCCACCTGGG + Intergenic
1198318163 X:135490450-135490472 CTGGAGGCACTTTGCACACTGGG + Intergenic
1199447552 X:147943683-147943705 CTGGATGGACTGTGTAAATCAGG + Intronic
1199523091 X:148759608-148759630 CTGAATGCACAGTGCAAGCATGG + Intronic
1199665945 X:150096543-150096565 CTGTATGCACTTTCCAAATACGG + Intergenic