ID: 1165104718

View in Genome Browser
Species Human (GRCh38)
Location 19:33462125-33462147
Sequence AGCCCCGGCCCTGGGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 7, 3: 41, 4: 489}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165104718_1165104727 8 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104727 19:33462156-33462178 AGCAGGCCCTGAGGACATCTGGG 0: 1
1: 0
2: 3
3: 33
4: 288
1165104718_1165104734 29 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104734 19:33462177-33462199 GGGTGGACTTGGGCCCTGCAAGG 0: 1
1: 0
2: 3
3: 30
4: 267
1165104718_1165104733 19 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104733 19:33462167-33462189 AGGACATCTGGGGTGGACTTGGG 0: 1
1: 0
2: 0
3: 14
4: 189
1165104718_1165104723 -9 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104723 19:33462139-33462161 GCCGGGGCTCTGAACAGAGCAGG 0: 1
1: 0
2: 1
3: 15
4: 190
1165104718_1165104735 30 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104735 19:33462178-33462200 GGTGGACTTGGGCCCTGCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 136
1165104718_1165104732 18 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104732 19:33462166-33462188 GAGGACATCTGGGGTGGACTTGG 0: 1
1: 0
2: 1
3: 19
4: 214
1165104718_1165104728 9 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104728 19:33462157-33462179 GCAGGCCCTGAGGACATCTGGGG 0: 1
1: 0
2: 5
3: 38
4: 335
1165104718_1165104725 -1 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104725 19:33462147-33462169 TCTGAACAGAGCAGGCCCTGAGG 0: 1
1: 0
2: 1
3: 29
4: 278
1165104718_1165104729 12 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104729 19:33462160-33462182 GGCCCTGAGGACATCTGGGGTGG 0: 1
1: 0
2: 5
3: 26
4: 337
1165104718_1165104726 7 Left 1165104718 19:33462125-33462147 CCAGCACCCCCAGGGCCGGGGCT 0: 1
1: 0
2: 7
3: 41
4: 489
Right 1165104726 19:33462155-33462177 GAGCAGGCCCTGAGGACATCTGG 0: 1
1: 0
2: 3
3: 28
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165104718 Original CRISPR AGCCCCGGCCCTGGGGGTGC TGG (reversed) Intronic
900428893 1:2592764-2592786 AGCCCTGGCCCTGAGGGAGAGGG - Intronic
900624829 1:3603351-3603373 AGCCCCTGCTCTGGGGGTGCTGG - Intronic
900641617 1:3690394-3690416 AGCCCCGGCCCTGGAGATCATGG - Intronic
900948140 1:5842869-5842891 AGCGCAGGCTTTGGGGGTGCGGG + Intergenic
901195118 1:7436134-7436156 AGCCCCGGGCCTGGGGGACGAGG - Intronic
901208099 1:7508791-7508813 AGCCCTGGCCCTGGAGGAGAGGG + Intronic
901443311 1:9292644-9292666 AGCCGCCGCCCTGGTGTTGCCGG - Intergenic
901672847 1:10866349-10866371 AGCCCCGGCCCTGGAGCTGAGGG + Intergenic
901776697 1:11565180-11565202 TGCCCTTGCCCTGTGGGTGCAGG - Intergenic
902731673 1:18373938-18373960 AGGCCCGGGCCTGGGCCTGCTGG - Intronic
902873722 1:19328807-19328829 AGCCCCGGCCTTGAGGCTTCGGG - Exonic
903161819 1:21494474-21494496 AGCCCCTGCACTGGGGATACTGG + Intergenic
903568514 1:24286700-24286722 TGCCACAGCCCTTGGGGTGCAGG + Intergenic
903652268 1:24929539-24929561 GGCGCCGGCCCTGGGGCTCCGGG - Intronic
903744469 1:25577357-25577379 AGCCCAGGTCCTGGTGGTCCTGG - Intergenic
903807819 1:26017869-26017891 CACCCCAGCCCTGGGGATGCTGG - Intergenic
904207716 1:28865558-28865580 ATCCCCGGGTCTGGGGCTGCTGG - Intergenic
904236627 1:29121336-29121358 AGCCCGGGCCGTCGGGGGGCCGG + Exonic
904264680 1:29311443-29311465 GGCTTCGGCCCTGGGGATGCAGG - Exonic
904328337 1:29741962-29741984 AGCCCCAGCCCTGGAGGACCTGG + Intergenic
904472963 1:30747241-30747263 AGCCACAGGCCTGGTGGTGCAGG + Intronic
904738186 1:32651187-32651209 AGCCCTCGCGCTGGGGGCGCAGG + Exonic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
906223639 1:44103385-44103407 AACCACGGCCCTGGTGGAGCTGG + Intergenic
906315689 1:44785167-44785189 AGCCCCAGCCCTGGGAGACCCGG - Exonic
906325249 1:44841738-44841760 AGGCCTGGCCCTGGGGCTGGAGG - Intronic
907953498 1:59206508-59206530 ACCCACGGCCCTGGTGGTGTAGG - Intergenic
912451156 1:109768553-109768575 ACACCTGGCCCTGGGGCTGCTGG + Intronic
912681160 1:111729821-111729843 AACCCTGGCCCTGGGGGGGATGG + Intronic
912682666 1:111739101-111739123 CGCCCCGGCCCCCGGGGAGCCGG - Intronic
913321908 1:117594626-117594648 AGCCTGGCCTCTGGGGGTGCAGG - Intergenic
913550763 1:119915376-119915398 AGCCCTACCCCTGGGGGTGCTGG - Exonic
915111467 1:153566748-153566770 TGCCCTGGCCCTGGGGGAGGAGG - Intronic
916059627 1:161089635-161089657 AGCCCAGGCCATGGGGGCGGTGG - Intergenic
917157904 1:172024830-172024852 ACCCCAGGCCCTGGTGGTGTAGG - Intronic
919813741 1:201424971-201424993 AGGCCAGGCCCTGGTGGGGCTGG - Intronic
920188925 1:204179913-204179935 GGCCCCTGCCCAGGGGGTGGTGG + Intergenic
920902687 1:210127261-210127283 AGCCACTGCCCTGGGAGTGAGGG - Intronic
921747054 1:218751380-218751402 AGCCCCAGCCCTGGGGCTACTGG - Intergenic
923116788 1:230947845-230947867 AGCCCCGGCCACGGGTGTGCGGG - Intronic
924784651 1:247183944-247183966 AGCCGGGGCCCTCGGGGTGAAGG - Intergenic
1063714477 10:8513748-8513770 AACCACGGCCCTCGGGGAGCTGG + Intergenic
1065124354 10:22559911-22559933 AGTCCCAGCCCTGGGGGCACAGG - Intronic
1066337058 10:34488673-34488695 AGCCCCGGCCACAGCGGTGCTGG - Intronic
1067071926 10:43138613-43138635 GGCTCCGGCCCGGGCGGTGCGGG + Intronic
1067809889 10:49418202-49418224 GGCTCCCGCCCTGGGGGTGGGGG + Intergenic
1069551664 10:69368469-69368491 TGCCCAGGGCCTTGGGGTGCTGG + Intronic
1069604354 10:69730383-69730405 AGCCCTGGCCCTGGTCCTGCTGG - Intergenic
1070918072 10:80167586-80167608 AGCCCCAGCCCTGGAGGACCTGG - Intronic
1072188619 10:93063437-93063459 AGCCCCGGACCCAGGGGTGTGGG + Intronic
1072241174 10:93496736-93496758 CGGCCCGGCCCCGGGGCTGCGGG - Exonic
1072845465 10:98825599-98825621 AGCCCCGGGGTTGGGGGGGCGGG + Intronic
1075502883 10:122993965-122993987 AGCCCCAGCCCTGCCGGTCCAGG - Exonic
1075573792 10:123563732-123563754 AGCGCTGGCCCTGGGGCTTCTGG - Intergenic
1075999855 10:126905754-126905776 AGCTCCAGCCCCGGGGATGCGGG + Intronic
1076875546 10:133213900-133213922 CTGCCCGGCCCTGGGGCTGCTGG - Intronic
1076879613 10:133233620-133233642 AGCCCCCACCCTTAGGGTGCTGG - Intergenic
1076880612 10:133237597-133237619 AGCCTCGGCCCGCGGGGTGGGGG + Exonic
1077124463 11:926204-926226 GGCCCGGGGCCTGAGGGTGCGGG + Intronic
1077124527 11:926365-926387 GGCCCTGGGTCTGGGGGTGCGGG + Intronic
1077305919 11:1868657-1868679 AGCCCCCGCCCTGGCAGGGCTGG + Intronic
1077505206 11:2926938-2926960 AGCCCAGGACCAGGGGGTGGGGG - Intergenic
1077615341 11:3670004-3670026 GGCCCCAGCCCTGGGAGTGGAGG - Intronic
1077730269 11:4722801-4722823 AACCACGGCCCTGGTGGAGCTGG + Intronic
1078568978 11:12441154-12441176 GGCCCCAGCCTTGGGGGTGGAGG + Intronic
1079034546 11:17011026-17011048 AGCCAAGGCCCTGGGGGCACAGG + Intronic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1081483796 11:43512176-43512198 AGCCCTGGCCTTGGAGGTACTGG - Intergenic
1081679265 11:44990274-44990296 AGCCCTGGCTCTGGGGGTTGAGG + Intergenic
1081998490 11:47378984-47379006 AGCCTAGGCAGTGGGGGTGCAGG - Intergenic
1082986948 11:59177249-59177271 TGCCCAGGCCCTGGAGATGCTGG + Intronic
1083148294 11:60774492-60774514 AGCAGTGGCCCTGTGGGTGCTGG - Intronic
1083334573 11:61915186-61915208 AGCTAGGCCCCTGGGGGTGCAGG + Intronic
1083740526 11:64708629-64708651 AGCCCAGACCCTGGGAGAGCAGG + Intronic
1083755426 11:64789424-64789446 AGCCCAGGCCCTGGCCCTGCTGG - Exonic
1083877032 11:65529634-65529656 AGCCGCGGCTATGGGGGTGGTGG + Intronic
1083891579 11:65598305-65598327 TGCCCAGGCCCCGTGGGTGCCGG - Exonic
1084000343 11:66292395-66292417 CCCCGCGGCCCTGGGGGTGGGGG - Intronic
1084003646 11:66312320-66312342 AGCCACGCCCCTGGGGGCCCTGG - Intergenic
1084146290 11:67266902-67266924 AGAGCCGGCCCCGGGGGTCCAGG - Intronic
1084172394 11:67406775-67406797 AGCCTGGGCTCTGGGGGTGGCGG + Intronic
1084526990 11:69703902-69703924 AGCTCCGGCGATGGGGGTGCGGG + Exonic
1084616138 11:70237217-70237239 AACCAGGGGCCTGGGGGTGCAGG - Intergenic
1085053708 11:73392441-73392463 GGGCCCGGCCCTGGAGGTGGAGG + Exonic
1085153188 11:74268442-74268464 ACCCCAGGTCCTGGGGCTGCAGG + Intronic
1085386526 11:76161215-76161237 TGCCCCTGCCCTGGGTCTGCCGG + Intergenic
1086064878 11:82733717-82733739 AGCCGCGGCGATGGCGGTGCAGG - Exonic
1086300377 11:85421077-85421099 AGCCAGGGCCCTGGTGGTGTAGG + Intronic
1086845842 11:91748641-91748663 AGCCCCGACCTTTGCGGTGCAGG - Intergenic
1087832071 11:102830115-102830137 AACCCCGGCCCTTGGGCTGTGGG + Intergenic
1088645555 11:111913649-111913671 GGTCCAGGCGCTGGGGGTGCCGG - Exonic
1089011379 11:115134892-115134914 AAACTCAGCCCTGGGGGTGCAGG + Intergenic
1090146777 11:124332976-124332998 ATGGCGGGCCCTGGGGGTGCTGG - Intergenic
1090187005 11:124745650-124745672 GGCCCGGGCCCTGGGGGGCCTGG + Exonic
1090635119 11:128686319-128686341 TGCCCAGGCCCTGGGGGAGGCGG + Intergenic
1091016457 11:132055331-132055353 AGCCTCAGCCCTGGGCATGCCGG - Intronic
1091252875 11:134158397-134158419 AGCACTTGCCCTGGGTGTGCAGG + Exonic
1091347967 11:134867985-134868007 AGCAGCGGCCCTGAGGCTGCAGG + Intergenic
1091402534 12:189540-189562 ACCCCCCGCCCAGGGGCTGCAGG - Intergenic
1091750895 12:3020678-3020700 CGGCCCTGCCATGGGGGTGCCGG - Exonic
1092087423 12:5774694-5774716 AGCCCTGTCCCTGGGAGGGCTGG - Intronic
1092108975 12:5945524-5945546 TGCCCCGGCTCTGGGGGAGCAGG - Intronic
1094515159 12:31121470-31121492 AGCCCCAGCCCTGGGGCTACCGG + Intergenic
1095674196 12:44897648-44897670 AGCCAGGGCCCTGGTGGTGTAGG - Intronic
1095964342 12:47857052-47857074 CGCACCTGCCCTGGGGCTGCTGG - Intronic
1096626183 12:52897494-52897516 AACCACGGCCCTGGAGGAGCTGG + Exonic
1096749842 12:53751725-53751747 AGCCGCGGCCCCGGGCGGGCGGG - Intergenic
1097170651 12:57110868-57110890 TTCCATGGCCCTGGGGGTGCAGG + Intronic
1097249059 12:57622427-57622449 AGCCCAGCACCTGGGGGAGCGGG - Intronic
1099285467 12:80709972-80709994 AGATCCGGCCCTGAGGATGCCGG - Intergenic
1100819764 12:98420255-98420277 AGACCAGGACCTGGGGGTGGGGG + Intergenic
1103716587 12:122948863-122948885 AACCCGGGCCTTGGGGGTGGCGG + Intronic
1103764565 12:123271356-123271378 AGCCGAGGCCCTCGGCGTGCGGG + Intronic
1103899163 12:124294650-124294672 AGAGCTGGCCCTGGGTGTGCGGG + Intronic
1103958573 12:124593368-124593390 GGCCCAGGCCCCGGGGGTGCAGG - Intergenic
1103958815 12:124594659-124594681 AGCCCGGGCCCAGCGGGTCCCGG - Intergenic
1104785309 12:131444819-131444841 AGCCATGGCCCTGGGGATGGGGG - Intergenic
1104841610 12:131828525-131828547 AGTCCGGGCCCTGGGGGCGGCGG - Exonic
1105250829 13:18697663-18697685 GGGAACGGCCCTGGGGGTGCAGG - Intergenic
1105608571 13:21947680-21947702 AGCACCACCCCTGGGGGTGGAGG - Intergenic
1106378853 13:29216486-29216508 ACCCAGGGCCCTGGTGGTGCAGG + Intronic
1107468172 13:40667265-40667287 AGCCGCGGCGCCGGGGGTGGGGG - Intergenic
1107732803 13:43365538-43365560 AACCCTGGACCAGGGGGTGCAGG - Intronic
1108503238 13:51086796-51086818 AGCCCTGCCCCTGGGAGTGAGGG - Intergenic
1112041510 13:95552679-95552701 AGCCCCGGGGTTGGGAGTGCGGG + Intronic
1113199876 13:107855276-107855298 ACCCCCGGCCCGTGGGCTGCTGG + Intronic
1113537101 13:111076558-111076580 AGCCCCGCTACTGGGGGTGGTGG + Intergenic
1113904955 13:113814889-113814911 GGCCCCGGGGCAGGGGGTGCTGG + Exonic
1113936182 13:113996265-113996287 AGGCCCTGCCCCGGGGGAGCGGG - Intronic
1114870155 14:26645905-26645927 ACCCACGGCCCTGGTGGTGTAGG + Intergenic
1116820344 14:49621108-49621130 ATCCCGGGCCCCGGGGGTCCTGG - Exonic
1117997825 14:61494494-61494516 AGCCCTGGTCCTGGGGATGTGGG + Intronic
1118642071 14:67802148-67802170 AGTCCTGGCACTGGGAGTGCTGG + Exonic
1121299947 14:92862292-92862314 AGACTCTGCCCTGGAGGTGCAGG - Intergenic
1121310456 14:92932779-92932801 AGCCTCGGACCTGGAGGGGCAGG - Exonic
1121571831 14:94952068-94952090 TGCCCCGGCCCTCGGGGTGTGGG - Intergenic
1122151025 14:99726336-99726358 AACCCCTGCTCTGGGGCTGCTGG + Intronic
1122201163 14:100123608-100123630 AGCCTGGCCCCTGCGGGTGCTGG - Intronic
1122436635 14:101705747-101705769 AGCCCCGGCCCGCAGGGTCCTGG - Intergenic
1122552726 14:102558759-102558781 AGGCAGGGCCCTGAGGGTGCAGG - Intergenic
1122693810 14:103543359-103543381 AACCCAGGCCCTGGGGCTTCTGG - Intergenic
1122838732 14:104444060-104444082 TGCCCAGGCCCTGGGGGAGGAGG + Intergenic
1122880257 14:104687688-104687710 AGGAGCGGCCCTGGGGGCGCTGG + Intergenic
1122977324 14:105176219-105176241 AGACCGGGCGCTGGGGGTGGGGG - Intronic
1123403439 15:20006749-20006771 AGCCCCTGCACAGGTGGTGCTGG + Intergenic
1123425686 15:20168662-20168684 AGCCCAGCAGCTGGGGGTGCAGG - Intergenic
1123512777 15:21013403-21013425 AGCCCCTGCACAGGTGGTGCTGG + Intergenic
1123534914 15:21175189-21175211 AGCCCAGCAGCTGGGGGTGCAGG - Intergenic
1123578377 15:21695085-21695107 TGCCCAGGCCCTGGGGAGGCAGG + Intergenic
1123615002 15:22137567-22137589 TGCCCAGGCCCTGGGGAGGCAGG + Intergenic
1123705953 15:22951375-22951397 AGCCCCGGCCGGGTGGGTGCAGG + Intronic
1124319552 15:28702898-28702920 CCCCCAGGCCCTGGGGCTGCAGG + Intronic
1125200971 15:37100558-37100580 AGCCCCGGCTGGGGGGGTGGGGG + Intronic
1128743117 15:70096841-70096863 AGCCCGGGCCGGGGAGGTGCGGG + Exonic
1129108119 15:73322882-73322904 TGCCCCGGCGCTGGGGGACCTGG + Exonic
1129880215 15:79001474-79001496 AGCCCCTTCCCTTGGGGTGGCGG + Intronic
1129893948 15:79090163-79090185 GGCCGCGGCCCTGGGGGCTCAGG - Intronic
1130348142 15:83067361-83067383 CGCCCCTGCCCTGGGGCTGCCGG - Intergenic
1130518683 15:84645686-84645708 AGCCCTGGCCCTGGGTCTGGTGG - Exonic
1130542932 15:84835024-84835046 GGCCCCAGCCCTGGGGCTGTGGG + Intronic
1130551653 15:84893329-84893351 GGCACCGGCCATGGGGGTTCAGG - Intronic
1130993160 15:88888871-88888893 AGTCCCAAGCCTGGGGGTGCTGG + Intronic
1132150150 15:99453295-99453317 AGCCCCCTCCCTGCGGCTGCTGG + Intergenic
1132243899 15:100279988-100280010 AGCACCAGCCCTGGGGGGGATGG - Intronic
1132365287 15:101252163-101252185 AGCTCCGGCCCCGCGGGCGCCGG - Intergenic
1202987247 15_KI270727v1_random:429330-429352 TGCCCAGGCCCTGGGGAGGCAGG + Intergenic
1132482843 16:175209-175231 AGGCCCTGCCCTGGGTGTCCAGG - Intergenic
1132560204 16:590070-590092 CGCGGCGGCCCTGGTGGTGCGGG + Intronic
1132644106 16:990898-990920 TGCCAGGGCCCTGGGGGAGCAGG - Intergenic
1132650359 16:1018813-1018835 AGCCCAGGCCCTTGGTGAGCTGG + Intergenic
1132650369 16:1018864-1018886 AGCCCAGGCCCTTGGTGAGCTGG + Intergenic
1132669096 16:1095418-1095440 AGGCCCTGCCCTGGGGGCTCCGG - Intronic
1132859431 16:2062721-2062743 AGCCCTGGCTCTGGGTGAGCAGG + Intronic
1132892547 16:2211312-2211334 ACCCCCGGTCTTGGGTGTGCGGG - Exonic
1132931479 16:2461128-2461150 CGCCCCAGGCCTGGGGGTTCGGG - Exonic
1133138476 16:3728536-3728558 AGGCCTGGCCCTGGGGGTTCAGG + Exonic
1133317539 16:4893684-4893706 AGTCCCGCCTCTGTGGGTGCAGG - Intronic
1134070592 16:11257214-11257236 AGCCCCGGCCGTGTGTGTGGTGG - Intronic
1134071409 16:11262153-11262175 AGCCCCTGCTCTGGGCTTGCTGG - Intronic
1134441452 16:14301910-14301932 AGCCTCGACCCTGGGGGCGGGGG - Intergenic
1134771889 16:16816212-16816234 AGCCCGGGCCCTGGGACTCCTGG - Intergenic
1135089676 16:19503371-19503393 AGCCCAGGCCCTGGGGAATCAGG - Exonic
1136272706 16:29158118-29158140 AGTCCCGGCCCGTGGGGTCCTGG + Intergenic
1136519458 16:30786707-30786729 TGCCCCGGCCCCCGGGGTCCCGG + Intronic
1136579564 16:31143247-31143269 AGCCCCTCCCCAGGGGGTGTGGG - Intronic
1136627872 16:31472776-31472798 AGACCCGGATCTGGGGATGCAGG + Intronic
1138104869 16:54282555-54282577 GGCCCCGGCGCGGGGGTTGCGGG - Intergenic
1139489707 16:67279677-67279699 AGGCCAGGGCCTGGGGGGGCCGG + Exonic
1139655860 16:68386969-68386991 AGGCCAGGCGCAGGGGGTGCGGG + Intronic
1140036430 16:71374948-71374970 AGCCCAAGTGCTGGGGGTGCAGG - Intronic
1141950471 16:87336074-87336096 AGCCCTGTCCCGGTGGGTGCTGG - Intronic
1142006113 16:87690286-87690308 AGCCCCGGTCCTCGGGGCGGTGG - Exonic
1142102889 16:88285015-88285037 AGACCCGGCCCTAGGGGAACCGG - Intergenic
1142224499 16:88870993-88871015 AGCCCATGCCCTGGGTCTGCAGG - Intergenic
1142230969 16:88900153-88900175 AGGGCCGGCCCCGCGGGTGCAGG + Intronic
1142261279 16:89043553-89043575 TGCCCCAGCCCGGGAGGTGCTGG - Intergenic
1203120129 16_KI270728v1_random:1529349-1529371 AGCCCAGCAGCTGGGGGTGCAGG + Intergenic
1142625176 17:1187234-1187256 AGCCTCTGCTCTGGGGCTGCCGG + Intronic
1143532253 17:7512320-7512342 ATCCCCGGCCTGGGGGCTGCTGG + Exonic
1144758705 17:17695045-17695067 GGCCCCTGCCGTGGGGTTGCCGG - Intronic
1144781469 17:17810421-17810443 AGCCCTGGGCTTGGGGGTGGGGG + Exonic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1145236835 17:21214310-21214332 AGCCCCGCCCCCGGGGTCGCCGG + Exonic
1145769448 17:27482278-27482300 ATCCATGGCCCTGGGGTTGCAGG + Intronic
1145785840 17:27593408-27593430 AGCCCCTGGTCTGGGGCTGCAGG - Intronic
1145943965 17:28759367-28759389 GGCCCAGGCCCTGAGGCTGCTGG + Exonic
1146662428 17:34673690-34673712 AGCCCCAGCACTGGGGTGGCAGG + Intergenic
1146907083 17:36624725-36624747 TGTCCCGGCCCTGGGGGTCCTGG + Intergenic
1147179012 17:38673511-38673533 CCCCCCGGCCCTGGTGGTGGGGG - Exonic
1147183633 17:38702289-38702311 AGCTCCGGGCCGGGAGGTGCGGG + Intergenic
1148580245 17:48738549-48738571 ATCACCTGCCCTGGGAGTGCAGG + Intergenic
1148721589 17:49757292-49757314 AGTCCAGGCCCTGGGGGACCTGG - Intronic
1148783799 17:50135479-50135501 AGCCCCTACCCTGTGGGTCCTGG - Intronic
1148793177 17:50184965-50184987 CCCCCAGGGCCTGGGGGTGCTGG + Exonic
1149512072 17:57250924-57250946 AGCCAGGGCCCTGGGGGGGTGGG - Intergenic
1149998153 17:61415782-61415804 GGCCCAGGACCTGGGGGTGGGGG - Intergenic
1150128450 17:62653374-62653396 AGACCCCGCCCCGGGGGTGGGGG - Intronic
1151655576 17:75494378-75494400 AGCTCCTGCCCAGGGGGTACTGG - Intronic
1151668282 17:75557964-75557986 AGCCCTGGCCCTGGGGCACCAGG - Intronic
1152391921 17:80008508-80008530 CGCCTGGGCCCTGGGGATGCAGG + Intronic
1152418066 17:80175818-80175840 AGCCCTGGCCCTGGGGTGGCAGG + Intronic
1152516447 17:80827584-80827606 TGGCCCCTCCCTGGGGGTGCAGG - Intronic
1152610536 17:81313130-81313152 AGCTCCGGCCCCGGTGGGGCTGG + Exonic
1152627205 17:81393285-81393307 GGTCCCGGCCCCGCGGGTGCAGG - Intergenic
1152696029 17:81796052-81796074 GGCCCCGGCACTGGGGCGGCTGG - Intergenic
1154221545 18:12459295-12459317 AGCCCATGCCCTGGTTGTGCAGG + Intronic
1154438020 18:14361263-14361285 GGGAACGGCCCTGGGGGTGCAGG + Intergenic
1155064077 18:22253928-22253950 GGCCTGGGCTCTGGGGGTGCAGG + Intergenic
1157196456 18:45624012-45624034 AGCCCTGACCCTGGTGGTACGGG + Intronic
1157222338 18:45837299-45837321 AGTGCAGGCCCTGGGGGTGCAGG + Intronic
1159901720 18:74053282-74053304 AGCCAGGGCCCTGGTGGTGTAGG - Intergenic
1160026678 18:75223731-75223753 AGCCCTGGCCCTGCATGTGCTGG + Intronic
1160598212 18:79992448-79992470 GGCCCTGGGCCTGGGGGTGATGG - Intronic
1160605482 18:80046575-80046597 GGCTCCGTCCCTGGGGCTGCTGG + Intronic
1160662147 19:306189-306211 TGCCCCAGCCCTGGGGGTCGTGG - Exonic
1160680502 19:409847-409869 GGCCCCAGCCCTGGTGATGCAGG + Intergenic
1160699399 19:498644-498666 AGCCCTGGGCCCGGAGGTGCAGG + Exonic
1160703248 19:518095-518117 AGCCCCGGGCTGGGGGGTGCTGG + Intronic
1160734088 19:653956-653978 ACCCCAGGCTCTGGGGATGCAGG + Intronic
1160837066 19:1129762-1129784 CGCCCAGGCCTTGGTGGTGCAGG + Intronic
1160841124 19:1147484-1147506 GGCTGCGGCCATGGGGGTGCAGG - Intronic
1160910248 19:1470769-1470791 AGCCCCAGCTGTGGGAGTGCGGG + Exonic
1160983683 19:1827856-1827878 GGCCCTGGCTTTGGGGGTGCTGG + Exonic
1160987936 19:1848244-1848266 AGCCCCGGGCCCCGCGGTGCCGG + Exonic
1161297477 19:3527143-3527165 AGCCCTGTCCCTGCGGGTCCTGG + Intronic
1161328048 19:3672874-3672896 AGCCCCAGCCCTGGAGGCGGTGG + Intronic
1161487587 19:4544074-4544096 GGCCCAGGGCGTGGGGGTGCGGG + Exonic
1161574502 19:5048180-5048202 TGCCCCTGCCCGGGAGGTGCCGG + Intronic
1161584756 19:5099352-5099374 AGCCCTGGGTCTGGGGGTGATGG - Intronic
1162378247 19:10317498-10317520 CGCCGAGGCCCTGGGAGTGCTGG + Exonic
1162452590 19:10763920-10763942 GGGCCTGGCCCTGGTGGTGCGGG + Intronic
1162584682 19:11551726-11551748 CGCGCCGGCCCAGGGGGAGCAGG - Intronic
1162768884 19:12937426-12937448 AGCCCTGGACCTGGGAGCGCGGG - Intergenic
1162796632 19:13090616-13090638 AGCCCTGGCCCTGGGGAAGGCGG + Intronic
1162942798 19:14023668-14023690 AGGCCAGGCACTGGGGGCGCAGG + Intergenic
1163434387 19:17286528-17286550 AGCCCCGGGCCTGGATGTCCTGG - Exonic
1163520223 19:17787724-17787746 AGCCACGGGGCTGGGTGTGCTGG - Exonic
1163602185 19:18255713-18255735 ATCCCCAGCCCTGTGGGTTCAGG - Intergenic
1163645844 19:18488541-18488563 AGCCCCCGCCCCGTGGATGCTGG - Intronic
1164686841 19:30172353-30172375 AGCCCTGGCCCTCAGGCTGCTGG + Intergenic
1165104718 19:33462125-33462147 AGCCCCGGCCCTGGGGGTGCTGG - Intronic
1165158581 19:33802877-33802899 AGCCCAGGCCCTGGGGGAGGCGG + Intronic
1165831978 19:38734999-38735021 AGCCCTGGCCCTGTGGGGACAGG - Intronic
1165858321 19:38893598-38893620 GGCCCCAGCCCTGGGGTTCCCGG + Intronic
1166369963 19:42295090-42295112 GGCCCCGACTCTGGGGGTGGAGG - Exonic
1166859638 19:45802255-45802277 TGCAGCGGCCCTGGGGGTGGGGG + Exonic
1166997806 19:46728117-46728139 AGCTCTGGCCCTGGGGGAGGGGG + Intronic
1167134417 19:47608653-47608675 AGCCCCAGTCCCGGGGGTTCAGG - Intronic
1167134635 19:47609420-47609442 AGACGCGGGGCTGGGGGTGCCGG - Intronic
1167289051 19:48614682-48614704 AGCCCCGGCGATGGGGGGGATGG - Intronic
1167443566 19:49524447-49524469 AGCCCTGGCTCTGGGAGTGGTGG + Intronic
1167508391 19:49882960-49882982 GGCTCAGACCCTGGGGGTGCAGG - Exonic
1167569282 19:50276853-50276875 CGGCCAGGCCCTGGGGGAGCTGG + Exonic
1167716387 19:51144969-51144991 AGCCCCCTCCCTGGGGCTGGGGG + Intronic
1167722088 19:51185979-51186001 AGCCCCCTCCCTGGGGCTGGGGG + Intergenic
1167762231 19:51457152-51457174 AGCCCCCTCCCTGGGGTTGGGGG - Intronic
1167774267 19:51544591-51544613 AGCCCCCTCCCTGGGGCTGAGGG - Intergenic
1168152406 19:54456091-54456113 ACGCCCGGGGCTGGGGGTGCCGG + Exonic
1168152471 19:54456391-54456413 CGCCCCGGCCCTTAGGGGGCGGG - Exonic
1168153866 19:54462737-54462759 AGCACAGGCCCTGGGAGTCCCGG - Exonic
1168241713 19:55092128-55092150 AGAGCCTGGCCTGGGGGTGCCGG - Intronic
1168322206 19:55517319-55517341 AGCGCTGGGCCTGGGGGTCCCGG - Exonic
925069716 2:956567-956589 GGCCGGGGCCCTGGGGGAGCGGG - Intronic
925240342 2:2320239-2320261 AGCCTCTGCCCTGGGGATGAGGG + Intronic
926037215 2:9645317-9645339 TGGCCCAGCCCTGGGGGTGGTGG + Intergenic
926061876 2:9809505-9809527 AGCCCCTGCCCTAGGGGTCAGGG - Intergenic
926170669 2:10550783-10550805 AGCTGCTGCCCTGGGGGTGGGGG + Intergenic
927148025 2:20179718-20179740 GGCTCCGGCCCTGGGCCTGCTGG + Intergenic
927492088 2:23527324-23527346 AGCCCCCACCCTGGGGTGGCTGG - Intronic
927889433 2:26739079-26739101 TGCTCAGGACCTGGGGGTGCTGG - Intergenic
930222673 2:48761072-48761094 AGGCCAGGCCCTGGGGGTTAGGG + Intronic
932114817 2:69036842-69036864 TGCTCTGGCCCTGGGGGTCCTGG - Intronic
932209267 2:69914387-69914409 GGCCGCGGCCCTGGAGGTTCTGG - Intronic
933777429 2:85779502-85779524 GGCCCTGGCCCTGGGGGTGCTGG + Intronic
933984224 2:87577222-87577244 AGCCCGGCCCCTGGGGGTGCGGG + Intergenic
934656254 2:96118034-96118056 ACCCCCGTGGCTGGGGGTGCTGG - Intergenic
935275757 2:101474257-101474279 AGCCATGGCCGAGGGGGTGCCGG - Intronic
935325792 2:101935697-101935719 ATCCAGGGCCCTGGTGGTGCAGG - Intergenic
935349690 2:102142702-102142724 AGCCCCGCCGCTGCGGGGGCGGG - Intronic
936309630 2:111373574-111373596 AGCCCGGCCCCTGGGGGTGCGGG - Intergenic
937261376 2:120588503-120588525 AGGGCTGGCACTGGGGGTGCCGG + Intergenic
937319382 2:120951885-120951907 AGCCCAGGCCCTGGGGCTCCGGG + Intronic
937377576 2:121348182-121348204 AGCCCCAGCCCTGGGCGAGGTGG - Intronic
937908664 2:127064865-127064887 AGCCCCTTCCCTGGGCGGGCTGG - Intronic
938062015 2:128261814-128261836 AGCCCCGGGCCTCGGGCTTCAGG - Intronic
938380989 2:130836690-130836712 AGACCCGGCCCAGGGGCCGCCGG - Intergenic
938947288 2:136224800-136224822 AGGCCAGGCCCTGGGGATTCAGG - Intergenic
941276543 2:163497711-163497733 AACCCAGGCCCTGGTGGTGTAGG - Intergenic
941478002 2:165971811-165971833 ACCCCGGGCCCTGGTGGTGTAGG - Intergenic
941951304 2:171160198-171160220 AGCCCCGGGGCGGGGGGGGCGGG + Intronic
942942025 2:181630218-181630240 AACCCCGACTCTGGGGGGGCAGG - Intronic
943464292 2:188209528-188209550 AGCCCCTGGCCTGGGAGTTCAGG - Intergenic
943756182 2:191559716-191559738 AGCACCAGCCCTAGGGGTACAGG + Intergenic
943943601 2:194029787-194029809 AACCCCTTCCCTGGGGGTGAGGG + Intergenic
944635366 2:201671088-201671110 ACCCACGGCCCTGGTGGTGTAGG - Intronic
946225470 2:218261958-218261980 AGCCTCAGGCCTGGGGGTGTGGG + Intronic
947139466 2:227008095-227008117 GGCCCCGGCCCAGGCGGTGGCGG - Exonic
947576248 2:231277184-231277206 TGCCCCAGCCCTGGAGGTGGAGG + Intronic
947761466 2:232606530-232606552 AGACCCGGCGCTGGGGCTGGGGG + Intronic
947840516 2:233204609-233204631 AGTCGCGGCCCTTGGAGTGCTGG - Exonic
948207254 2:236168698-236168720 CGGCCCAGCCGTGGGGGTGCGGG - Intergenic
948763112 2:240204730-240204752 AGCCTTGGCCCTGAGGGTGGGGG - Intergenic
948767134 2:240228278-240228300 AGCCCAGGGCCAGGAGGTGCTGG + Intergenic
949023909 2:241756031-241756053 GGCCGCGGCCCTGTGTGTGCTGG + Intronic
949036713 2:241818782-241818804 TGCCCGGGCCCTGGCAGTGCTGG + Intergenic
1169224225 20:3846462-3846484 ATGCCAGGCCATGGGGGTGCCGG + Intergenic
1170606890 20:17881617-17881639 AGCCCCCGCCATGGTGGTGGAGG + Intergenic
1170733145 20:18991095-18991117 AGCCCTGGGTCTGGGGGTGATGG + Intergenic
1170944884 20:20882174-20882196 AGCCCTGGGTCTGGGGGTGATGG - Intergenic
1171459205 20:25289091-25289113 AGGCCGGGGCCTGGGGGTGCTGG + Intronic
1172118721 20:32585496-32585518 GGCCCGGCCCCTGGGGGCGCGGG + Intronic
1172269857 20:33648568-33648590 AGCACCAGCCCTGGAGCTGCAGG - Exonic
1172625438 20:36343976-36343998 TGTTCCGGCCATGGGGGTGCAGG + Intronic
1172767208 20:37357163-37357185 AGCCCCTGTCCTTGGGGAGCAGG + Intronic
1173818443 20:46005280-46005302 AGCCAAGACCCTGGGAGTGCAGG - Intergenic
1173868569 20:46328373-46328395 AGCCCCAGCCCAGGGCGGGCCGG - Intergenic
1175815358 20:61880678-61880700 ACCCCTGGCCTTGGGGGTGAGGG + Intronic
1175831846 20:61969038-61969060 AGCCCCCTCCCTGGCGGCGCTGG - Intronic
1175911214 20:62406396-62406418 ACCCCCAGCCCTGTGGGTTCTGG - Intronic
1176113123 20:63419480-63419502 ACCCACCGCCCTGGCGGTGCGGG - Intronic
1176122750 20:63461563-63461585 AGGGCCGGCCCCCGGGGTGCTGG - Intronic
1176179582 20:63743033-63743055 AGCCCCGGGCCTGGAGGGGGTGG - Exonic
1176236632 20:64056562-64056584 AGCCCCCGCTCTGTGGTTGCAGG + Intronic
1178314798 21:31558978-31559000 AGCCGTGCCCCTGGGGCTGCGGG + Intronic
1178895546 21:36554220-36554242 AGCCCAGGGCCTGGGGGGGTTGG - Intronic
1178920091 21:36733058-36733080 AGCCCCAGCCCTGGGGGGTCTGG + Intronic
1179574581 21:42299783-42299805 GTCCCAGGCCCTGGGGGTGAGGG + Intergenic
1179923744 21:44521481-44521503 GGCCCTGGCCCTGGGGCAGCTGG - Intronic
1179986031 21:44920704-44920726 AGCCCCGGCCCAGGGGTGTCTGG - Intronic
1180006106 21:45021431-45021453 GGCCACGGCCCTGGGGCTGGTGG + Intergenic
1180180677 21:46117480-46117502 AGCCTCGGCCCAGGGGGTGTGGG + Intronic
1180867254 22:19126705-19126727 AGGCCCCGCCCTGGGGGAGTGGG - Intergenic
1181045827 22:20213869-20213891 AGCCAGGAACCTGGGGGTGCAGG - Intergenic
1181078719 22:20400048-20400070 TGCCCAGGCCCAGGGGGAGCAGG + Intronic
1181086604 22:20442465-20442487 AGCCTCGTCCCAGTGGGTGCTGG - Intronic
1183284010 22:36951498-36951520 GGGCAGGGCCCTGGGGGTGCTGG + Intergenic
1183581221 22:38727750-38727772 TGCCCAGGGCCTGGGGGTGGGGG + Intronic
1183605445 22:38864899-38864921 AGGCCAGGCCCTGGGAGGGCAGG - Exonic
1183723195 22:39573970-39573992 AGCCCTGGCCATGGGGATGCCGG - Intronic
1184502633 22:44883088-44883110 AGTTGTGGCCCTGGGGGTGCTGG + Exonic
1184594025 22:45503351-45503373 ATCCCGGGCCCTGGGGGTTCAGG + Intronic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1185250729 22:49800260-49800282 AGGCCTGGCCTTGGGGGTGGGGG - Intronic
1185292016 22:50031976-50031998 CGCCACGGCCCTGGCGCTGCAGG + Exonic
1185338184 22:50280062-50280084 AGTCTCAGACCTGGGGGTGCAGG + Exonic
1185375536 22:50481330-50481352 AGCCCCGAGCCTGCGGGGGCCGG - Intergenic
1185403440 22:50630858-50630880 AGCCCCGGCACTGGGAGTGGTGG + Intergenic
949882939 3:8675817-8675839 AGCCCCAGCCCTGGGGCTACCGG + Intronic
949883926 3:8680031-8680053 AGCCCCAGGGCTGGGGCTGCTGG - Intronic
949985309 3:9536261-9536283 AGCCCCTGCCCTGGATGGGCAGG - Intronic
950196855 3:11015477-11015499 GGCACTGGCCCTTGGGGTGCTGG - Intronic
950217302 3:11168731-11168753 AACCCCAGGGCTGGGGGTGCGGG + Intronic
951393962 3:22141653-22141675 AGCACCGCCCCTGGGGGAGGAGG + Intronic
952616345 3:35278163-35278185 ACCCCAGGCCCTGGTGGTGTTGG - Intergenic
953391509 3:42536375-42536397 AGCCCCGGCCCTGGGCTCGGAGG + Exonic
953418944 3:42739894-42739916 AGGCCCGGGGCTGGGGGTGGGGG + Intronic
953911027 3:46893120-46893142 AGCCAGGGCCCAGGGTGTGCAGG + Intronic
954972596 3:54663775-54663797 AGCCCCAGTCCTCAGGGTGCTGG - Intronic
963103433 3:141625719-141625741 AGGCCTGGGCCTGGAGGTGCAGG - Intergenic
964053054 3:152419605-152419627 AGCCAGGGCCCTGGTGGTGTAGG - Intronic
964209671 3:154212846-154212868 ATCCATGGCCCTGGGGGTGGGGG + Intronic
964802295 3:160569158-160569180 AACCACGGCCCTGGTGGAGCTGG - Intergenic
966711981 3:182980630-182980652 AGCCCCGGACCTCGGGGAGGCGG + Exonic
968380965 4:95472-95494 AGCCCCAACCCAGAGGGTGCAGG - Intergenic
968426526 4:527135-527157 TGCCCTGGCGCTGGGGCTGCTGG + Exonic
968688481 4:1977115-1977137 AGCCCCTGTCCTGGATGTGCAGG + Intronic
968871610 4:3245513-3245535 AGCCCCGTTCCTGGGGGTGTGGG + Intronic
968890173 4:3364634-3364656 AGCCCAGGGCCTGGGGCAGCTGG + Intronic
969307788 4:6335661-6335683 AGCCCTGGCCCACCGGGTGCTGG - Intronic
969448198 4:7257357-7257379 AGACCCAGGCCTGGGGGTGGTGG + Intronic
969449458 4:7264784-7264806 AGGCCAGACCCTGAGGGTGCAGG + Intronic
969526780 4:7707877-7707899 GGCCCTGGTCCTGGGGGTGATGG - Intronic
969599974 4:8170553-8170575 AGTCCCGGCCCCGTGGCTGCGGG - Intergenic
972730301 4:41788226-41788248 AGACCCAGCCCTGGGAGTGGGGG + Intergenic
973081898 4:46003361-46003383 AACCCAGGGCCTGGTGGTGCAGG + Intergenic
975448730 4:74500085-74500107 AGCCCAGGCTCTGGGAGTTCAGG + Intergenic
977928614 4:102728812-102728834 AACCACTGCCCTGGTGGTGCTGG + Intronic
978384464 4:108166913-108166935 AGCCCAGGCGCTGGGGCCGCAGG + Intronic
980856798 4:138450477-138450499 AGCCCCGGAATTGGGGGTGTTGG + Intergenic
980985485 4:139690874-139690896 AGCCTGGGCCCTGGGGGCTCAGG - Intronic
981474979 4:145179709-145179731 AGCCCCGGCCGTGGGCGGCCCGG + Intronic
981671503 4:147292500-147292522 ACCCCGGGCCCTGGTGGTGTAGG - Intergenic
981885290 4:149666456-149666478 ACCCAGGGCCCTGGTGGTGCAGG - Intergenic
982206433 4:153000562-153000584 AGCCGTGGCCCTAGGGGAGCTGG + Intergenic
985068439 4:186144969-186144991 AGCCCCAGCCCCGGGGCCGCGGG + Exonic
985317367 4:188672503-188672525 ATCCAGGGCCCTGGTGGTGCAGG - Intergenic
985589157 5:755819-755841 GGGCCCGGCCCTGTGGCTGCGGG - Intronic
985603836 5:848335-848357 GGGCCCGGCCCTGTGGCTGCGGG - Intronic
985631763 5:1017686-1017708 AGCTCAGGCCCTGGGGCTGCAGG - Intronic
986110308 5:4709662-4709684 ACCCCAGGCCCTGGTGGTGTAGG - Intergenic
986266390 5:6194906-6194928 AGACCCTGCCATAGGGGTGCTGG - Intergenic
986646309 5:9919899-9919921 AGCCCCAGCAGTGGGGATGCAGG + Intergenic
987374236 5:17218597-17218619 GGCCCGGGCCCGGGGGGTGTGGG + Intronic
988640239 5:33033799-33033821 AGCCCCAGGCCTGGAGGGGCTGG + Intergenic
991652026 5:68865296-68865318 ACCCTCGGCCCTGGTGGTGTAGG - Intergenic
993381900 5:87217979-87218001 ACCCAGGGCCCTGGTGGTGCAGG + Intergenic
995061065 5:107812422-107812444 AGCCACTGCCCCAGGGGTGCAGG - Intergenic
996191549 5:120549362-120549384 AGCCTGGGCCCTGGGTGTGGTGG - Intronic
997980832 5:138466466-138466488 AGCCGCGGCCATGGGGGTGCTGG + Intronic
999276326 5:150332986-150333008 AGACACAGCTCTGGGGGTGCTGG + Intronic
999385488 5:151151186-151151208 AGCCCCGCCTCTGAGGGTTCTGG + Intronic
1000423586 5:161064466-161064488 AGCCCCGCCCCTCAGGCTGCAGG - Intergenic
1000798426 5:165693524-165693546 ACCCACGGCCCTGGTGGTGTAGG + Intergenic
1001123668 5:168999785-168999807 AGGGCCGGCCCTGGGGCTGCAGG + Intronic
1001382138 5:171311872-171311894 GCGCCCGGCCCGGGGGGTGCGGG - Exonic
1001878090 5:175218160-175218182 AGCCCAGGGCCTGGGTTTGCTGG - Intergenic
1001995754 5:176156281-176156303 AGCCCAGGCCCTGCGGTTGGTGG + Intergenic
1002082085 5:176743299-176743321 CGTCCCTGCCCCGGGGGTGCGGG + Intergenic
1002184234 5:177446871-177446893 AGCCCCGGGCCTGCGGGGGGAGG - Exonic
1002196675 5:177504955-177504977 AGACCCAGCCCTGGGTGTGGGGG + Intronic
1006180014 6:32149001-32149023 AGCGGCGTCCCTGGGGGTGTGGG + Exonic
1006185870 6:32181424-32181446 AGCCCTGGCCCTGGGGATCCTGG - Exonic
1006362573 6:33594998-33595020 AAGGCAGGCCCTGGGGGTGCGGG + Intergenic
1006945744 6:37783549-37783571 GGCCTGGGCCCTGGGGGTGTGGG - Intergenic
1007357073 6:41328811-41328833 AGCCAAGGTCCTGGGGCTGCAGG - Intergenic
1007360561 6:41352515-41352537 AGGCCCGGGGCTGGGGGTGGGGG - Intergenic
1007621953 6:43220830-43220852 AGCCCAGGCCCTGGCGGCACAGG - Exonic
1007749303 6:44062406-44062428 AGCTCTGCCCCTGGGGGTCCTGG + Intergenic
1014205519 6:118651604-118651626 AGCCCCGGCTCTGGCTCTGCCGG - Intronic
1016461617 6:144285163-144285185 AGCCCCTTCCCGGGGGGTGGGGG + Intergenic
1017163855 6:151390526-151390548 AGCCCCGGCGCCGGGGGCGGGGG + Intronic
1017817742 6:158027670-158027692 AGCCCCTCCCCTGGGGGCACAGG + Intronic
1018013679 6:159693573-159693595 GGCTCCGCCCCTGAGGGTGCCGG + Intronic
1018450235 6:163900974-163900996 TACCCCGGCCCTGGGAGAGCTGG - Intergenic
1018957295 6:168418770-168418792 AGCCCAGGCCCTGGGGAGCCTGG - Intergenic
1019061216 6:169259511-169259533 AGCCCTGGCCCTGGGAATTCTGG - Intergenic
1019178913 6:170175385-170175407 GGCCCAGGACTTGGGGGTGCTGG - Intergenic
1019486270 7:1290834-1290856 AGCCCTGGAAATGGGGGTGCAGG - Intergenic
1019546726 7:1581129-1581151 AGACCTGGCCCTGGGGGAGGCGG - Intergenic
1021340160 7:19455292-19455314 AGCCCCGTCCCTAGGGGAGAGGG - Intergenic
1022410459 7:30135449-30135471 AGCCCCGGGCCGGGCGGTGCGGG + Intronic
1022697937 7:32728434-32728456 AGCGGCGGCCCTGGACGTGCGGG + Intergenic
1023289712 7:38656528-38656550 AGCCACGGCCCTGGTGGAGCTGG - Intergenic
1023703054 7:42911766-42911788 AGCCGCGGCGCTGGCGGTGGGGG - Intronic
1023873190 7:44273653-44273675 AGGCCAGCCCCTGGGGGTGCAGG + Intronic
1023994308 7:45149796-45149818 AGCCCCAGGCCTGAGGGAGCAGG + Intergenic
1023996345 7:45161301-45161323 TGCCCTGGCACTGGGGGTGGTGG + Intronic
1024286088 7:47758831-47758853 GGGCCGTGCCCTGGGGGTGCAGG + Intronic
1026894262 7:74000851-74000873 AGCGGCCGCCCTGGGGCTGCAGG + Intergenic
1029458236 7:100681692-100681714 AGCCCAGGGGCTGGGGGTCCGGG + Exonic
1029497311 7:100902903-100902925 AGCCCCGACCCTGGCCCTGCTGG - Intergenic
1029649431 7:101880848-101880870 AACCCAGGACCTGGGGGTGGGGG - Intronic
1030597990 7:111562317-111562339 GGCCCCGGCCCCGGCGGGGCGGG - Intronic
1032015699 7:128379186-128379208 GGACCTGGCCCTGTGGGTGCTGG - Intergenic
1032240513 7:130155278-130155300 TGCCCAGGCCCTGCTGGTGCTGG - Intergenic
1033200037 7:139360332-139360354 TGCCAGGGCCCTGGGGGTGGGGG + Intronic
1034469552 7:151248127-151248149 TGCCCCTGCCCTGGGGGTGGGGG - Intronic
1034475647 7:151280065-151280087 AGGCCTGGCCCGGGTGGTGCAGG + Intergenic
1035208371 7:157309677-157309699 AGCCCCGGCCCTGTGTGAGCAGG - Intergenic
1035621333 8:1037436-1037458 CCGCCAGGCCCTGGGGGTGCAGG - Intergenic
1035739329 8:1914340-1914362 AGCCACAGCCCTGAGGGTTCTGG + Intronic
1036191192 8:6671646-6671668 AGCCCCAGTGCTGGGGGTTCGGG - Intergenic
1036643671 8:10599321-10599343 AAGCCCAGCCCAGGGGGTGCAGG + Intergenic
1036650306 8:10637948-10637970 GGACCCAGCCCTGGGGCTGCAGG - Intronic
1036694202 8:10964154-10964176 AGCCCCTGCCCTGGGGAGGTAGG - Intronic
1036775936 8:11613257-11613279 AGCCTTGGGCCTGTGGGTGCCGG + Intergenic
1037808209 8:22069987-22070009 AGGCCGTGCCCTGGGGCTGCGGG + Intronic
1037825139 8:22156304-22156326 AGCCCTGGCCTTGGGGGTTGGGG - Intronic
1037882168 8:22578764-22578786 TGCCCAGGACCTGGGGATGCGGG + Exonic
1038056093 8:23859160-23859182 AGCCCTGCCCCTCAGGGTGCGGG + Intergenic
1039079717 8:33722730-33722752 GGCCCAGGTCCTGGTGGTGCTGG + Intergenic
1040481850 8:47833791-47833813 AGCCTTGGAGCTGGGGGTGCAGG - Intronic
1042764164 8:72302336-72302358 AACCATGGCCCTGGGTGTGCAGG + Intergenic
1049044289 8:140137110-140137132 TGCCCGAGCCCTGTGGGTGCTGG - Intronic
1049178018 8:141206053-141206075 AGCCACGAGTCTGGGGGTGCCGG + Intergenic
1049185113 8:141246402-141246424 AGCCTCGGCCCTGGGGGTGTTGG + Intronic
1049256021 8:141614360-141614382 AGCCCCTGGGCTGGGGGTGGAGG - Intergenic
1049553087 8:143269665-143269687 AGCCCCTGGCCTGAGGGTGTGGG - Intronic
1049602866 8:143515982-143516004 AGCCCAGGCCCTGCAGGTGCAGG + Intronic
1049616137 8:143576523-143576545 CGCCCTGGCCCTGGGAGAGCTGG - Exonic
1049655538 8:143795380-143795402 CTCCCTGGCCCTGGGGCTGCCGG + Intronic
1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG + Intronic
1049812673 8:144582454-144582476 AGCAGCAGCCCTGGGGGTTCTGG + Intronic
1050094219 9:2047222-2047244 AGCTCCGGCCCCGGGCCTGCGGG - Exonic
1050300546 9:4253718-4253740 ACCCACGGCCCTGGTGGTGTAGG + Intronic
1052857295 9:33415321-33415343 AGCCCTGGGCGAGGGGGTGCGGG + Intergenic
1053608207 9:39681501-39681523 ACCCAGGGCCCTGGTGGTGCAGG + Intergenic
1053611440 9:39717440-39717462 TGCCCTGTCCCTTGGGGTGCTGG + Intergenic
1053866047 9:42437861-42437883 ACCCAGGGCCCTGGTGGTGCAGG + Intergenic
1053869475 9:42475490-42475512 TGCCCTGTCCCTTGGGGTGCTGG + Intergenic
1054086814 9:60753720-60753742 TGCCCTGTCCCTTGGGGTGCTGG - Intergenic
1054242080 9:62624952-62624974 TGCCCTGTCCCTTGGGGTGCTGG - Intergenic
1054245324 9:62660908-62660930 ACCCAGGGCCCTGGTGGTGCAGG - Intergenic
1054556205 9:66659468-66659490 TGCCCTGTCCCTTGGGGTGCTGG - Intergenic
1054559452 9:66695439-66695461 ACCCAGGGCCCTGGTGGTGCAGG - Intergenic
1056808061 9:89743988-89744010 AGCCCCTGCCCTGGGCCTCCTGG + Intergenic
1057943719 9:99306523-99306545 AACCACGGCCCTGGTGGAGCTGG - Intergenic
1058249004 9:102668478-102668500 TGCCCAGGGCCTGGGGGAGCTGG - Intergenic
1059142215 9:111864288-111864310 AGCCCCACCCTTGGGGGTGCAGG - Intergenic
1059251544 9:112891157-112891179 AGCCCCTGCCCCGGTGGTGGGGG - Intergenic
1060402374 9:123356284-123356306 AGGCCAGGGCCTGGGGGTCCGGG - Exonic
1060407991 9:123382135-123382157 AGCCCTGGCCCCGGGGCTGCAGG - Exonic
1060584379 9:124777109-124777131 AGCTCCGCCCCTGGCGGCGCTGG + Intergenic
1061261600 9:129483362-129483384 ACGCCCGGCCCTGGGGCTGGGGG - Intergenic
1061304295 9:129723509-129723531 AACCCTGGCCCTTGGGGTGGCGG + Intergenic
1061472047 9:130834998-130835020 AGCCCCGGCGGGGAGGGTGCAGG - Intronic
1061562565 9:131415420-131415442 AGCCCCAGCCCCAGGGGAGCGGG - Intronic
1061807253 9:133143377-133143399 AGGCCCGCCCCTGAGGCTGCTGG - Intronic
1061953599 9:133950012-133950034 AGCCCCAGCACTGGGGTTCCTGG - Intronic
1062038295 9:134392457-134392479 AGCTCCTGCCATGGGGGTACAGG - Intronic
1062048830 9:134436939-134436961 GGCCCCAGCCCTGGAGCTGCAGG + Exonic
1062156446 9:135051467-135051489 GGCACCGCCACTGGGGGTGCTGG - Intergenic
1062207804 9:135346888-135346910 AGCCCCGGCCCAGAGCCTGCAGG - Intergenic
1062372748 9:136248553-136248575 AGCCCTGGGCCTGGGGGTGGTGG + Intergenic
1062567216 9:137168608-137168630 CGCTCGGGCCCTGGGAGTGCTGG - Exonic
1186496714 X:10016432-10016454 TGCCCCGGCCCTGGTTCTGCAGG + Intronic
1187154682 X:16712233-16712255 TGCACCGGGGCTGGGGGTGCAGG + Intronic
1189717729 X:43882549-43882571 AGCCCAGGCCCGGGGAGGGCGGG + Intergenic
1190968314 X:55323597-55323619 AGCCCAGGGCCTGGGGCTTCTGG + Intergenic
1191220822 X:57986045-57986067 AACCGCGGCCCTGGTGGAGCTGG - Intergenic
1192739362 X:73877625-73877647 ACCTCCGACCCTGGGGGTGGGGG - Intergenic
1193073707 X:77333208-77333230 AGCCAAGGCCCTGGTGGTGTGGG + Intergenic
1199793819 X:151177424-151177446 CGCCGCGGCCCTGGGGCTCCAGG + Intronic
1200064215 X:153497048-153497070 AGCCCCAGCCCTGGGGTCCCTGG + Intronic
1200126278 X:153816373-153816395 AGCCCCAGCCCTGGGGTCCCTGG - Intronic
1200150703 X:153950050-153950072 AGCTCCGGGCCTGGGGGTGCAGG - Intronic
1200234419 X:154461416-154461438 GGCCCAGGCCCTGGGCGTGCCGG + Exonic
1201146996 Y:11070353-11070375 AGTACCGGCTCTGGGGGTGACGG + Intergenic