ID: 1165105462

View in Genome Browser
Species Human (GRCh38)
Location 19:33467217-33467239
Sequence TAGGAGCCTCCTCTTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165105462 Original CRISPR TAGGAGCCTCCTCTTGAGGG AGG Intronic
900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG + Intronic
901161252 1:7177899-7177921 GAAGAGCCTCCGCCTGAGGGAGG - Intronic
901671522 1:10858823-10858845 AAGGAGCCTCCTCTGATGGGAGG + Intergenic
901768212 1:11517224-11517246 CAAGAGCCTCCACTTGAGGTGGG + Intronic
902576581 1:17381753-17381775 TCAGGGCCTCCTTTTGAGGGAGG - Intronic
904271471 1:29353151-29353173 TAGCAGCCCTCTCTTGGGGGAGG + Intergenic
907593196 1:55695462-55695484 TAGGAGTCTCCTCTGGGGAGTGG - Intergenic
908815759 1:68032036-68032058 TAATAGCCTACTCTTGATGGAGG + Intergenic
909940841 1:81610010-81610032 TAGTAGCCTCCTCTGGAGTGTGG + Intronic
910209167 1:84776064-84776086 GAGGACCTTCCTCCTGAGGGTGG - Intergenic
915275939 1:154788055-154788077 TAGGCGCCTCCACTGGAGGCTGG + Intronic
915523427 1:156462102-156462124 AGGGAGCCTCCTCTAGAGGGTGG + Intergenic
915978535 1:160406366-160406388 GAGAAGCCTACCCTTGAGGGTGG + Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918392946 1:184085243-184085265 AAGGAGCCTTCTGTTGATGGTGG + Intergenic
920096165 1:203487816-203487838 CAGGAGCCGCCTCCCGAGGGTGG - Exonic
920345687 1:205304375-205304397 CAGGAGGCTCCGCATGAGGGTGG - Exonic
922739962 1:228009174-228009196 AAGCAGCCTCCCCTTGGGGGAGG + Intronic
1070390681 10:75967878-75967900 GAAGAGCCTGTTCTTGAGGGAGG + Intronic
1070735327 10:78860023-78860045 AAGGAGCCTCCTCAGCAGGGTGG + Intergenic
1071490002 10:86129818-86129840 TGGAAGACTGCTCTTGAGGGGGG - Intronic
1072232637 10:93426022-93426044 TAGCAGCCTCCCCCTGGGGGTGG + Intronic
1072249704 10:93572023-93572045 AAGGAGACTCCCCTTGAGGATGG - Intronic
1072898918 10:99390472-99390494 TAGCATCTTCCTCTTGGGGGAGG + Intronic
1073868026 10:107827699-107827721 GAGCAGCCTCATCTTTAGGGAGG - Intergenic
1076078816 10:127559379-127559401 TAAGCCCCTCCTCTTGAGTGTGG - Intergenic
1081955439 11:47088175-47088197 TAGGATCCACCTCTTGAAGTGGG + Intronic
1081977168 11:47242984-47243006 TAGCAGTGTCCTCTGGAGGGGGG - Intronic
1090451231 11:126808167-126808189 TAGGGCCCTCATCTTGAGGCTGG + Intronic
1101560980 12:105857786-105857808 TGGGAGCTTCTTCTTGAGTGGGG - Intergenic
1102558453 12:113745085-113745107 TATGAACCTCCTCTGGAGGACGG - Intergenic
1104580311 12:130006734-130006756 GGGGAGCCTCCCCTTGAGGGTGG + Intergenic
1104689961 12:130818361-130818383 AGGGAGACTCCTCTGGAGGGTGG + Intronic
1105925721 13:25005941-25005963 TGGGAGTCTCCTCTTCAGGGGGG + Intergenic
1106038978 13:26071674-26071696 TGGGAGTCTCCTTTTCAGGGGGG - Intergenic
1107339361 13:39389456-39389478 TAGGAGCCTGCTGTAGAGGAAGG + Intronic
1113396890 13:109956170-109956192 AAGGAGCCACATCTTGGGGGTGG + Intergenic
1113814380 13:113161373-113161395 TAGGAGACTCCTCCCAAGGGAGG + Intronic
1115342162 14:32304469-32304491 GGGGAGCCTCCTCCTCAGGGTGG - Intergenic
1117602746 14:57391253-57391275 CAGGACCTTGCTCTTGAGGGAGG - Exonic
1123444098 15:20311565-20311587 TAGGATCCACCTCTTGGGGCAGG + Intergenic
1123467616 15:20528361-20528383 TAGGAGCCTCTTCTCGATAGAGG - Intergenic
1123650498 15:22472681-22472703 TAGGAGCCTCTTCTCGATAGAGG + Intergenic
1123740906 15:23281523-23281545 TAGGAGCCTCTTCTCGATAGAGG + Intergenic
1123746092 15:23321035-23321057 TAGGAGCCTCTTCTCGATAGAGG - Intergenic
1124278361 15:28344352-28344374 TAGGAGCCTCTTCTCGATAGAGG - Intergenic
1124304341 15:28567256-28567278 TAGGAGCCTCTTCTCGATAGAGG + Intergenic
1124727020 15:32163368-32163390 GAGGAGCCTCCTTTACAGGGGGG - Intronic
1126119653 15:45240402-45240424 TAGGAGGCTCCTCAGGAAGGAGG + Intergenic
1126198148 15:45954651-45954673 TAGGAGCCACCTCTCTAAGGTGG + Intergenic
1126200312 15:45978385-45978407 TAATACCCTCCTCTTGAGTGTGG + Intergenic
1127280960 15:57492221-57492243 TAGGAGGCACATCTTAAGGGAGG + Intronic
1127334161 15:57967248-57967270 TTGGATCCTCCTCTGTAGGGGGG + Intronic
1127574881 15:60281700-60281722 CAGGTGCATCCTCTTAAGGGTGG - Intergenic
1129740256 15:77986510-77986532 TGGGAGCCAGCTCTGGAGGGTGG + Intronic
1129845497 15:78766087-78766109 TGGGAGCCAGCTCTGGAGGGTGG - Exonic
1130744760 15:86639187-86639209 TAACAGCCTCTTCTTGAGTGTGG - Intronic
1133622452 16:7539425-7539447 TAGGAGTCTCTTCTTGTAGGTGG + Intronic
1137270738 16:46900850-46900872 CAGGACCCTCCGCTTGAGGCTGG - Intronic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1140453937 16:75093731-75093753 TGGGAGCCTCCAGTCGAGGGTGG + Intronic
1143529377 17:7493145-7493167 TAGGACTCTCCACTGGAGGGAGG - Intronic
1156335865 18:36170862-36170884 AAGGAGCCTCCTCTTTACAGGGG - Intronic
1159459676 18:68708558-68708580 TGGGAGCCTGCTGTTGTGGGTGG - Intronic
1160189798 18:76706554-76706576 GAGGAGCCCCCACTGGAGGGCGG - Intergenic
1165105462 19:33467217-33467239 TAGGAGCCTCCTCTTGAGGGAGG + Intronic
927489066 2:23508572-23508594 TAGGCTCCACCTCTTGATGGGGG + Intronic
931708024 2:64963912-64963934 TAGAAGCCTCCACTAGATGGTGG + Intergenic
933595606 2:84280088-84280110 TAGTAGCATCTTATTGAGGGAGG + Intergenic
935115796 2:100135276-100135298 TAGGTTCCACCTCCTGAGGGAGG - Intronic
936613165 2:114021446-114021468 ACAGAGCCTCCTCTTGAGGAAGG - Intergenic
937041816 2:118827706-118827728 TGGGAGCCTCCTCTTGAGAAAGG + Intergenic
938343521 2:130550336-130550358 TATGACCCTCCTGTTGAGTGTGG - Intergenic
938346312 2:130570386-130570408 TATGACCCTCCTGTTGAGTGTGG + Intergenic
945054996 2:205860645-205860667 GAGGAGCTGTCTCTTGAGGGTGG - Intergenic
945929356 2:215839831-215839853 AAGGGGCCACCTGTTGAGGGTGG - Intergenic
1170627321 20:18039834-18039856 TGGGAGCCCCATCTGGAGGGAGG + Intronic
1171334474 20:24371010-24371032 CGGGAGCCTCCTCTGAAGGGAGG + Intergenic
1172426038 20:34856757-34856779 TGGGAGGCTTCTCCTGAGGGGGG + Intronic
1175874184 20:62221654-62221676 TAGGAGTCTGCTCTTGGGGGAGG + Intergenic
1175885084 20:62285562-62285584 CAGGAGCCACTTCTTGATGGGGG + Intronic
1175904268 20:62371953-62371975 CAGGGGCCCCCACTTGAGGGAGG - Intergenic
1175946193 20:62559860-62559882 TTGGAGCCCCCTCCTGTGGGTGG - Intronic
1178362228 21:31958191-31958213 CAGGAGCCACCTCCTGAGGAGGG - Intronic
1180117780 21:45723246-45723268 TAGTGGCCTGCTCTCGAGGGAGG + Intronic
1182504344 22:30771255-30771277 TCAGACCCTCCTCTGGAGGGAGG + Intronic
1184268704 22:43364964-43364986 TAGGAACCTCATCTGGAAGGTGG + Intergenic
1184530205 22:45050775-45050797 TGGAAGCCTGTTCTTGAGGGAGG + Intergenic
1185264935 22:49896375-49896397 TAGTATCCTCCTATTGAGGTGGG + Intergenic
951659372 3:25045477-25045499 CAGGACACTCCTCTGGAGGGAGG - Intergenic
951691927 3:25405864-25405886 TAGGAGCCAGCTCTTGGTGGAGG + Intronic
952712227 3:36443236-36443258 TATGAGCCTCCTCAAGACGGAGG + Intronic
953058487 3:39406970-39406992 TCGGAGCCTCCGCTGGAGGGCGG - Intronic
954293196 3:49660542-49660564 GGTGAGCCTCCTCTGGAGGGGGG - Exonic
954328385 3:49876038-49876060 TGGGAGCCTCCTCTTTAGAGTGG + Intergenic
955556989 3:60148986-60149008 AGGGAACCTCCTCTTGATGGTGG - Intronic
960192912 3:114728616-114728638 AAATAGCCTCCTCTTGAGAGGGG - Intronic
965585526 3:170314492-170314514 ACGCAGCCTCCTCTTGAGAGAGG - Intergenic
966402059 3:179557528-179557550 TAGCCGTCTCCTCTTCAGGGTGG - Intergenic
966586077 3:181626460-181626482 TAAGAGCCTTTTTTTGAGGGGGG - Intergenic
968764185 4:2459528-2459550 TAGGAGCTGCCTGTTGAGGGAGG + Intronic
969015907 4:4104161-4104183 TAGGTGCCTGGTCTTGAGGAAGG + Intergenic
969243423 4:5916812-5916834 CAGGAGCCTCTGCTTGAGGTGGG + Intronic
971175302 4:24276974-24276996 TAGGAGCCTGAATTTGAGGGCGG - Intergenic
973630188 4:52813068-52813090 TAGGCCCTTCCTCTTGATGGAGG - Intergenic
973646362 4:52954871-52954893 TAGGAGCCACTTCTTGAGGGAGG - Intronic
974132581 4:57774875-57774897 TAGCAGCCACCTCCTTAGGGTGG + Intergenic
979670519 4:123356025-123356047 TAGTCCCCTTCTCTTGAGGGTGG + Intergenic
983664972 4:170171184-170171206 TAAAAGCCACCTCTTGATGGTGG + Intergenic
986165926 5:5271414-5271436 GAGGAGCCTCCGTGTGAGGGAGG - Intronic
986754898 5:10826443-10826465 TAGGGGGCTCCACATGAGGGTGG + Intergenic
986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG + Intergenic
994158308 5:96527554-96527576 TATGAGCCTGCTGTAGAGGGAGG - Intronic
995140271 5:108728034-108728056 TGGGAGCCTCCTTCTGACGGCGG - Intergenic
995496235 5:112747225-112747247 TAGGACCTTTTTCTTGAGGGGGG + Intronic
995805763 5:116050688-116050710 TGGAAGCCTCCTCTGGAGAGTGG + Intronic
996561840 5:124838305-124838327 TAGAAGCCTCCTTTTCAAGGTGG - Intergenic
998445020 5:142191805-142191827 TTGGAGCCTCACCTTGAGGGTGG + Intergenic
999806080 5:155082630-155082652 TATGAGCCGCTACTTGAGGGAGG - Intergenic
1005968612 6:30744061-30744083 TAGGGGCGTCCTCTGGAGGCAGG + Exonic
1011018388 6:82783610-82783632 TGGGACCCTCCTGTTGAGAGTGG + Intergenic
1019389696 7:779134-779156 TAGGATCCTCTTGCTGAGGGTGG + Intronic
1019777960 7:2923611-2923633 TAGGAGGGTCCCCTTGAGCGCGG + Intronic
1019801209 7:3089613-3089635 CAGGAGACCCCTCTGGAGGGAGG + Intergenic
1022508951 7:30923190-30923212 TAGCAGCCCCTTCTTGAGGAAGG - Intronic
1023417874 7:39949799-39949821 CAGGAGCCTCCTCGTGGAGGGGG + Intergenic
1024532678 7:50406484-50406506 TAGGAGGCTCCCATTGAAGGAGG - Intergenic
1025213717 7:57037072-57037094 TAGGCGCCACCTCTGGAGGCAGG + Intergenic
1026015077 7:66666185-66666207 AAGGAGCCTCCTCTGCAGGTAGG + Intronic
1028597939 7:92566736-92566758 TAGGCACTTCCCCTTGAGGGTGG - Intronic
1029256161 7:99271046-99271068 TCGGGGCTTCCTCATGAGGGTGG + Intergenic
1030517435 7:110555528-110555550 TAATGTCCTCCTCTTGAGGGTGG + Intergenic
1033252567 7:139773759-139773781 GAGGAGCCTCCCCTTGGAGGAGG + Intronic
1033513689 7:142085490-142085512 CAGGGGCAGCCTCTTGAGGGAGG + Intronic
1034981799 7:155483874-155483896 ATGGAGCCTCTTCTGGAGGGAGG + Intronic
1036216453 8:6883714-6883736 TGGGGGCTTCCTCTTCAGGGAGG + Intergenic
1039388617 8:37158926-37158948 TAGGGGCCTCCACTAGAGGTTGG + Intergenic
1041191564 8:55360875-55360897 GAGGAGCCTCCTCATGCTGGAGG + Intronic
1053753700 9:41280820-41280842 TAGGAGCTTCCTGTTAAGTGTGG - Intergenic
1054259223 9:62845180-62845202 TAGGAGCTTCCTGTTAAGTGTGG - Intergenic
1054332556 9:63774857-63774879 TAGGAGCTTCCTGTTAAGTGTGG + Intergenic
1055173035 9:73284231-73284253 TCTGATACTCCTCTTGAGGGAGG - Intergenic
1057309757 9:93934656-93934678 TAGAAGATTCCTCTTGTGGGAGG + Intergenic
1058053337 9:100427395-100427417 TAGGAGGCTCCCCTTCCGGGCGG + Intronic
1060383077 9:123195177-123195199 TAGTTGCCTTCTCTTGAGGGAGG - Intronic
1060704892 9:125789668-125789690 TAGTAGCCTCCCCTTGAGCATGG - Intronic
1188920398 X:35968889-35968911 TAGAAGCCACCTCTGCAGGGTGG - Intronic
1190368430 X:49719179-49719201 TAGGAGCTTCCCCTGGAGGGAGG + Intergenic
1199391026 X:147279121-147279143 TAAGAGGCTTCCCTTGAGGGAGG + Intergenic
1199391243 X:147281812-147281834 TAAGAGGCTTCCCTTGAGGGAGG + Intergenic
1199391461 X:147284510-147284532 TAAGAGGCTTCCCTTGAGGGAGG + Intergenic
1199615695 X:149653027-149653049 GAGGAGGATCCTCTTGAGTGAGG - Intergenic
1200082015 X:153581927-153581949 TAGGGGCTTCCTCAGGAGGGTGG - Exonic