ID: 1165106052

View in Genome Browser
Species Human (GRCh38)
Location 19:33470213-33470235
Sequence CTGGAGGCCTAGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 559}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165106052_1165106066 12 Left 1165106052 19:33470213-33470235 CCCTCCAGCCTCTAGGCCTCCAG 0: 1
1: 0
2: 2
3: 49
4: 559
Right 1165106066 19:33470248-33470270 GATAGCAGCTGGGGATCTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 148
1165106052_1165106061 2 Left 1165106052 19:33470213-33470235 CCCTCCAGCCTCTAGGCCTCCAG 0: 1
1: 0
2: 2
3: 49
4: 559
Right 1165106061 19:33470238-33470260 CACCTGCCCTGATAGCAGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 197
1165106052_1165106062 3 Left 1165106052 19:33470213-33470235 CCCTCCAGCCTCTAGGCCTCCAG 0: 1
1: 0
2: 2
3: 49
4: 559
Right 1165106062 19:33470239-33470261 ACCTGCCCTGATAGCAGCTGGGG 0: 1
1: 0
2: 1
3: 14
4: 187
1165106052_1165106060 1 Left 1165106052 19:33470213-33470235 CCCTCCAGCCTCTAGGCCTCCAG 0: 1
1: 0
2: 2
3: 49
4: 559
Right 1165106060 19:33470237-33470259 CCACCTGCCCTGATAGCAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165106052 Original CRISPR CTGGAGGCCTAGAGGCTGGA GGG (reversed) Intronic
900369033 1:2323355-2323377 CTGGAGAGCCAAAGGCTGGAAGG - Intronic
900460126 1:2798750-2798772 TTGGAGGCTGAGAGGCTGGGAGG - Intronic
900460151 1:2798830-2798852 TTGGAGGCTGAGAGGCTGGGAGG - Intronic
900460157 1:2798854-2798876 TTGGAGGCTGAGAGGCTGGGAGG - Intronic
900460171 1:2798894-2798916 TTGGAGGCTGAGAGGCTGGGAGG - Intronic
900460183 1:2798934-2798956 TTGGAGGCTGAGAGGCTGGGAGG - Intronic
900460191 1:2798966-2798988 TTGGAGGCTGAGAGGCTGGGAGG - Intronic
900460200 1:2798998-2799020 TTGGAGGCTGAGAGGCTGGGAGG - Intronic
900460216 1:2799046-2799068 TTGGAGGCTGAGAGGCTGGGAGG - Intronic
900478435 1:2886984-2887006 TGGGAGGCCGAGAGGCTGGGAGG - Intergenic
902551041 1:17219797-17219819 CTCCAGGCCCAGGGGCTGGAGGG + Intronic
902728805 1:18354972-18354994 CTGGAAGCTGAGAGGCTGGCAGG + Intronic
903499976 1:23795343-23795365 CTGCAGGCCTGGAGCCTGTAGGG + Exonic
903670328 1:25031477-25031499 CTGGAGGGATGGAGGCTGGAGGG + Intergenic
903944373 1:26952338-26952360 GTGGAGGCCCAGATGCTGGGCGG + Exonic
904303871 1:29574330-29574352 CTGAAGGCCTCAGGGCTGGATGG + Intergenic
904542170 1:31240303-31240325 CTGGAGCCCTAGAGACAGGGTGG - Intergenic
904678380 1:32212373-32212395 CTGGGTGCCTAGAGGCCAGAGGG + Intronic
904824729 1:33266799-33266821 CTGGGGGCCCTGATGCTGGAGGG + Intronic
905203672 1:36330538-36330560 TCGGAGGCCTAGAGGCCGGAGGG - Intergenic
905320569 1:37113917-37113939 CTGGAAGCATAGATGCTGGGAGG + Intergenic
905805496 1:40874107-40874129 TTGGAAGCCCTGAGGCTGGAGGG + Intergenic
905906391 1:41621226-41621248 CTGGGGGCCAGGAGGCTGAAGGG - Intronic
906873755 1:49513418-49513440 ATGGAATCCTAGAGGGTGGAGGG - Intronic
907277300 1:53323946-53323968 CTGAATACCAAGAGGCTGGAAGG - Intronic
908714465 1:67054465-67054487 CTGGTGGCAGAGGGGCTGGAAGG + Intergenic
909697519 1:78484165-78484187 CTGGAGCCAGTGAGGCTGGATGG + Intronic
910279967 1:85488758-85488780 CTAGAGTCCTAGAGACTGAAAGG + Intronic
910368094 1:86487742-86487764 CAGTATGGCTAGAGGCTGGATGG - Intronic
911508543 1:98784122-98784144 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
914788424 1:150854470-150854492 CTGCAGGCCTTGAGCCTGGGAGG + Intronic
916213792 1:162379179-162379201 CTTCAGGACTAGAGGCTTGATGG - Intronic
916339745 1:163718682-163718704 ATGGACTCCTAGAGGATGGAGGG + Intergenic
916889556 1:169103145-169103167 CTGGAGGCAGACAGGCTGGCAGG - Intergenic
917024881 1:170631187-170631209 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
917060574 1:171033108-171033130 CTGGAGCCAGGGAGGCTGGATGG - Intronic
917808920 1:178638600-178638622 CTGGAGACCTAAAGGAAGGAAGG - Intergenic
917926076 1:179790152-179790174 CTCCAAGCCTAGAGACTGGAGGG + Intronic
918376855 1:183918075-183918097 GTGGAGGACTAGAGGCTGTCTGG + Intronic
918802266 1:188986820-188986842 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
919780415 1:201217310-201217332 CTGGAGGCCGACAGGATGGCTGG - Exonic
919921568 1:202169357-202169379 CATGAGGCCTCCAGGCTGGATGG - Intergenic
920169523 1:204062565-204062587 ATAGAGGCTTAGATGCTGGAAGG - Intergenic
920704514 1:208241947-208241969 GTGGTGGCCTGGAGGCTGAAGGG - Intronic
920754588 1:208717023-208717045 CCTGAGAGCTAGAGGCTGGAGGG + Intergenic
922500789 1:226095526-226095548 AGGGAGTCCTAGAGGGTGGAGGG + Intergenic
922924394 1:229335747-229335769 CTGGAAGGCTCCAGGCTGGAGGG - Intronic
923339644 1:232996445-232996467 CTGGAGGCCTGGGAGCTGCATGG + Intronic
924466609 1:244304246-244304268 CCGGAGGCAGAGAGTCTGGAGGG - Intergenic
1062790917 10:305861-305883 CTGGAGCCCAAGAGGTTTGAGGG - Intronic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1065060044 10:21890579-21890601 GTGGAGGCCTAGAGGCAAGCAGG + Intronic
1065602143 10:27379907-27379929 CTGGACTACTAGAGGGTGGAGGG - Intergenic
1065988051 10:30976652-30976674 CTTGAGCCCTAGAGATTGGAAGG + Intronic
1065998129 10:31078954-31078976 ATGGAGGCCTAGAGAAGGGAAGG - Intergenic
1066287563 10:33982779-33982801 CTGTAGGCCTCCAGGCTTGAGGG + Intergenic
1066430856 10:35349872-35349894 CTGGAATCCTAGAGCCTGTAAGG - Intronic
1067031079 10:42879155-42879177 CTGGAGGGGAAGAGGCTGAAGGG + Intergenic
1067160217 10:43819265-43819287 CTGGAGGCGGATAGGGTGGAGGG + Intergenic
1067704724 10:48598333-48598355 CTGGTGGCCTAAGGGCTGGGTGG + Intronic
1069918090 10:71799357-71799379 CAGGGGGCTTAGAGGCTGGCAGG - Intronic
1069986918 10:72290906-72290928 CTGGAGTCCAAGAGGCTGGTGGG + Intergenic
1070588128 10:77781466-77781488 TTGGAGGCCAAGATGCTGCATGG - Intergenic
1070811168 10:79298770-79298792 CTGGGCGCCTGGAGGCTGGGAGG + Intronic
1070975786 10:80604487-80604509 CAGGAGGGCCAGAGGCTGGGTGG + Intronic
1071059052 10:81548429-81548451 CTGGAGCCAGAGAGGCTGGATGG + Intergenic
1071134585 10:82438382-82438404 CTGGAGCCAGAAAGGCTGGAAGG - Intronic
1072316339 10:94206834-94206856 CTGGGGGCCTGGAGGCTTTATGG - Intronic
1072784279 10:98269304-98269326 CTGGAGTGCTAGACGCTGGAGGG + Intergenic
1073059736 10:100726275-100726297 CTGCAGGCCTGGAAGCTGGGAGG + Intergenic
1073156895 10:101354339-101354361 CTGGCGGCGGAGCGGCTGGAGGG + Intronic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1075405527 10:122193209-122193231 CTGGAGGCTTTGTGGCTGGTTGG + Intronic
1075574487 10:123568940-123568962 CTGGAGGCCAGGAGGAGGGAGGG + Intergenic
1076185114 10:128440674-128440696 CTGGAGGGAGGGAGGCTGGAAGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076378786 10:130011132-130011154 CCCCAGGCCTAGGGGCTGGAGGG - Intergenic
1076679587 10:132164872-132164894 CTGGAGGCCTGAAGGCTGGGCGG + Intronic
1077139180 11:1016070-1016092 CTGGAGGCTAGGTGGCTGGATGG + Exonic
1077401991 11:2363465-2363487 TGGGAGCCCCAGAGGCTGGAGGG - Intergenic
1077988692 11:7381895-7381917 CTGGAGTACCAGTGGCTGGAAGG - Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1079935267 11:26608780-26608802 CTGGAGCCAGGGAGGCTGGACGG - Intronic
1080164899 11:29224794-29224816 CTGGAGCCAAAGAGGCTGGATGG - Intergenic
1081460466 11:43268158-43268180 CTGGAAGGCTACAGCCTGGATGG + Intergenic
1081562624 11:44231855-44231877 CTGGAAGCCTAAAGGATAGAAGG - Intronic
1082128428 11:48457752-48457774 CTGGAGGCCTATGGGGTTGAGGG + Intergenic
1083305150 11:61758146-61758168 CTGCCGGCCTAGAGTATGGAGGG + Intronic
1083325277 11:61869910-61869932 CAGGAGGCCCAGCGGCTGGCTGG + Intergenic
1083326794 11:61877015-61877037 CTGGAGGCCTGGTGGGTGGGAGG + Intronic
1083475317 11:62911416-62911438 ATGGAGGCCTGGAGTCTGAAAGG - Intronic
1084207562 11:67604832-67604854 CTTGTGGCCTGGAGGCTGGCTGG + Exonic
1084484375 11:69439289-69439311 CTGGAGGCCTTGGGGGTGGAGGG - Intergenic
1084729540 11:71064581-71064603 CTGGAAGGAAAGAGGCTGGATGG + Intronic
1085066288 11:73498678-73498700 CTGGAGCCCGGGAGGCTGAATGG + Intronic
1085519642 11:77130523-77130545 CTGGAAGCCTTGAGCCTGGCTGG - Intronic
1086450143 11:86907539-86907561 CTAGAGCCCAAGAGGCTGCAGGG - Intronic
1087130377 11:94664565-94664587 CTGGAAGGCTAGGGGCTGGTAGG - Intergenic
1088697711 11:112382693-112382715 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
1088699322 11:112397939-112397961 CTGAAGTCCTAGAGCCTGGATGG - Intergenic
1089145585 11:116327598-116327620 CTGGAGGCCAAAAGACTGGTGGG - Intergenic
1090853899 11:130595135-130595157 CTGCAGACCTATAGGCTAGATGG - Intergenic
1090884266 11:130862115-130862137 CCGGTGGCCTTGAGGCCGGAAGG - Intergenic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1091745449 12:2989180-2989202 TGGGAGGCCGAGAGGCAGGAGGG - Intronic
1092628605 12:10354793-10354815 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1092727577 12:11500251-11500273 CTGGACGCCAAGAGACAGGAAGG + Intronic
1093194342 12:16112306-16112328 CTGGAGCCTGAGAGGCTGGGAGG + Intergenic
1093522489 12:20067063-20067085 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
1093808445 12:23464550-23464572 CTGGAGGCAGGGAGGCTGGATGG + Intergenic
1093957014 12:25232003-25232025 CTGTAGGACTAGAGGCTGGGGGG - Intronic
1094054551 12:26256009-26256031 CTGGAGCCAGGGAGGCTGGATGG + Intronic
1095990792 12:48033176-48033198 CTGATAGCATAGAGGCTGGAAGG + Intergenic
1096836721 12:54355831-54355853 CCGGATGCCGGGAGGCTGGAAGG + Intergenic
1096841181 12:54379868-54379890 CTGGGGGACCAGAGGCTGTAGGG + Intronic
1097178335 12:57156467-57156489 CTGGAGGCTGAGTGGGTGGATGG - Intronic
1097357743 12:58621041-58621063 CTAGAGGAACAGAGGCTGGAAGG - Intronic
1100581051 12:95940903-95940925 CTGGAGGTCAAGAGGAAGGAAGG + Intronic
1100724494 12:97394703-97394725 CTGGAGGTTTTGAGGCTGAAGGG - Intergenic
1101020276 12:100546745-100546767 CTGGAGGGTTAGTGGATGGAGGG - Intronic
1101066532 12:101027521-101027543 CTGGAGCCAGGGAGGCTGGATGG + Intronic
1102226928 12:111235367-111235389 CTGGAGGTGTACAGGCAGGAGGG + Intronic
1103449187 12:121016258-121016280 CTGGAGCCTGAGAGGATGGATGG - Intronic
1105330468 13:19411098-19411120 CTGCAGGCCTAGAGAATGGGAGG + Intergenic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1106068915 13:26387730-26387752 GTGGAGACCTAGAAGATGGAAGG - Intronic
1106104350 13:26721389-26721411 CAGGAGGCTTAGAGGCAGGAGGG + Intergenic
1106307106 13:28522453-28522475 CTGGCAGGATAGAGGCTGGAAGG + Intergenic
1108815656 13:54287148-54287170 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1108957777 13:56182698-56182720 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
1109307935 13:60661557-60661579 CTGAAGCCCAGGAGGCTGGATGG - Intergenic
1110717967 13:78729689-78729711 CTGGAGTAATAGAAGCTGGAGGG - Intergenic
1110790507 13:79582018-79582040 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1111647155 13:91045947-91045969 CTGGAGGCCTAGATAATAGAGGG + Intergenic
1113665915 13:112142135-112142157 TTGGAGGCTGCGAGGCTGGATGG - Intergenic
1115292385 14:31786926-31786948 CTGGAGCCAGAGAGGCTGGTTGG + Intronic
1116633959 14:47369535-47369557 CTGGAGGACTGCAGGGTGGAGGG - Intronic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117699086 14:58395865-58395887 CAGGAGGCCCCGAGGCCGGATGG + Intergenic
1117727848 14:58691985-58692007 CAGAAGGCCTAGACCCTGGAAGG + Intergenic
1118867703 14:69716363-69716385 CTGCAGGCCAAGAGCCTAGAAGG - Intergenic
1119152306 14:72372906-72372928 CTTGAGGCTAAGAGGCTGCATGG + Intronic
1119483728 14:74975222-74975244 CTGAAGAGATAGAGGCTGGAGGG + Intergenic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120681741 14:87488290-87488312 CTGGAGGCCGAGAGGAGTGAGGG - Intergenic
1120736388 14:88057625-88057647 CTGCAGTCCTATAGGCTGTATGG + Intergenic
1120852420 14:89183528-89183550 CAGGGGGCCTAGAGGCAGAAAGG + Intronic
1121627787 14:95399328-95399350 CAGGAGCCCTGTAGGCTGGAGGG + Intergenic
1121739729 14:96242994-96243016 CTGGAGAACTAGAACCTGGAGGG + Exonic
1121739747 14:96243099-96243121 CTGGAGGACTAGAACCTGGAGGG + Exonic
1121739753 14:96243129-96243151 CTGGAGAGCTAGAACCTGGAGGG + Exonic
1121739757 14:96243144-96243166 CTGGAGGGCTAGAACCTGGAGGG + Exonic
1121739762 14:96243174-96243196 CTGGAGAGCTAGAACCTGGAGGG + Exonic
1121739767 14:96243204-96243226 CTGGAGAGCTAGAACCTGGAGGG + Exonic
1121739782 14:96243280-96243302 CTGGAGAGCTAGAACCTGGAGGG + Exonic
1121739786 14:96243295-96243317 CTGGAGGGCTAGAACCTGGAGGG + Exonic
1121739788 14:96243310-96243332 CTGGAGGGCTAGAACCTAGAAGG + Exonic
1121739799 14:96243356-96243378 CTGGAGAGCTAGAACCTGGAGGG + Exonic
1121739803 14:96243371-96243393 CTGGAGGGCTAGAACCTGGAGGG + Exonic
1121739805 14:96243386-96243408 CTGGAGGGCTAGAACCTAGAAGG + Exonic
1121739813 14:96243417-96243439 CTGGAGGGCTAGAACCTGGCAGG + Exonic
1121739826 14:96243478-96243500 CTGGAGGGCTAGAACCTGGAAGG + Exonic
1121905706 14:97741100-97741122 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1122267721 14:100554458-100554480 CTGGCTGCCTACAGCCTGGAAGG - Intronic
1122320580 14:100852886-100852908 CTGGTGCCCTGGAGGCTGGGTGG + Intergenic
1122414417 14:101542030-101542052 CTGGAGGCTGAGCGGGTGGAGGG - Intergenic
1122451100 14:101808210-101808232 GTGAAGGCTTAGAGGCAGGAGGG + Intronic
1122533157 14:102443163-102443185 ATGGAGGCCCAAAGGCTGCAGGG - Intronic
1122549197 14:102540586-102540608 CTGGAGGCTTCGGGCCTGGAAGG + Intergenic
1123060421 14:105591883-105591905 CTGGATGCTGAGGGGCTGGAGGG + Intergenic
1123084899 14:105712854-105712876 CTGGATGCTGAGGGGCTGGAGGG + Intergenic
1124700939 15:31911293-31911315 GTGGACTCCTAGAGGCAGGAGGG + Intergenic
1125462559 15:39920532-39920554 CTGTTGGCTTCGAGGCTGGATGG + Exonic
1125831060 15:42717501-42717523 CTGTAGCCCTAGAGACTGGGAGG + Intronic
1127564927 15:60177930-60177952 CTGGGGGACTAGCGGCTGGCAGG + Intergenic
1127854746 15:62945220-62945242 CTGAAGGGCAGGAGGCTGGAAGG + Intergenic
1128162354 15:65431902-65431924 ATGGAGGCAGAGGGGCTGGAGGG + Intergenic
1129738416 15:77978241-77978263 CTGGAGGCCAGGAGGCAGGGAGG - Intergenic
1129847657 15:78775368-78775390 CTGGAGGCCAGGAGGCAGGGAGG + Intronic
1130147244 15:81283238-81283260 CGGGAGGCAGAGAAGCTGGAGGG + Intronic
1130254246 15:82318541-82318563 CTGGAGGCCAGGAGGCAGGGAGG - Intergenic
1130600723 15:85271429-85271451 CTGGAGGCCAGGAGGCAGGGAGG + Intergenic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1132248347 15:100315146-100315168 CTGGAGGCCGGGAGGCAGGCAGG + Intronic
1132279181 15:100598001-100598023 ATCAAGGCCCAGAGGCTGGAAGG - Intronic
1132406061 15:101542508-101542530 CTGGAGGCCTGGAGGCTTAGAGG - Intergenic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132877272 16:2145623-2145645 CTGTAGGCCTGGAGGCAGGGAGG - Intronic
1133718196 16:8469515-8469537 CTGGAGGCAGAGAGGCAGGTGGG - Intergenic
1134627277 16:15731248-15731270 CTGAAGGCCTATAGGATGGGTGG - Intronic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1135488997 16:22891717-22891739 CTGAAGGGCTAAGGGCTGGAAGG - Intronic
1135723346 16:24835379-24835401 ATGGAGGATTAGGGGCTGGAGGG - Intergenic
1136139790 16:28281377-28281399 GTGGAGGCCTGGGTGCTGGAGGG - Intergenic
1138443140 16:57047045-57047067 CTGGAGGCCTAGAGAGAGGTGGG - Intronic
1139851445 16:69953184-69953206 CTGGAGCCCTAGAGGCCCGGAGG - Intronic
1139880422 16:70176096-70176118 CTGGAGCCCTAGAGGCCCGGAGG - Intronic
1140061628 16:71575607-71575629 CTGAAGGCCTTGAGTCTGGCAGG - Intronic
1140372088 16:74419421-74419443 CTGGAGCCCTAGAGGCCCGGAGG + Intronic
1140719613 16:77759394-77759416 ATGGAGGCCTAGAGGATTAATGG - Intergenic
1141374648 16:83519085-83519107 CTGGAAGCTTAGAATCTGGAAGG + Intronic
1142147809 16:88499827-88499849 CTGGACCCGGAGAGGCTGGATGG - Intronic
1142354161 16:89594261-89594283 CTGGAGGCCGAGAGCCAGGCTGG + Intronic
1142356354 16:89603766-89603788 GGGGAGCCCTGGAGGCTGGAGGG + Intergenic
1142777764 17:2154651-2154673 CTAGAGGCCTGCTGGCTGGAAGG + Intronic
1142809297 17:2387702-2387724 CTGGAGGCGTAGATGCTCGTGGG + Intronic
1143084773 17:4407364-4407386 TTGGAGGCCTAGTGGGAGGATGG + Intergenic
1143782161 17:9234564-9234586 CTGGAACCCTGGAGGCTGAATGG - Intronic
1144083034 17:11781896-11781918 CTGAAGGCACTGAGGCTGGAAGG - Intronic
1144729886 17:17520170-17520192 GTGGATGCCTGGGGGCTGGAGGG + Intronic
1145126536 17:20304718-20304740 CTGGAGGGCTTGGGGCTGTAGGG + Intronic
1145819848 17:27823881-27823903 CTGGGGGCCTCCTGGCTGGAGGG + Intronic
1146570256 17:33946318-33946340 CTGGGGGGCCCGAGGCTGGAGGG + Intronic
1146887534 17:36482704-36482726 CGGGAGGCCAGGAGGGTGGAAGG + Intergenic
1147043411 17:37735298-37735320 CTGGAGGCATATAGCCTGGAGGG - Intronic
1147740301 17:42667615-42667637 CTGGAATCCCTGAGGCTGGAGGG - Intergenic
1147805102 17:43125622-43125644 CTGGAAGAGTAGAGGCTAGAGGG - Intergenic
1147811105 17:43170439-43170461 CTGGAAGCGTAGAGGCGAGAGGG - Intergenic
1148027784 17:44600335-44600357 CTGGCTTCCCAGAGGCTGGAGGG + Intergenic
1149974865 17:61255363-61255385 CTGGAGATCTGGAGGCTGTAAGG - Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1150258899 17:63772844-63772866 CAGGAGTCATAGAGGCTGGGTGG - Intronic
1150807182 17:68328747-68328769 CTACATGCCTAGATGCTGGAGGG + Intronic
1150823115 17:68451524-68451546 GTGGAGCCCTAGGGTCTGGAGGG - Intronic
1151194341 17:72421026-72421048 CTGGAAGCCCAGAGTCTGGCTGG + Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151538572 17:74752390-74752412 GTGAAGGCTTAGAGGCTAGAGGG - Intronic
1152309579 17:79541660-79541682 CTTGAGGCCTAGCGGTTTGATGG - Intergenic
1152450585 17:80376793-80376815 CAGGAGGCCTAGAGGAAGAAAGG - Intronic
1152451259 17:80381924-80381946 CTGCTTGCCCAGAGGCTGGAAGG + Intronic
1152464484 17:80458157-80458179 GGGGAGGCCTAGAGGCTGTCTGG - Intergenic
1152795460 17:82304162-82304184 CTGGAGACCGGGAGGCTCGAGGG + Intergenic
1153754080 18:8262498-8262520 CTGGAGGCCTGGAGGATGGCAGG - Intronic
1154411714 18:14145366-14145388 CTGGAGGCCTAGAGGCCCTCAGG - Intergenic
1155087290 18:22470980-22471002 CTGGAGCCCCAGAAGCTGGCTGG + Intergenic
1156036490 18:32771658-32771680 CGGGAGGCCTGGAGGCCGGGAGG + Intronic
1156294026 18:35773873-35773895 CTGGGGCCCCTGAGGCTGGAAGG - Intergenic
1157429249 18:47610989-47611011 CTGGAGGCCAAGAAGCTGACTGG - Intergenic
1157767776 18:50314125-50314147 CAGGAGACCTAGAGACTGGGAGG + Intergenic
1158215619 18:55097700-55097722 CAGGGGGCCTGGAGGCTGGACGG - Intergenic
1158566357 18:58557200-58557222 TTGAGGGCCGAGAGGCTGGAGGG + Intronic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160416121 18:78712216-78712238 CTGGAAAGCTGGAGGCTGGAAGG - Intergenic
1160568881 18:79803300-79803322 CTGGAGGCCTAGAGGTGAGGGGG - Intergenic
1160712573 19:559253-559275 CTGGGGGCCGAGGGCCTGGACGG - Intergenic
1160754585 19:750909-750931 CTGGAGGCCCTGGGGGTGGAGGG + Intergenic
1160774050 19:846657-846679 CTGGAGTCCTGGATTCTGGAAGG - Intronic
1161902027 19:7126126-7126148 CTGGAGCCTAAGAGGCTAGATGG + Intronic
1162015574 19:7844929-7844951 CTGAGGGCCTACAGGTTGGATGG - Intronic
1162022252 19:7873285-7873307 CTGGGGGCCTGGAGGCTGCGGGG + Exonic
1162023287 19:7878806-7878828 CTGCAGGCCTGGAGCCTGTAGGG - Intergenic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163103059 19:15109139-15109161 CTTGATGCCTCGGGGCTGGAGGG - Exonic
1163320937 19:16574271-16574293 CTGTAGTCTTACAGGCTGGAAGG + Intronic
1163360087 19:16840435-16840457 CTGGAGGCCTGGAGGCCAGGAGG - Intronic
1163403410 19:17108088-17108110 GTGCAGGCGTGGAGGCTGGAGGG - Intronic
1163448174 19:17359947-17359969 CCAAAGGCCTGGAGGCTGGACGG - Intronic
1163492427 19:17624744-17624766 CTTGGTGCCTAGAGGCTGGGGGG - Intronic
1163587571 19:18172512-18172534 CTGAAGTCCCAGTGGCTGGATGG - Intronic
1164727608 19:30476827-30476849 CTGGAGTCCAAGAGGCAGGCAGG - Intronic
1164853078 19:31500655-31500677 CAGGAGGCCTGGGGCCTGGAGGG + Intergenic
1165106052 19:33470213-33470235 CTGGAGGCCTAGAGGCTGGAGGG - Intronic
1165353913 19:35292127-35292149 GTGGGGGCCTAGACCCTGGAAGG + Exonic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165896253 19:39142943-39142965 CTGGAATCCGAGTGGCTGGAAGG - Intronic
1166425226 19:42671452-42671474 CTGAAGCCCTATAAGCTGGAGGG - Intronic
1166425319 19:42672945-42672967 CTGAAGCCCTATAAGCTGGAGGG + Intronic
1166916623 19:46199710-46199732 GTAGAGGCCTAGACGCTGGTGGG - Intergenic
1167348730 19:48962445-48962467 CTGGCGACTGAGAGGCTGGAGGG + Intergenic
1167429437 19:49446156-49446178 CTGGAGGCCAGGAGGCTTCAGGG + Intergenic
1167483641 19:49747547-49747569 TAGGAGGCCTGGAGCCTGGATGG - Intronic
1167491965 19:49798289-49798311 CTCCTGGCCTAGAGGCTGGGAGG - Intronic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
1168180871 19:54662378-54662400 CTGGTGGCTTTGAGGTTGGAGGG + Intronic
925668943 2:6290985-6291007 CAGGAGACATATAGGCTGGAAGG + Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926206167 2:10835512-10835534 CTGGAGGCCTGAAGGCAGGTGGG + Intronic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
927589444 2:24340572-24340594 CTGGTGGGACAGAGGCTGGAAGG - Intronic
927625103 2:24707871-24707893 CTGGAGGCCCAGAGCCAGGTGGG + Exonic
928744318 2:34393891-34393913 CTTGAGGTATAGATGCTGGATGG + Intergenic
928757585 2:34545503-34545525 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
929097266 2:38275380-38275402 CTGGAGGGCTGGCGGCTGCAGGG - Intergenic
929804186 2:45130182-45130204 CTTTTGGCCTAGATGCTGGAAGG - Intergenic
931218840 2:60270837-60270859 AAGGAGGGATAGAGGCTGGAGGG + Intergenic
932699068 2:73981292-73981314 CTGGATGCCTGGAGCATGGAGGG - Intergenic
932826726 2:74948017-74948039 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
932874196 2:75433343-75433365 CTGGAGCCAGGGAGGCTGGAAGG + Intergenic
933665003 2:84957770-84957792 CTGGATGCTTAGAGGAAGGAAGG - Intergenic
933842948 2:86302244-86302266 TTGCAGCCCTAGAGGCTGGGAGG - Intronic
934519374 2:95010355-95010377 CTGGAAGCCCGGAGGCTGGGTGG + Intergenic
934621117 2:95807787-95807809 GTGAAGGCCCACAGGCTGGAGGG - Intergenic
934812329 2:97291030-97291052 ATGAAGGCTCAGAGGCTGGAGGG + Intergenic
934825365 2:97416893-97416915 ATGAAGGCTCAGAGGCTGGAGGG - Intergenic
934884719 2:98014474-98014496 CTGGTGGGCTAGGGGCTGGTGGG - Intergenic
936069253 2:109354289-109354311 CTGCAGGCCCAGAGGCTGAAGGG + Intronic
936462475 2:112723228-112723250 CTGGAGGCCTGAAGGCTGCCCGG - Intronic
937931498 2:127208665-127208687 CTGGAGCCAGGGAGGCTGGATGG + Intronic
939100788 2:137892312-137892334 CTGCAGGCCCAGAGGATGCAGGG - Intergenic
939106026 2:137949836-137949858 CTGGAGGACTTGGGGCTGGCAGG + Intergenic
939192405 2:138931840-138931862 CTGGAGCCAGAAAGGCTGGATGG + Intergenic
941088564 2:161147161-161147183 CTGGAGCCAGGGAGGCTGGATGG - Intronic
941362705 2:164572248-164572270 CTTGAAACCTAGAGGTTGGATGG - Intronic
941694382 2:168535049-168535071 CTGGAGCCAGGGAGGCTGGACGG - Intronic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
942526894 2:176862260-176862282 CTGGAGGACTGGAGACTGGTTGG + Intergenic
942924065 2:181411393-181411415 CTGGAGCCACGGAGGCTGGATGG + Intergenic
944366665 2:198928954-198928976 CTGGAGCCCATGAGGCAGGAGGG - Intergenic
946061983 2:216950372-216950394 CTGGAGGGGGACAGGCTGGAGGG + Intergenic
946555270 2:220849377-220849399 CTACAGGGCTAGAGGGTGGAGGG + Intergenic
946843510 2:223839468-223839490 CAGGAGGCCTAGAGGTGGGCAGG + Intergenic
947480103 2:230491499-230491521 CTGGAGCCAGGGAGGCTGGATGG - Intronic
948051608 2:234983087-234983109 GTGCAGGCCTAGGGGCTGGGTGG + Intronic
948238496 2:236408773-236408795 CTGGAGGCCTTGAGGTTTGAGGG + Intronic
948610105 2:239161645-239161667 CTGGGGACCTTCAGGCTGGAGGG - Intronic
948988824 2:241541637-241541659 CTGGAGAGCGAGATGCTGGACGG - Intergenic
1168956948 20:1841102-1841124 CTGGATGCCTATAGGAGGGAGGG + Intergenic
1169106304 20:2998139-2998161 CTGGTAGCCAGGAGGCTGGAGGG - Intronic
1169400496 20:5275282-5275304 CAGGAGGCCAGGAGGCTGGGAGG - Intergenic
1170840187 20:19918998-19919020 CTGAAGGCTGGGAGGCTGGAAGG + Intronic
1170883461 20:20317851-20317873 CTGGAGGCCGTGAGGCTGCTGGG + Intronic
1171163126 20:22946634-22946656 CTGGAGTCACAGAGGCTGGCTGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172150392 20:32786441-32786463 CTGGAGGCCTGGGGTCTGGCGGG - Intronic
1172613625 20:36268925-36268947 ATGGAGGCCTGGAGGAAGGAAGG + Intronic
1172829729 20:37823428-37823450 CTGAAGCCCTGGAGCCTGGAGGG + Intronic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1173411752 20:42817683-42817705 CTGGAGCCAGGGAGGCTGGAGGG + Intronic
1173861610 20:46287526-46287548 GTAGAGGCCCTGAGGCTGGATGG + Intronic
1173916047 20:46709540-46709562 CCCGAGGCCTGGAGGCGGGACGG - Exonic
1174309010 20:49635906-49635928 CTGAAGGCCAAGAGGCTCCAAGG + Exonic
1174401445 20:50278103-50278125 CTTGAGGCCTGGAGGGTGGAGGG + Intergenic
1174453010 20:50631247-50631269 CTGGAGCCCTTGAGGATGGGGGG - Intronic
1174564878 20:51457366-51457388 CAGGAGGCCTGGGGACTGGAAGG + Intronic
1175297119 20:57916105-57916127 CTGCAGTCCTAGAGAATGGAGGG - Intergenic
1175529212 20:59662679-59662701 CTGGAGGAAAAGGGGCTGGAGGG + Intronic
1175818576 20:61896362-61896384 CAGGAGGCCCAGATGCGGGACGG - Intronic
1175934689 20:62509444-62509466 CTGGAGGGGTGGAGGATGGAGGG - Intergenic
1175934700 20:62509474-62509496 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934997 20:62510276-62510298 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175935195 20:62510815-62510837 GTGGAGGGGTAGAGGATGGAAGG - Intergenic
1175965841 20:62659864-62659886 CTGGATGCCCAGAGCTTGGATGG + Intronic
1177511386 21:22091872-22091894 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1177878943 21:26669420-26669442 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1177926796 21:27226953-27226975 TTAGAGGCCTAGACCCTGGAAGG - Intergenic
1177956596 21:27606231-27606253 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1178510665 21:33202402-33202424 CAGGTGGCATAGGGGCTGGAGGG - Intergenic
1178713414 21:34941208-34941230 CTGGAGGCACAGAGGCTAAAGGG - Intronic
1179288088 21:39995278-39995300 CTGGAGTCCAAGTGGCTGGTTGG + Intergenic
1179898834 21:44378425-44378447 CTTGGGGGCTTGAGGCTGGATGG + Intronic
1180564421 22:16650740-16650762 CTGCAGGCCTAGAGAATGGGAGG - Intergenic
1180715135 22:17866409-17866431 GTGGAGGCGTGGAGGCTGCAGGG + Intronic
1180937303 22:19634194-19634216 TTGCAGTCCTGGAGGCTGGAAGG - Intergenic
1183013017 22:34962884-34962906 GTGGAGGCCCAGAGACGGGAGGG - Intergenic
1183355405 22:37356202-37356224 CTGAAGGACTAGAGGCTGCTGGG + Intergenic
1183671633 22:39276285-39276307 CTGGAGGGCCAGCGACTGGAGGG + Intergenic
1183716985 22:39539130-39539152 ATGGAAGCCTAGGGGCTGAAAGG - Intergenic
1184103823 22:42355758-42355780 CTGGAGGCCTAGAGACCTGGAGG + Intergenic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184361838 22:44023845-44023867 CGGGAAGCTTAGAGGATGGAGGG - Intronic
1184391605 22:44206469-44206491 CTGGAGGGCCCGAGGCTGCAGGG + Exonic
1184967918 22:47995217-47995239 CTGGAGCCCCAGCAGCTGGAAGG - Intergenic
1185103735 22:48855643-48855665 CCTGAGGCCTATTGGCTGGAGGG + Intergenic
1185134285 22:49060308-49060330 CAGGAGGGCTGGAGGGTGGAAGG - Intergenic
1185185917 22:49400237-49400259 CGGGAGGGCTGGAGGCAGGAGGG + Intergenic
1185217495 22:49609788-49609810 CAAGGGGCCTAAAGGCTGGAGGG + Intronic
1185413984 22:50699859-50699881 CTGGTGGCTTAGAGTGTGGAAGG + Intergenic
949119952 3:373454-373476 CTGGAGCCAGGGAGGCTGGATGG - Intronic
949693500 3:6667608-6667630 CTGGAGCCAGAGAGGCCGGATGG - Intergenic
949905088 3:8852480-8852502 CTGGAGCCCTGGATTCTGGAGGG + Intronic
950364720 3:12474888-12474910 CTGGGGGCTGAGAGGCTGCAGGG - Intergenic
950364723 3:12474896-12474918 CTGGAGGCCTGGGGGCTGAGAGG - Intergenic
950588566 3:13917042-13917064 TTGGAGGCCTAGAGGGTTGAGGG + Intergenic
950729712 3:14947348-14947370 GTCGGGGCCTAGAGGCTGAAGGG - Intergenic
950738536 3:15031320-15031342 CTGGAGACCTAGAGACTGAGAGG - Intronic
950831275 3:15878437-15878459 CTGGAGGCCAAGATGCGGCATGG + Intergenic
952174261 3:30844348-30844370 CTGGAAGCCTGGTGGGTGGAGGG - Intronic
952850656 3:37725819-37725841 CTGGAGGCTTAGAGAAAGGATGG + Intronic
952983270 3:38755669-38755691 CTGGAGGCATAGAGCCTAAAAGG - Intronic
953414219 3:42706177-42706199 CTGGTGGCCGACTGGCTGGATGG + Intronic
953983434 3:47424270-47424292 CTGGATGGCTAGAGACAGGATGG - Intronic
954104589 3:48403146-48403168 CTGAAGGCCTCAAGGCTGAAGGG + Intergenic
955391393 3:58524773-58524795 CTGAGGGCCTCGAGGCAGGACGG - Intronic
955420748 3:58734685-58734707 ATGGAGGCCAAGAGACAGGAAGG - Intronic
955643348 3:61110223-61110245 ATGGAGGCCTGTGGGCTGGAAGG - Intronic
955769266 3:62372623-62372645 CTCGTAGCCTAGGGGCTGGAGGG + Exonic
956746197 3:72312679-72312701 TTGGAGGCCTGGAGGATGGGAGG + Intergenic
956892124 3:73623637-73623659 CTGGAATCCTAGAGGATGCACGG + Intronic
958516339 3:95121068-95121090 CTGGAGCCCTGGAGGCATGAGGG + Intergenic
959031100 3:101300234-101300256 CTGGAGCCAGGGAGGCTGGACGG - Intronic
959667983 3:108942836-108942858 CTGGAGGCATGGAGGAGGGAAGG - Intronic
960233436 3:115254934-115254956 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
960413728 3:117359034-117359056 CTGGAGCCAGAGGGGCTGGATGG + Intergenic
960565323 3:119126184-119126206 CTGGAGCCAGGGAGGCTGGACGG + Intronic
960977090 3:123186016-123186038 CGGGAGGCTGAGAGGCAGGAGGG - Intronic
960990043 3:123304322-123304344 CTGGAGCCTTGCAGGCTGGAAGG - Intronic
961327951 3:126121237-126121259 CTGGAGGCTACGAGTCTGGATGG - Intronic
961434331 3:126906277-126906299 CTGGAGGCCTGGAGGCCTGGAGG - Intronic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
961824770 3:129593233-129593255 CTGGAGGCCTGGGAGCTGGCAGG - Intronic
962765659 3:138560381-138560403 CTGGTGGCATAGACACTGGAGGG - Intronic
962849544 3:139297833-139297855 CAGGAAGCCTAGAGGCAGGGTGG + Intronic
963461254 3:145617318-145617340 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
963898616 3:150712155-150712177 CTGGTGGCCTAGTCACTGGAGGG - Intergenic
964387283 3:156161449-156161471 CTGGAGGGTTGGGGGCTGGATGG - Intronic
964831208 3:160886017-160886039 CTGGAGCCAGTGAGGCTGGATGG + Intronic
965263326 3:166510762-166510784 CTGGAGTCAGGGAGGCTGGATGG + Intergenic
966539640 3:181075193-181075215 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
968019239 3:195369423-195369445 CTGAAGCCCTTGAGGGTGGAGGG - Intronic
968094815 3:195921361-195921383 CGGGAGGCTTAGAGGCCCGAGGG - Intergenic
968859426 4:3154645-3154667 CTGGAAGCCTGGAGGCTGTAGGG - Intronic
969251955 4:5973897-5973919 CTGGAGGGCTGGGGGCCGGAGGG + Intronic
969705556 4:8789369-8789391 ATGGAGGCCTGCAGGCTGGGAGG + Intergenic
969705565 4:8789400-8789422 ATGGAGGCCTGAAGGCTGGGAGG + Intergenic
969705584 4:8789462-8789484 ATGGAGGCCTACAGGCCGGGAGG + Intergenic
970557926 4:17254228-17254250 TTGGATGCCAAGAGACTGGAAGG - Intergenic
970580717 4:17471732-17471754 ATGGAAGCCTAGAGGCTGAGGGG + Intronic
971978792 4:33726706-33726728 CTGGAGGTCTAGTGTCTGGGAGG - Intergenic
972284891 4:37638621-37638643 CTGGGGGCCTAGAGAAAGGAGGG + Intronic
974181223 4:58386720-58386742 CTGGAGTCAGGGAGGCTGGATGG - Intergenic
978313231 4:107409309-107409331 CTGGAGGCATAGGCACTGGAGGG - Intergenic
978903852 4:113983615-113983637 CTGGATGCCCAGAGGTTGGAGGG + Intergenic
979758870 4:124374636-124374658 CTGGAGGCCTCCGGGCTGGCAGG + Intergenic
979775428 4:124583373-124583395 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
980184644 4:129446401-129446423 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
980990283 4:139733649-139733671 CTGAAGACCTACAGGCAGGAAGG + Intronic
981590752 4:146357809-146357831 CTTGAAGCTGAGAGGCTGGAAGG + Intronic
981618738 4:146670058-146670080 CTTGAGGTCAAGAGACTGGAAGG + Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
983453012 4:167930331-167930353 CTGGAATGCTAGAGCCTGGAAGG + Intergenic
983602805 4:169549090-169549112 CTGGTGGCATAGGGACTGGAGGG + Intronic
984335001 4:178379265-178379287 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
987216118 5:15739131-15739153 GTGGATGCCAAGATGCTGGATGG - Intronic
987224706 5:15828038-15828060 CTGAATGCCTAAAGCCTGGATGG - Intronic
988371254 5:30370942-30370964 GTGAAGGCCCAGAGGCTGGGAGG - Intergenic
989676693 5:43981568-43981590 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
990139093 5:52682518-52682540 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
996342153 5:122451047-122451069 TTGGAGGCCTTGATGCTGAAAGG - Exonic
996877358 5:128253992-128254014 CTGGAGGTCTATAGACGGGAGGG + Intergenic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
998292284 5:140926874-140926896 GTGGACGCCTAGAGGGAGGATGG + Exonic
999153345 5:149441372-149441394 CTGGAGGCCACCAGGGTGGAGGG + Intergenic
1000834317 5:166135422-166135444 CTGGAGGCCCAGATGCTGGGAGG + Intergenic
1001304251 5:170560202-170560224 CTGGAAGCCCAGAGGCTGAGAGG - Intronic
1001584836 5:172826823-172826845 CTGGAGAGGTAGGGGCTGGATGG - Intergenic
1001702037 5:173713737-173713759 CTGCAGTCCCACAGGCTGGATGG - Intergenic
1001965776 5:175908860-175908882 GCAGAGGCCTGGAGGCTGGAAGG - Intergenic
1001977188 5:176009768-176009790 CTGCAGGTCTTCAGGCTGGAGGG - Intronic
1002240237 5:177834012-177834034 CTGCAGGTCTTCAGGCTGGAGGG + Intergenic
1002251169 5:177930336-177930358 GCAGAGGCCTGGAGGCTGGAAGG + Intergenic
1003770771 6:9297137-9297159 CTTGAGGCCTAGAAACTGCAGGG + Intergenic
1004731890 6:18366704-18366726 GTGGAGGCCGAGATGGTGGACGG - Intergenic
1004732131 6:18368224-18368246 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1005121049 6:22389807-22389829 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1006093668 6:31642910-31642932 CTGCAGGGCCAGGGGCTGGAGGG - Exonic
1006095198 6:31651977-31651999 CTGGAGGACGAGAGGTGGGAGGG + Intronic
1006096474 6:31659618-31659640 CTGGGAGACTGGAGGCTGGAGGG - Exonic
1006101686 6:31689627-31689649 CTGGAAGCCTAGGCGGTGGATGG + Exonic
1006327388 6:33364911-33364933 CTGCAGGCCTGGAGCCTGTAGGG - Intergenic
1006458478 6:34144919-34144941 CCGGAGCCCTAGGGGCCGGAGGG - Intronic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1007458176 6:41996995-41997017 GTGCAGGCCTAGTTGCTGGAGGG - Intronic
1007473419 6:42104885-42104907 CTGGCGGCCCAGATACTGGAGGG + Exonic
1007619881 6:43205436-43205458 CTGGAGGCATAGGGGATGGGAGG + Intronic
1007703205 6:43776212-43776234 TTGGAGGCCTAGAGAGGGGAGGG + Intronic
1008244254 6:49150798-49150820 CTGGAGCCAAGGAGGCTGGAAGG - Intergenic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1008773663 6:55009224-55009246 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1010483220 6:76379301-76379323 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1010931757 6:81812343-81812365 CTGGAGGCATAGATGATGTAGGG - Intergenic
1010945607 6:81970204-81970226 CTGGAGCCAGGGAGGCTGGAGGG + Intergenic
1011753548 6:90476686-90476708 CTGGCACCCTAGAGGCAGGAGGG - Intergenic
1014046654 6:116896622-116896644 CTTGAGCCCTAGAGGCTCGGAGG + Intronic
1015358184 6:132305176-132305198 CTGGAGCCAGAGAGGCTGGATGG + Intronic
1015660190 6:135566408-135566430 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1015791359 6:136967569-136967591 CTGGAGATCTCCAGGCTGGATGG - Intergenic
1016940675 6:149480920-149480942 CAGGTGGCCAAGAGCCTGGAGGG - Intronic
1017744811 6:157436832-157436854 AAGGAGGCCCAGATGCTGGAGGG + Intronic
1017760315 6:157563151-157563173 CTACAAGCCTGGAGGCTGGAGGG + Intronic
1018258741 6:161948982-161949004 GGGGAGGCAGAGAGGCTGGAGGG + Intronic
1018800238 6:167216590-167216612 ATCAAGGCCTGGAGGCTGGAAGG - Intergenic
1018812861 6:167309916-167309938 ATCAAGGCCTGGAGGCTGGAAGG + Intronic
1018972208 6:168537617-168537639 CAGGAGGCCGAGTGGCTGGTTGG + Intronic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019070335 6:169340423-169340445 CTGGAGGCCTCGAAGCAGCAGGG - Intergenic
1019188793 6:170238160-170238182 CTGGAAGCCTGGAGGCTGGGAGG - Intergenic
1019345027 7:525445-525467 CTGGAGGCCTCCATGCTGTAAGG - Intergenic
1019429494 7:992189-992211 CTGGAGACCTAGAGGCGGGGGGG - Intergenic
1022170039 7:27817967-27817989 CAGGAGGCCAAAAGGCAGGAGGG - Intronic
1022236540 7:28467129-28467151 TTGGAGGGCTAAAGGGTGGAAGG - Intronic
1023207174 7:37763572-37763594 CTGGAGCCAAGGAGGCTGGACGG + Intronic
1023881448 7:44323837-44323859 CTGGAGGCCAAGAGGACAGACGG + Intronic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1025709407 7:63893063-63893085 CTGAGGTCCTGGAGGCTGGAGGG + Intergenic
1026057251 7:66995466-66995488 CTGGTGGCCTTCAGGCTGGACGG - Exonic
1026217841 7:68365247-68365269 CTGGGAGGCTAGAGGATGGAGGG + Intergenic
1026590162 7:71687441-71687463 CTGGAAGCCAAGAGGCTGCTGGG - Intronic
1026720863 7:72829585-72829607 CTGGTGGCCTTCAGGCTGGACGG + Intergenic
1028974265 7:96894027-96894049 TGGGAGACCTAGAGGCAGGATGG - Intergenic
1029055135 7:97733157-97733179 TTGGAGGGCCGGAGGCTGGAGGG + Intronic
1029318571 7:99736746-99736768 CTGGAGGCTTAGGGGCCAGAGGG - Intergenic
1029323500 7:99785732-99785754 CTGGAGGCTTAGGGGCCAGAGGG - Intergenic
1029572500 7:101379481-101379503 CTGGAGGGTGAGAGGCAGGAAGG - Intronic
1030701576 7:112646929-112646951 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1031804576 7:126292660-126292682 CTGGAGCCAGGGAGGCTGGACGG + Intergenic
1032019691 7:128400451-128400473 CTGGAGGCCAAGATGCGGCATGG - Exonic
1032075427 7:128833631-128833653 CAGGAAGCCTTGAGGCTGCAGGG - Intronic
1032121541 7:129160492-129160514 CTGGAGGCCTGGGGGCTAGGGGG + Intronic
1032473050 7:132192220-132192242 CAGGAGGCCTACAGTCTAGAAGG - Intronic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1034131484 7:148722499-148722521 CTGGAGGCCTGCAGGATGGCGGG - Intronic
1034254590 7:149717627-149717649 CCGGAGGCCCAGAGGCTGATGGG - Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035032983 7:155874592-155874614 CTGGAGGCCCAGACCCTGAAAGG + Intergenic
1035491683 7:159284830-159284852 CTGGAGCCAGAGATGCTGGATGG + Intergenic
1035760404 8:2064546-2064568 CGGGAGGCCAAGCGGATGGAGGG + Intronic
1036137332 8:6174233-6174255 TGGGAGTCCTAGATGCTGGAGGG - Intergenic
1036544326 8:9751723-9751745 CTGGCAGCCGAGAGGCAGGAGGG - Exonic
1036668476 8:10764093-10764115 ATGGAGGCCTTGAGGCTGCCTGG - Intronic
1037200792 8:16249847-16249869 CTTGAGGCTTACAGGCTGCAGGG + Intronic
1037624161 8:20593070-20593092 CTGCAGGCCTCCAGGCTTGAGGG + Intergenic
1037786481 8:21906295-21906317 CTGGATCACTAAAGGCTGGAAGG - Intergenic
1037943908 8:22974609-22974631 CTGAAGGCCTAGAAGCTATAAGG + Intronic
1039079038 8:33717981-33718003 CTGGAGTCCAGCAGGCTGGAAGG + Intergenic
1039293852 8:36127773-36127795 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1039608540 8:38901544-38901566 CTGGCGGCCTAGGGGCGCGAGGG + Intronic
1039792407 8:40886365-40886387 CTGGAGGCCTGGAGGAGCGAGGG - Intronic
1039944099 8:42115433-42115455 CTTGAGGACTAGAGACTGGTAGG + Intergenic
1040968862 8:53112615-53112637 CTGGTGGCATAGACACTGGAGGG + Intergenic
1042252193 8:66767628-66767650 CTCGAAGCCTAGAGGATTGAAGG + Intronic
1042979694 8:74511839-74511861 CTGCAGTCCTAGAAGATGGATGG + Intergenic
1045562765 8:103281796-103281818 CTGGAGGATTAGAGGCTACATGG + Intergenic
1046338908 8:112826170-112826192 CTGGAGCCAGAGAGGCTGAATGG - Intronic
1047182062 8:122598136-122598158 CTGGAGTCTTTGAGGCTGCAAGG - Intergenic
1047928919 8:129707109-129707131 CTGGATGCCCAGTGCCTGGAAGG + Intergenic
1048386234 8:133915175-133915197 CAGGTGGCCTGGAAGCTGGAAGG - Intergenic
1048853916 8:138670258-138670280 CAGGAGCCCTGGAGTCTGGAAGG + Intronic
1048993753 8:139776200-139776222 CAGGAGGCCTGCAGGATGGAAGG - Intronic
1049258890 8:141628240-141628262 CTGGAGGGGTGGAGGCTGCAGGG + Intergenic
1049348999 8:142154110-142154132 CTGGCTCCCAAGAGGCTGGAGGG - Intergenic
1049747804 8:144270388-144270410 CTGGAGGCCTCGGAGCTGAAAGG + Intronic
1050616886 9:7410654-7410676 CTGGAGGTGAAGAGGCTGGCTGG - Intergenic
1051119025 9:13731353-13731375 GTGGTGGCCTAGAAGCTGGGTGG - Intergenic
1051151578 9:14085415-14085437 CCTGAGGGCTAGAGGCTGAATGG - Intronic
1052158563 9:25226411-25226433 CTGGAGTCCCAAAGGGTGGAGGG + Intergenic
1052546637 9:29888904-29888926 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
1052941412 9:34134287-34134309 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1055040373 9:71864540-71864562 ATGGAAGCCTAGAGGAAGGAAGG - Intronic
1055326152 9:75132219-75132241 CTGGAGGGCAAGAGAATGGAAGG + Intronic
1056578322 9:87872377-87872399 CTGGAGGGGTAGAGCCTGGCTGG - Intergenic
1057382756 9:94583821-94583843 CTTGAGGCCTTGAGGCTAGGTGG - Intronic
1057704137 9:97385880-97385902 CTGGGGGCCTGGTGGCTGGATGG + Intergenic
1057997170 9:99828806-99828828 CGTGAGGCCGAGAGGCGGGAAGG - Exonic
1060859196 9:126939866-126939888 CTGGAGGCCTGTTGGGTGGAGGG + Intronic
1060907908 9:127324431-127324453 ATGGAGGCACGGAGGCTGGAGGG - Intronic
1061014218 9:127972640-127972662 CTGCAGGCCTGGAGGCAGGGAGG + Intronic
1061278107 9:129581173-129581195 CTTGAGGCCTTGAGGCTGGGAGG + Intergenic
1061283135 9:129608776-129608798 CTGGAAGCCTCAAGGCTGGTGGG - Intergenic
1061814860 9:133188582-133188604 CTGGGGGCCTGGCGGCTGGAAGG + Intergenic
1062480237 9:136747712-136747734 CTGGAAGGCTGGAGGCTGGAGGG - Intronic
1062480265 9:136747802-136747824 CTGGAAGGTTGGAGGCTGGAGGG - Intronic
1062480289 9:136747893-136747915 CTGGAAGGCTGGAGGCTGGAGGG - Intronic
1062480314 9:136747998-136748020 CTGCAGAACTGGAGGCTGGAGGG - Intronic
1062480319 9:136748021-136748043 CTGGAGGGCTGGAGGCTGGAGGG - Intronic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1062480329 9:136748059-136748081 CTGCTGGGCTGGAGGCTGGAGGG - Intronic
1062480341 9:136748104-136748126 CTGGAGGGCTGGAGGCTGTAGGG - Intronic
1062480345 9:136748119-136748141 TTGGAGAACTGGAGGCTGGAGGG - Intronic
1062480364 9:136748194-136748216 CTGGAGGGTTGGAGGCTGGAGGG - Intronic
1062505998 9:136876868-136876890 CTGGTGCCCCTGAGGCTGGAGGG + Intronic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1185544618 X:933677-933699 CTGGAGGCATAGGGGCTGCATGG - Intergenic
1186147936 X:6644306-6644328 CTGAAGGCTTAGAGGTTAGAGGG - Intergenic
1186397416 X:9223865-9223887 CTGAAGGCTTGGAGTCTGGAGGG - Intergenic
1186669817 X:11757799-11757821 CCGGCGGCCGGGAGGCTGGACGG - Intergenic
1187974821 X:24694176-24694198 TTGGAGGACCAGAGCCTGGAGGG + Intronic
1189280311 X:39816387-39816409 CTGTGGGCCTAGAGGCAGGCAGG + Intergenic
1189362047 X:40360314-40360336 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1189571871 X:42306775-42306797 CTGGAGTCAGGGAGGCTGGATGG + Intergenic
1189659239 X:43279232-43279254 CTGGAGGCCAAGATGCGGCATGG - Intergenic
1189809518 X:44768337-44768359 ATGGACTCCTAGAGGATGGAGGG + Intergenic
1190300590 X:49054774-49054796 ATGGAGGTCAAGAGGCAGGATGG - Intronic
1190529597 X:51361591-51361613 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
1191778403 X:64843233-64843255 CCATAGGCCTAGAGGCTGGAGGG - Intergenic
1191923385 X:66281063-66281085 CTGAAGTTCTAGAGGCTAGAGGG + Intergenic
1192138875 X:68630858-68630880 CTGGCGCCCTGGAAGCTGGAGGG + Intergenic
1192340099 X:70257290-70257312 CAGGAGACCAACAGGCTGGAAGG + Intergenic
1192547182 X:72023802-72023824 CTGGAGGCAGGGAGGCTGGTGGG + Intergenic
1192930263 X:75799319-75799341 CTGGAGCCAGAGAGGCTGGACGG - Intergenic
1193649056 X:84108648-84108670 CTGGAGGCCTAGGGGATTCAAGG - Intronic
1193719523 X:84971498-84971520 CTGGAGCCAGGGAGGCTGGACGG - Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1194286771 X:92020354-92020376 CTGGAGCCAGGGAGGCTGGATGG + Intronic
1194523128 X:94942894-94942916 CTGGAGCCATGGAGGCTGGATGG + Intergenic
1194851949 X:98881114-98881136 CTGGAGCCAGGGAGGCTGGATGG + Intergenic
1195810679 X:108825337-108825359 CTGGTGGCATAGACACTGGAGGG + Intergenic
1196607363 X:117671824-117671846 CTGGAGCCAGGGAGGCTGGATGG - Intergenic
1197765555 X:130057367-130057389 CTGGAGGCCCAGAGGCCAGGGGG - Exonic
1198231439 X:134693231-134693253 CTGGAGAGCTGGAGGCAGGAAGG - Intronic
1198517900 X:137427394-137427416 CTAGAGGCCCAGAGGCTAGGAGG + Intergenic
1199977700 X:152904126-152904148 CTGGAGGCCAACAGGGTGGCAGG - Intergenic
1200058632 X:153474327-153474349 CTGGTGGCCTGGGGGCAGGATGG - Intronic
1200604317 Y:5244914-5244936 CTGGAGCCAGGGAGGCTGGATGG + Intronic
1200958090 Y:8971509-8971531 CTGGAGGCTTAGAGGCCTGTGGG - Intergenic
1201274849 Y:12287402-12287424 CCGAGGGCCTAGAGGCTGGGAGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic
1201636571 Y:16129028-16129050 CTGAAGGCTTGGAGGCAGGAAGG - Intergenic
1202600852 Y:26591712-26591734 CTGCAGGCCTAGAGAATGGGAGG - Intergenic