ID: 1165106605

View in Genome Browser
Species Human (GRCh38)
Location 19:33473594-33473616
Sequence AAGTACCTCTGGAAGCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165106605_1165106610 7 Left 1165106605 19:33473594-33473616 CCCTGACGCTTCCAGAGGTACTT 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1165106610 19:33473624-33473646 ACCCAAGGCACTGAGCTATCAGG 0: 1
1: 0
2: 1
3: 10
4: 139
1165106605_1165106608 -8 Left 1165106605 19:33473594-33473616 CCCTGACGCTTCCAGAGGTACTT 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1165106608 19:33473609-33473631 AGGTACTTAACCGAAACCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 54
1165106605_1165106613 10 Left 1165106605 19:33473594-33473616 CCCTGACGCTTCCAGAGGTACTT 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1165106613 19:33473627-33473649 CAAGGCACTGAGCTATCAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165106605 Original CRISPR AAGTACCTCTGGAAGCGTCA GGG (reversed) Intronic
908856629 1:68437066-68437088 AAGTTACTCTGGCAGCATCATGG - Intronic
912703827 1:111897432-111897454 AAGCACCTCCGGAGGCGGCAAGG - Intronic
916742676 1:167660216-167660238 AACAACCTCTGTAAGCATCAGGG - Intronic
922868532 1:228881471-228881493 AATTACTTCTGGAACTGTCAGGG + Intergenic
1071494286 10:86157076-86157098 CAGGACCTCTGGAAGCCTGAAGG + Intronic
1076329740 10:129655437-129655459 GAGGCCCTCTAGAAGCGTCAGGG - Intronic
1083275831 11:61596443-61596465 AAGTATCTCAGGTAGGGTCATGG + Intergenic
1085377733 11:76082055-76082077 AACTACCTCTGGAAGTGAGAAGG + Intronic
1087090407 11:94265138-94265160 ATCTACCTCTGGAACAGTCATGG - Intergenic
1089032654 11:115348858-115348880 AACTACATCGGGAAGGGTCATGG + Intronic
1097999115 12:65922077-65922099 AAGAACCTCTGGTAGGGCCATGG + Intronic
1101476329 12:105052033-105052055 AAGTAACTCTGGTAGAGACAGGG - Intronic
1102918997 12:116777788-116777810 AGTTATCTCTGGAAGCCTCAGGG - Intronic
1109782246 13:67127079-67127101 AAATACCTCTGGAACCATCATGG - Intronic
1109981171 13:69909920-69909942 AAGTTCCTCTCACAGCGTCAAGG + Intronic
1113728944 13:112625944-112625966 GAGCACCTCTGGGAGGGTCACGG - Intergenic
1119338661 14:73856161-73856183 AAGTTGCTCTGGATGAGTCAGGG - Intronic
1122610536 14:102979526-102979548 AAGTACCCCTTGTAGGGTCATGG - Intronic
1125059099 15:35397646-35397668 AGGTACCTCTGGAAGTGAGAGGG + Intronic
1132069538 15:98763614-98763636 AAGTCCCTTTGGAAGCCTAAGGG + Intronic
1132076106 15:98821934-98821956 AAGTACCTGTGGAAGGGAAAGGG - Intronic
1138410420 16:56835213-56835235 AAATACTTCTGGAAGCTTGAGGG + Intronic
1138716381 16:59027949-59027971 AGGTACCTCTGGAGACTTCATGG + Intergenic
1144139922 17:12338171-12338193 AAATTTCTCTGGAAGAGTCAAGG - Intergenic
1146061027 17:29607487-29607509 AAGTAACTCTGGAAGAGGGAGGG - Intronic
1152229054 17:79105653-79105675 AAGCACCTCTGGCAGCCCCAGGG - Intronic
1162731859 19:12722963-12722985 AAGTACCTCTGGATGGGGGAAGG - Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165106605 19:33473594-33473616 AAGTACCTCTGGAAGCGTCAGGG - Intronic
926874512 2:17459891-17459913 AAATACAACTGGAAGCATCAAGG + Intergenic
927347230 2:22059318-22059340 AATTATCTCTGGAAACTTCAGGG - Intergenic
940242462 2:151578101-151578123 AAGTACCTCTGGAAGCTTAAGGG + Intronic
940243459 2:151588793-151588815 AGGTATCTCTGGAAGCTTAAGGG + Intronic
940244415 2:151599346-151599368 AGGTATCTCTGGAAGCTTAAGGG + Intronic
940664181 2:156587280-156587302 GACTACCTCTGGTATCGTCAAGG - Intronic
940755205 2:157674113-157674135 AGGTACCTCTGGAAGCATGAAGG + Intergenic
1174681487 20:52413063-52413085 AAGTACCTGTAAAAGCATCATGG - Intergenic
1174904903 20:54540113-54540135 AAGTCCCTTTGGAAGCCCCAGGG + Intronic
1178067496 21:28921820-28921842 AAGTACCTCTTGAAATGTCTTGG + Intergenic
1179723018 21:43325958-43325980 AAATCCCACTGGAAGCCTCAGGG + Intergenic
954100498 3:48368918-48368940 ACGTGCCTCTGGAAGAGTCAGGG + Intergenic
955758296 3:62249572-62249594 AAGGACCTCTGGAATCTTAATGG + Intronic
963582292 3:147141013-147141035 AATTACCTATGGAACAGTCAAGG + Intergenic
969929877 4:10620585-10620607 AATTGCCTCTGGAAGTGTCAGGG - Intronic
971997414 4:33982902-33982924 AAGGTCATCTGGAAGCATCAAGG - Intergenic
973878470 4:55244550-55244572 AAGTTACTCTGGAAGCCACAGGG + Intergenic
976329139 4:83808652-83808674 AATTACATCTGGAAGCATCATGG - Intergenic
978327500 4:107575915-107575937 AAGTACCTCAGGAAGCAAAAAGG - Intergenic
979864054 4:125730921-125730943 GAATACCTCTGTAAGAGTCAGGG - Intergenic
991663701 5:68974973-68974995 CAGTACCTCTGGACCCATCAAGG + Intergenic
997007602 5:129836926-129836948 AAGTTTTTCTGGAAGGGTCATGG - Intergenic
1001522819 5:172407006-172407028 ACGTATCTCTGAAAGCTTCAGGG + Intronic
1001888399 5:175317292-175317314 AAGTATGTATGGAAGAGTCAAGG - Intergenic
1006625805 6:35397016-35397038 AATTGCCTCTGGAGGCCTCAGGG - Intronic
1007925875 6:45649217-45649239 AAGACCCTCAGGAAGGGTCAAGG - Intronic
1008559888 6:52713486-52713508 ATGGCCCTCTGGAAGCCTCAGGG - Intergenic
1013266941 6:108508962-108508984 AAGTCCCTCTGGAAGCTCCTGGG - Intronic
1014975424 6:127875492-127875514 GAGTCCCTCTGGAAGTCTCAAGG - Intronic
1015420510 6:133002522-133002544 AAGTAGATCTGGAAGGGTAAAGG + Intergenic
1033088024 7:138360152-138360174 AAGTACCTCTTGAAGCCACTTGG - Intergenic
1033415168 7:141155556-141155578 AAGCACCACTGGAAGGGTGAGGG - Intronic
1042170424 8:65985721-65985743 AAGTACCTCAGGCAGCTGCAAGG - Intergenic
1043106359 8:76117076-76117098 AAGTTGCTCTGGATGAGTCAGGG + Intergenic
1046639478 8:116711202-116711224 AAGTATCTCTGAAAGGGGCAGGG + Intronic
1054859684 9:69936665-69936687 AAGTTGCTCTGGATGAGTCATGG + Intergenic
1058902667 9:109456000-109456022 AAGTACCTGTGGGAGCCTCAGGG - Intronic
1062099343 9:134720092-134720114 CAGTGCCTCAGGAAGGGTCAGGG + Intronic
1186058343 X:5675432-5675454 AAGTAGCTCTTGGAGTGTCACGG + Intergenic
1187148781 X:16662643-16662665 AAGTAACTCTGCAGGCTTCATGG + Intronic
1187829331 X:23364988-23365010 AAGTACTTCTTGAAGAGTTACGG + Intronic
1193559499 X:83000329-83000351 AGGTACCCCTGGAAGTGTAACGG + Intergenic
1195108260 X:101621198-101621220 AATTGCCTCTGGATGCCTCAAGG + Intergenic