ID: 1165108067

View in Genome Browser
Species Human (GRCh38)
Location 19:33486240-33486262
Sequence GGGTTGGTTTGGGGGCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165108067_1165108080 3 Left 1165108067 19:33486240-33486262 CCCACTAGCCCCCAAACCAACCC No data
Right 1165108080 19:33486266-33486288 ATCATGCCCCCGCCAGGACCTGG 0: 1
1: 0
2: 1
3: 9
4: 97
1165108067_1165108075 -3 Left 1165108067 19:33486240-33486262 CCCACTAGCCCCCAAACCAACCC No data
Right 1165108075 19:33486260-33486282 CCCCCCATCATGCCCCCGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165108067 Original CRISPR GGGTTGGTTTGGGGGCTAGT GGG (reversed) Intronic
No off target data available for this crispr