ID: 1165110074

View in Genome Browser
Species Human (GRCh38)
Location 19:33497267-33497289
Sequence TCACCAAGTCTGCTACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165110074_1165110082 16 Left 1165110074 19:33497267-33497289 CCTGCCTGTAGCAGACTTGGTGA 0: 1
1: 0
2: 3
3: 12
4: 105
Right 1165110082 19:33497306-33497328 CATATGCCTGGCGCCATAAAGGG 0: 1
1: 0
2: 1
3: 3
4: 60
1165110074_1165110085 30 Left 1165110074 19:33497267-33497289 CCTGCCTGTAGCAGACTTGGTGA 0: 1
1: 0
2: 3
3: 12
4: 105
Right 1165110085 19:33497320-33497342 CATAAAGGGAAGCAAGTGCATGG 0: 1
1: 0
2: 1
3: 19
4: 301
1165110074_1165110081 15 Left 1165110074 19:33497267-33497289 CCTGCCTGTAGCAGACTTGGTGA 0: 1
1: 0
2: 3
3: 12
4: 105
Right 1165110081 19:33497305-33497327 ACATATGCCTGGCGCCATAAAGG No data
1165110074_1165110079 4 Left 1165110074 19:33497267-33497289 CCTGCCTGTAGCAGACTTGGTGA 0: 1
1: 0
2: 3
3: 12
4: 105
Right 1165110079 19:33497294-33497316 CGGACCTTCTCACATATGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165110074 Original CRISPR TCACCAAGTCTGCTACAGGC AGG (reversed) Intronic
915048625 1:153042567-153042589 TCACCAACTGTGCTCCAGGAAGG + Intergenic
916635706 1:166666305-166666327 TTACCAAGTGTGCTAGAGGCTGG - Intergenic
922149124 1:222981776-222981798 TCTCCAAGTATGGTACAGTCTGG + Intronic
922749256 1:228063054-228063076 TCTGCAAGGCTGCTGCAGGCAGG - Intergenic
1069466770 10:68646987-68647009 TCACCAAGACAGCTGCAGGTGGG - Exonic
1069571475 10:69496888-69496910 TCCCCAAGCCAGCTAAAGGCTGG - Intronic
1070842790 10:79499532-79499554 TCACCCACTCTGCTGCAGGTGGG - Intergenic
1072224901 10:93359974-93359996 TCACAAACTCTGTTCCAGGCTGG - Exonic
1072281000 10:93865378-93865400 TCACCAGGACTGCTACAGGCAGG - Intergenic
1074297947 10:112208555-112208577 TCTGCCACTCTGCTACAGGCTGG + Intronic
1075088171 10:119428013-119428035 TCACCAGGTCTGATACTGGGAGG + Intronic
1076995018 11:293583-293605 TCACCACCTCTCCTACAGGGAGG - Exonic
1090843788 11:130514646-130514668 TCCCCAACTCTGCTCCAGGGGGG + Intergenic
1091617394 12:2059825-2059847 GCACCAAGTGTGGTACAGGCAGG - Intronic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1094146741 12:27236640-27236662 TCATAAAGTCTGCTCTAGGCTGG - Intergenic
1097196542 12:57245193-57245215 CCATCATGGCTGCTACAGGCTGG + Exonic
1099660350 12:85550250-85550272 TCATCAGTTCTGCTTCAGGCAGG - Intergenic
1103017969 12:117510578-117510600 TAACAATGTCTGCGACAGGCCGG + Intronic
1104136507 12:125944691-125944713 AGACCAAGGCAGCTACAGGCTGG + Intergenic
1111186087 13:84737668-84737690 TCACCAAGTCTCCTACATGAAGG + Intergenic
1111199954 13:84922538-84922560 TCACCATGTATTCTACAAGCAGG + Intergenic
1112332021 13:98484092-98484114 TCACCAAGCCTCCTCAAGGCAGG - Intronic
1112463010 13:99619616-99619638 TTACTAACTCTGCTATAGGCAGG + Intronic
1112606674 13:100913240-100913262 ACAACACATCTGCTACAGGCAGG + Intergenic
1124641777 15:31400473-31400495 TTACGAAGTGTGCCACAGGCAGG + Intronic
1126682108 15:51212463-51212485 TGACCAAGTCCACGACAGGCTGG + Exonic
1129293792 15:74588332-74588354 TCACCAACTCTTTTACAGGATGG - Intronic
1130181206 15:81630402-81630424 TCACCATGGCTGTTACTGGCAGG + Intergenic
1136037471 16:27550801-27550823 TCACTCACTCTGCTACATGCTGG - Intronic
1136665106 16:31803654-31803676 TAAGCAATTCTGCTTCAGGCTGG - Intergenic
1137392421 16:48092540-48092562 TCACCAAGTGGGCTAGAGGCAGG + Intronic
1137410562 16:48224262-48224284 TCACCAAGTCTGCCACTTACTGG + Exonic
1137756968 16:50910141-50910163 TCCCCAAGTCTTCTCCTGGCCGG + Intergenic
1141573993 16:84952554-84952576 TAACCAAGTCTGCAGCTGGCGGG + Intergenic
1143761596 17:9108245-9108267 TCACCAAGGCTGCTACAATCAGG + Intronic
1144084404 17:11795878-11795900 TGACCAAGGGTGCTTCAGGCTGG - Intronic
1149163633 17:53724728-53724750 TCAGCAAGTCTGCTACCTGTGGG - Intergenic
1150705168 17:67480158-67480180 TCTCCAAGTCAGCAACAGGATGG - Intronic
1150778552 17:68101232-68101254 GAACCAAGTCTGCTACCCGCCGG - Intergenic
1154277809 18:12977243-12977265 CCACCCAGTCTCCTACATGCAGG + Intronic
1155619757 18:27764705-27764727 TCACCAAGTGTGGTGGAGGCTGG - Intergenic
1155915571 18:31553906-31553928 GCACCAAGTCTGCTACAGGATGG - Intergenic
1159607687 18:70492534-70492556 TCACAAAGTTTGCTATGGGCTGG - Intergenic
1161328574 19:3675419-3675441 GCAGCCAGTCTGCTGCAGGCTGG + Intronic
1162076936 19:8194172-8194194 CCCCCATGTCTGCAACAGGCTGG - Intronic
1164534874 19:29077859-29077881 GCACCAAGTCGGCTCCTGGCAGG - Intergenic
1165110074 19:33497267-33497289 TCACCAAGTCTGCTACAGGCAGG - Intronic
1165451334 19:35885415-35885437 TCAACAAGTATGATACAAGCAGG + Intergenic
1165604125 19:37085482-37085504 GCACCAAGTCTGCTGCGGGGAGG - Intronic
928090295 2:28369651-28369673 TGACACATTCTGCTACAGGCAGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
940715715 2:157221319-157221341 TTACCAATTCTCCTATAGGCAGG - Intergenic
948357906 2:237394885-237394907 TCACCAAGGCTGCTGGAAGCCGG - Exonic
1170130289 20:13011615-13011637 GCAGCAAGCCTGCTGCAGGCTGG - Intronic
1173039731 20:39451065-39451087 TCACCATGTTGGCCACAGGCTGG + Intergenic
1173155016 20:40601364-40601386 TTACCAAGACAGCCACAGGCAGG + Intergenic
1173734965 20:45353971-45353993 ACACCACCTCTGCTATAGGCTGG - Intergenic
1177871385 21:26577229-26577251 TTACCAAGTCAGTTAGAGGCAGG + Intergenic
1178512033 21:33213472-33213494 TCACACAGTCTGGTACAGGTGGG + Intergenic
1178940410 21:36900717-36900739 TCACCATGTCTGCTGCATGCTGG - Intronic
1179437689 21:41373599-41373621 TCAACAAGTCAGCTAATGGCTGG - Intronic
1180710186 22:17834153-17834175 ACACCAGCTCTGCTACTGGCTGG + Intronic
1183927632 22:41217269-41217291 TCACCAGGGCGGCTTCAGGCTGG + Intronic
949777349 3:7647744-7647766 ACAACAAATGTGCTACAGGCTGG + Intronic
954420190 3:50414816-50414838 CCTCCAAGTCTGCGCCAGGCCGG + Intronic
954594052 3:51810313-51810335 ACACCAAGTCTGATGCAGGGAGG - Intergenic
959040188 3:101413578-101413600 TCAGGAAGTTTGCTACAGGGAGG + Intronic
960036126 3:113104833-113104855 TCACAAAGTCTGCTAGGGCCCGG + Intergenic
960143255 3:114171761-114171783 CCAGCAAGTCTGCCACAGCCAGG + Exonic
960703322 3:120458454-120458476 TCCCCATGTCTGCAGCAGGCTGG - Intergenic
967627527 3:191703324-191703346 TGTGCAAGTCTGCTACTGGCGGG - Intergenic
970412111 4:15818490-15818512 ACACCAACTCTGCTAAAGGACGG + Intronic
970986911 4:22169655-22169677 TCACCCAGTCTATTATAGGCTGG - Intergenic
971926504 4:33015964-33015986 TCACAAAATTTTCTACAGGCAGG - Intergenic
977212416 4:94234547-94234569 TCAGCAAGAGTGCTACTGGCAGG - Intronic
986002658 5:3642451-3642473 TCACCAGGCCTGGCACAGGCGGG - Intergenic
987561434 5:19527384-19527406 TCACAATGTCTGGTACATGCTGG + Intronic
989266051 5:39475189-39475211 CCACCAACTCTGCTAAAGCCTGG - Intergenic
991671056 5:69048203-69048225 TCAGCAGATCTGCTAGAGGCAGG + Intergenic
992589240 5:78276361-78276383 TCACAAAGTATGTTGCAGGCTGG - Intronic
1000403280 5:160855954-160855976 TCATCAAGACTGGTACTGGCAGG - Intergenic
1000817396 5:165940645-165940667 TCACCAACTCTACCACAGGCTGG + Intergenic
1004256265 6:14067659-14067681 TCAAGAAATCTGGTACAGGCAGG - Intergenic
1006749889 6:36370337-36370359 TCACCATGTTGGCCACAGGCTGG - Intronic
1006945863 6:37784178-37784200 TCCCCAGGTCAGCTCCAGGCAGG + Intergenic
1007388899 6:41538497-41538519 TTACCAAGCCAGCTACAGGATGG + Intergenic
1007635429 6:43297176-43297198 TGTCCCAGTCTGCTCCAGGCTGG - Intronic
1012511854 6:100011533-100011555 TCACCATGTCTACTACAGGGAGG - Intergenic
1016772461 6:147867251-147867273 TGACCAAGTATGCTACAGTATGG - Intergenic
1016796926 6:148128133-148128155 TCACCAGGTAAGCAACAGGCAGG + Intergenic
1022468830 7:30669338-30669360 TCACCTAGACAGCTCCAGGCTGG - Intronic
1031948095 7:127862156-127862178 TTTCCTAGTCTGCTAAAGGCAGG + Intronic
1032059554 7:128713107-128713129 TCACCATCTCTACTAAAGGCTGG - Intronic
1032267583 7:130380018-130380040 TCCCCAAGGCAGCTTCAGGCAGG - Intergenic
1036601536 8:10265267-10265289 ACTCCATGTCTGCTCCAGGCTGG - Intronic
1038389929 8:27187309-27187331 TCACCAAGTCTGGGCCACGCTGG + Intergenic
1040382197 8:46883882-46883904 TCACCAAGCCCACTACAGACAGG + Intergenic
1048862028 8:138730650-138730672 TCATGAATTCTGCTACATGCCGG - Intronic
1051876771 9:21802219-21802241 TCACCAAGGCGGGTACTGGCCGG - Intergenic
1051965612 9:22825786-22825808 TCACCAAGACTGAGACAGACTGG - Intergenic
1053150718 9:35741034-35741056 ACACAAAGACTCCTACAGGCAGG + Exonic
1056453811 9:86741416-86741438 TCTCCAAGTCACCTACAGGCTGG - Intergenic
1060114127 9:120927702-120927724 ACACCAGGGCTGCCACAGGCTGG + Exonic
1188444431 X:30241859-30241881 TCACCCAGTCAGCCCCAGGCAGG + Intergenic
1188445596 X:30250281-30250303 TCACCCAGTCAGCCCCAGGCAGG + Intronic
1188970606 X:36611092-36611114 TGTCAAAGTCTGCTACAAGCAGG + Intergenic
1189255276 X:39633361-39633383 GCAGCAAGTGTGGTACAGGCAGG + Intergenic
1189373464 X:40448006-40448028 TCCCCCATTCTGCTATAGGCAGG - Intergenic
1194050855 X:89066505-89066527 TCAAAAAGACTACTACAGGCGGG - Intergenic
1194393193 X:93346575-93346597 TTACCAGCTCTGCCACAGGCGGG - Intergenic
1195870683 X:109482124-109482146 GCACTAACTCTGCTACAGGTGGG - Intergenic
1200869387 Y:8081131-8081153 TCACCAAGTCTGCTATAGACAGG + Intergenic
1200905127 Y:8473897-8473919 TCAACATGTCTCCTATAGGCAGG - Intergenic
1202071633 Y:20997674-20997696 TCACAATGTCTCCTGCAGGCAGG + Intergenic
1202245871 Y:22819440-22819462 TCACCAAGCCTGCTATAGACAGG - Intergenic
1202259924 Y:22959634-22959656 GCAACATGTCTCCTACAGGCTGG - Intergenic
1202398859 Y:24453188-24453210 TCACCAAGCCTGCTATAGACAGG - Intergenic
1202412910 Y:24593378-24593400 GCAACATGTCTCCTACAGGCTGG - Intergenic
1202457871 Y:25076692-25076714 GCAACATGTCTCCTACAGGCTGG + Intergenic
1202471921 Y:25216898-25216920 TCACCAAGCCTGCTATAGACAGG + Intergenic