ID: 1165113290

View in Genome Browser
Species Human (GRCh38)
Location 19:33514273-33514295
Sequence ACAGCTTCACTGCAGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165113290_1165113296 16 Left 1165113290 19:33514273-33514295 CCTGGGGACTGCAGTGAAGCTGT 0: 1
1: 1
2: 2
3: 27
4: 216
Right 1165113296 19:33514312-33514334 CACAGCACAGCACGGTGAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 184
1165113290_1165113298 22 Left 1165113290 19:33514273-33514295 CCTGGGGACTGCAGTGAAGCTGT 0: 1
1: 1
2: 2
3: 27
4: 216
Right 1165113298 19:33514318-33514340 ACAGCACGGTGAAGTGGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
1165113290_1165113299 23 Left 1165113290 19:33514273-33514295 CCTGGGGACTGCAGTGAAGCTGT 0: 1
1: 1
2: 2
3: 27
4: 216
Right 1165113299 19:33514319-33514341 CAGCACGGTGAAGTGGTCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 158
1165113290_1165113293 8 Left 1165113290 19:33514273-33514295 CCTGGGGACTGCAGTGAAGCTGT 0: 1
1: 1
2: 2
3: 27
4: 216
Right 1165113293 19:33514304-33514326 CCTGCCCTCACAGCACAGCACGG 0: 1
1: 0
2: 1
3: 49
4: 339
1165113290_1165113297 21 Left 1165113290 19:33514273-33514295 CCTGGGGACTGCAGTGAAGCTGT 0: 1
1: 1
2: 2
3: 27
4: 216
Right 1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165113290 Original CRISPR ACAGCTTCACTGCAGTCCCC AGG (reversed) Intronic
900492665 1:2960213-2960235 ACGGCTTCACTCCAGTCGCGGGG - Intergenic
900572992 1:3368594-3368616 AAAGCTCCAATGCAGTCACCAGG + Intronic
900619784 1:3581429-3581451 CCGGCTTCCCTGCAGCCCCCTGG - Intronic
902533539 1:17105777-17105799 CCAGCTGCATTGCAGTCACCTGG + Intronic
902815152 1:18912177-18912199 ACAGCTTCAAGGCTGTCCTCAGG + Intronic
904469807 1:30729348-30729370 CCAGCTGCACTGCAGGCTCCTGG - Intergenic
905340617 1:37274933-37274955 GCAGCTGCACTGCAGCCCCTTGG + Intergenic
905626730 1:39494374-39494396 AGGGTTTCACTGCATTCCCCAGG + Intronic
906207732 1:43996085-43996107 GCAGCTTCAGTGCAGCCCCAGGG + Exonic
906316048 1:44786956-44786978 CCAGCTCCCCTGCAGTGCCCAGG + Intronic
915268196 1:154733625-154733647 ACAGCTTCCCTCCAGACCCCCGG - Intronic
918046453 1:180944491-180944513 CCAGCTGCACTGTGGTCCCCTGG - Exonic
922866968 1:228868615-228868637 TCAGCTGCACTGGAATCCCCTGG + Intergenic
923417343 1:233776349-233776371 ACAGTTTCACTCCACTGCCCAGG + Intergenic
1063785844 10:9381781-9381803 AAAGCTTCACTCCAGTTCACTGG - Intergenic
1068773736 10:60849982-60850004 ACAGCCACACTGCAGTGTCCAGG + Intergenic
1069712088 10:70496207-70496229 ATAGCCTCACTGCAGTCCTCAGG + Intronic
1070825646 10:79388892-79388914 ACCTCCTCACTGCAGGCCCCAGG - Intronic
1071753089 10:88503353-88503375 ACAGTTTCACTTCATTGCCCAGG - Intronic
1072652936 10:97309772-97309794 TCAGTTTCACTGTAATCCCCAGG + Intergenic
1074216734 10:111392411-111392433 ACAACTTCACTTCTGTCCACAGG + Intergenic
1074707484 10:116147863-116147885 ACACCTCCACTGGGGTCCCCCGG - Intronic
1075514429 10:123097877-123097899 AAAGCTTTCCTGCACTCCCCAGG + Intergenic
1076922789 10:133464287-133464309 CCAGGTTCACTGCAGCACCCAGG - Intergenic
1076922798 10:133464339-133464361 CCAGGTTCACTGCAGCACCCAGG - Intergenic
1077094407 11:793190-793212 ACAGCCCCACTGCCCTCCCCAGG - Intronic
1077297875 11:1834553-1834575 GCATGTTCACTGCAGCCCCCAGG - Exonic
1077508728 11:2944209-2944231 GCAGCTTCACTGCGGGCCCAGGG - Intergenic
1078429775 11:11280150-11280172 ACTGAATCACTGCACTCCCCGGG - Intronic
1079444148 11:20544758-20544780 GCAGCTTCCCAGCAGGCCCCTGG + Intergenic
1080811893 11:35712729-35712751 ACAGCTTCACTCCTCTCTCCAGG - Intronic
1082101103 11:48173607-48173629 ACAGCTTGACTGCAGCCTCCTGG + Intergenic
1083265645 11:61545737-61545759 GCAGCTTCATTTCAGTCCCTGGG - Intronic
1083294298 11:61706988-61707010 GCAGCTTCACTGACCTCCCCTGG + Intronic
1085117398 11:73941922-73941944 ATAGCTTTACTACAGTACCCTGG + Intergenic
1085502228 11:77034619-77034641 ACAGGTCCAGTGCAGACCCCAGG + Intronic
1088893731 11:114062779-114062801 TCAGCTTCACGCCAGCCCCCTGG - Intronic
1089146851 11:116335510-116335532 AAAACTTCACTGCAGCCACCAGG - Intergenic
1089857441 11:121558910-121558932 ACAGCTTCTCTGCAAAGCCCAGG - Intronic
1096308887 12:50503534-50503556 ACAGTTTCACTGCGTTGCCCAGG + Intergenic
1099613585 12:84908032-84908054 ACCACTTCACTCCAGTCCCCAGG - Intronic
1102430554 12:112879666-112879688 ACAGCCTCGCTGCAGGCCCTGGG + Intronic
1104559327 12:129829694-129829716 AAAGCTTCACTGCAGAGCACAGG + Intronic
1105700877 13:22935154-22935176 ACAGCTTCAGTGCCTTCCCTGGG - Intergenic
1105853699 13:24358211-24358233 ACAGCTTCAGTGCCTTCCCTGGG - Intergenic
1106931289 13:34668542-34668564 ATAGCTTCACTGCAGGTCCCAGG + Intergenic
1108533482 13:51348265-51348287 ACAGACTCACTGCACTTCCCAGG - Exonic
1108799858 13:54081957-54081979 CCAGCTTCACGGCAGTGTCCAGG - Intergenic
1109242193 13:59902748-59902770 ACAGTTTCACTTCATTGCCCAGG - Intronic
1110087959 13:71406277-71406299 ACAGCTTCAATGGAGTCACTAGG + Intergenic
1110784052 13:79502426-79502448 CCAGCTTCAGTCCAGTCCCTGGG + Intronic
1113647730 13:112011017-112011039 CCAGCTGCACTGCAGTCCCTGGG + Intergenic
1114322230 14:21556798-21556820 AAACCTCCACTGCATTCCCCAGG - Intergenic
1114665467 14:24374998-24375020 GCAGCATCACTGCACTCCCCTGG - Intronic
1115956439 14:38785616-38785638 ACAGATTCACTGCAGCCAGCTGG - Intergenic
1116447530 14:45027846-45027868 ACAGTTTCACTGTATTGCCCAGG - Intronic
1117273365 14:54167579-54167601 ACAGGTCCACTGCAGTCCTAGGG + Intergenic
1118718430 14:68576586-68576608 ACTGTTTCCCTGCATTCCCCAGG - Intronic
1122175611 14:99916164-99916186 AGAACTTCATTGCAGTTCCCTGG - Intronic
1123849339 15:24339135-24339157 CCAGCAACACCGCAGTCCCCAGG - Intergenic
1123852533 15:24375087-24375109 CCAGCAACACCGCAGTCCCCAGG - Intergenic
1123868398 15:24546643-24546665 CCAGCAACACCGCAGTCCCCAGG - Intergenic
1124123130 15:26909515-26909537 ACAGCTTGACTGTAGCCTCCTGG - Intronic
1124545850 15:30626135-30626157 CCAGCTCCACTGCAGACACCCGG - Intronic
1125133419 15:36311978-36312000 ACAGCTTCTCTGTTGTCCCCAGG - Intergenic
1127313197 15:57770435-57770457 CCAGCTTCTCTGCTGTTCCCAGG + Intronic
1128109235 15:65066324-65066346 ACAGTGTCACTGCATTGCCCAGG - Intronic
1128270174 15:66302392-66302414 ACACCTTCACTTCAGACCCAGGG - Intronic
1128729217 15:70009487-70009509 ACAGCTTCCCTCCAGACTCCAGG + Intergenic
1130611924 15:85369188-85369210 ACAGCTTCACTGCAATTTCATGG + Intergenic
1132119592 15:99165557-99165579 TCTGCCTCACTGCAGACCCCAGG - Intronic
1134310566 16:13072042-13072064 TCCGCTTCTCTGCAGTGCCCGGG + Intronic
1134804091 16:17110050-17110072 ACAGCATGACTGCAGTACCTGGG - Intronic
1136480750 16:30540107-30540129 ACAGCCTGACTGTAGTCCCATGG + Intronic
1138340088 16:56283371-56283393 ACAGCTCCAGTGAAGGCCCCTGG - Intronic
1139443114 16:66979037-66979059 ATGGCTTCCCTGAAGTCCCCAGG - Intergenic
1139791716 16:69442972-69442994 AGAGCTTCACTGTATTGCCCAGG + Intronic
1141290706 16:82715996-82716018 TCAGCTTCCCTGCAGTCTGCTGG + Intronic
1141861354 16:86718584-86718606 CCTGCTTCCCTGCAGACCCCGGG + Intergenic
1142942431 17:3393075-3393097 ACAGTCTCACTGCAATGCCCAGG + Intergenic
1144853820 17:18257506-18257528 CCAGCATCACTGCACTCCCCTGG + Intronic
1145236098 17:21209367-21209389 CCATCTTCACTGCAGTCCTCTGG - Intronic
1147200731 17:38799659-38799681 GCAGCCGCCCTGCAGTCCCCTGG + Exonic
1147313385 17:39607540-39607562 ACACCTCCTCTGCAGCCCCCTGG + Intronic
1147623995 17:41887410-41887432 ACAGCCTCACTGCAATGCCTAGG - Intronic
1148775231 17:50091504-50091526 ACAGCCTTACTCCATTCCCCAGG - Intergenic
1151432262 17:74071519-74071541 ACAGCAGCACTCCTGTCCCCAGG - Intergenic
1151470793 17:74316521-74316543 ACAGCCTCAGTGCCGTCCTCAGG + Intergenic
1151617089 17:75220442-75220464 ACAGTTTCACTGTGTTCCCCAGG + Intronic
1152561792 17:81082338-81082360 AAAGCAGCACTGCAGACCCCGGG - Intronic
1152587683 17:81196306-81196328 CCAGCCTCACTGCCGGCCCCAGG + Intronic
1152900831 17:82940139-82940161 ACACCATCACTGCTGTTCCCAGG - Intronic
1153088687 18:1318847-1318869 ACAGCATCTCTGCATTCACCTGG + Intergenic
1153753424 18:8257002-8257024 ACTGCTTCTCCGCTGTCCCCTGG + Intronic
1157242634 18:46025401-46025423 CCAGCTCCACTGCTCTCCCCAGG + Intronic
1159289444 18:66396605-66396627 TGAGCTACGCTGCAGTCCCCTGG + Intergenic
1161112106 19:2476311-2476333 GCGGCTCCACGGCAGTCCCCAGG - Exonic
1161133965 19:2608733-2608755 ACAGCCTCAGTGCAGACCCCGGG - Intronic
1162923882 19:13919879-13919901 CCAGCTTCATGGCAGTCTCCAGG - Exonic
1163622340 19:18368614-18368636 ACACCTGCACTCCAGTGCCCTGG + Exonic
1165113290 19:33514273-33514295 ACAGCTTCACTGCAGTCCCCAGG - Intronic
1166964537 19:46520685-46520707 ACAGCCTCTCTGCATTCACCTGG + Intronic
925161853 2:1690192-1690214 ACAGCTTCCCTCCACTGCCCTGG + Intronic
926699030 2:15790432-15790454 CCTGCTTCACTGCAGTCCCAGGG - Intergenic
927826931 2:26315733-26315755 CCTGCCTCCCTGCAGTCCCCGGG - Exonic
928385324 2:30862721-30862743 GCAGCTTCACTCCAGTGCCCTGG - Intergenic
930711790 2:54557230-54557252 CCAGGTTCACCTCAGTCCCCAGG - Intronic
931862189 2:66367074-66367096 ACAGCTGGACTCCATTCCCCAGG - Intergenic
932832974 2:75008445-75008467 GCAGCTTCCCTCCAGTGCCCAGG - Intergenic
933253931 2:80059489-80059511 ACAGCTTTACTGGAGTCTCCCGG + Intronic
933698904 2:85240310-85240332 TCATCTCCACAGCAGTCCCCCGG - Intronic
934760331 2:96852028-96852050 ACAGCTTCACCACATTGCCCAGG - Intronic
939128901 2:138210864-138210886 ACATGTTCAATGCAGTCACCTGG - Intergenic
940236107 2:151512369-151512391 ACTGCACCACTGCAGTCCCCTGG - Intronic
940651024 2:156440990-156441012 TCAGCTTCACTCCAGACCTCCGG + Intronic
941699044 2:168584236-168584258 ACAGTTTCACTGCAGCTCACTGG - Intronic
941972335 2:171365166-171365188 ACAGCTCCACGGCATTCCACAGG + Intronic
942533044 2:176933437-176933459 ACAGCTTGCCTGCAGTTACCAGG - Intergenic
943446161 2:187990431-187990453 ACATCTCCTCTGCAGTTCCCAGG - Intergenic
946065526 2:216984034-216984056 ACTGTTTCCCTGAAGTCCCCAGG + Intergenic
948072917 2:235141833-235141855 ACACCTTCACAGCAACCCCCAGG - Intergenic
1168962344 20:1877902-1877924 CCAGCTTCACAGGAGGCCCCGGG + Intergenic
1169501136 20:6161906-6161928 ACAGCTACACTTCACTTCCCTGG + Intergenic
1171297143 20:24027771-24027793 ATAGATGCACTGCAGGCCCCTGG - Intergenic
1172402721 20:34663747-34663769 ACAGCTTTACTGGAGACCCAAGG + Intronic
1172971800 20:38879061-38879083 ACAGCTTCACTGCAGACCTAGGG - Intronic
1174517210 20:51101775-51101797 ACAGCACCACTGCAGTGCCCAGG - Intergenic
1175259341 20:57664745-57664767 ACAGCTTCACAGCCGGCTCCAGG - Intronic
1175488144 20:59360231-59360253 ACAGCTTTTCTGCAGCCTCCAGG + Intergenic
1175860805 20:62149111-62149133 ACAGATTCCCTGGAATCCCCGGG + Intronic
1175929207 20:62485663-62485685 ACAGCTACAGAGCAGTCCCCTGG - Intergenic
1176707953 21:10128935-10128957 CCAGCTTCATACCAGTCCCCAGG - Intergenic
1178289087 21:31351293-31351315 ACAGCTTCAGCCCAGTACCCAGG + Intronic
1179486801 21:41715804-41715826 CCAGCTCCACTGCGGTGCCCTGG - Intergenic
1179657752 21:42855720-42855742 CCAGCTGCACTGCTGTCACCTGG - Exonic
1179729512 21:43359965-43359987 TCAGGTTCTCTGCAGACCCCAGG - Intergenic
1179878777 21:44284919-44284941 TCAGCATCATTGCAGGCCCCAGG + Intergenic
1180140280 21:45889334-45889356 ACAGCTTCTAAGCAGGCCCCAGG - Intronic
1180673567 22:17571727-17571749 ACAGTCTCACTGCATTGCCCAGG - Intronic
1180866591 22:19123021-19123043 CCGGCTTCGCTGCAGTCTCCAGG - Intergenic
1181885523 22:26019108-26019130 ACACCTACACTGCTCTCCCCAGG + Intronic
1184390610 22:44201170-44201192 TCAGCTCCTCTGCAGTCCCTCGG + Intronic
1184599966 22:45537710-45537732 ACAGCTTCCCTGTCATCCCCTGG + Intronic
1184616475 22:45641414-45641436 GAAGGTTCAGTGCAGTCCCCAGG + Intergenic
1185277472 22:49956032-49956054 CCACCATCACTGCAGCCCCCGGG + Intergenic
950221029 3:11196233-11196255 GCAGCCTCACTGCAGTTGCCCGG + Intronic
950255297 3:11499793-11499815 GCAGATTCACTGCAGTGCCCAGG + Intronic
951695488 3:25441678-25441700 ACAGCTTTACTGCAAACACCTGG + Intronic
952109444 3:30105547-30105569 AGAGTTTCACTGCATTGCCCAGG - Intergenic
952736530 3:36696990-36697012 ACAGCCTCACAGCTGTCTCCAGG + Intergenic
952795616 3:37236101-37236123 ACAGCATGACTGCAGTTCCCTGG - Intergenic
954129352 3:48552209-48552231 ACAGCTTCCCAGAAGTGCCCAGG - Intronic
959580445 3:107977726-107977748 TCAGCCTCTCTGCAGTCCCTTGG + Intergenic
960025793 3:113007786-113007808 ACAGCTTCAGTGCAGTGCAGTGG - Intronic
963141664 3:141950749-141950771 AAAGATTCCCTGCAGGCCCCTGG + Intergenic
963585304 3:147179208-147179230 GCAGCTGCCCTGCAGTCCCATGG + Intergenic
966208303 3:177427083-177427105 ACAGCTTCACTGCAACCTCATGG - Intergenic
967277503 3:187790856-187790878 ACTGCCTAACTGCAGTTCCCAGG + Intergenic
967928690 3:194674004-194674026 ACAGCTTGCCAGCAGTCCCTTGG - Intergenic
969054932 4:4395711-4395733 ACAGCTTCTGTGCAGCTCCCTGG + Intronic
969212216 4:5696499-5696521 ACAGTTCCAGTGCAGGCCCCTGG - Intronic
969524288 4:7696248-7696270 ACAGCTTCAATGCCGTCATCAGG + Intronic
969732031 4:8963297-8963319 AGAGCATCACTGCAGCCCACGGG + Intergenic
972017001 4:34260140-34260162 ACAGCTTCAGTGGAGTTCCAGGG - Intergenic
972282499 4:37616389-37616411 ACAGCATCACTGGAATCCTCTGG + Intronic
974691978 4:65307717-65307739 ACATCTTGTCTGCAGTCCCCTGG - Intergenic
978380500 4:108123334-108123356 AAATTTTCACTGCAGTTCCCTGG + Intronic
979786095 4:124717276-124717298 ACATCATCACTACAGTTCCCTGG - Intergenic
982224227 4:153151562-153151584 ACAGCTTCACTCTATTGCCCAGG - Intergenic
983628380 4:169826026-169826048 ACAGCTACTCTGCACTTCCCTGG - Intergenic
985163415 4:187067746-187067768 ACAGTTTCACTCCATTGCCCAGG + Intergenic
986112872 5:4737885-4737907 ACATCTTGACTGCAGCCTCCTGG - Intergenic
988689938 5:33561817-33561839 GCAGCTTGCCTGCAGCCCCCTGG - Intronic
990297070 5:54412963-54412985 ACAGCTTCCCTGCTGCGCCCTGG - Intergenic
991300734 5:65126746-65126768 TCAGCTTCACTGCAGTTTCCTGG + Intergenic
998456869 5:142280463-142280485 AGAGTTTCACTGCAGTCCCCAGG - Intergenic
999657352 5:153823848-153823870 AGACATTCACTGCAGTCACCTGG - Intergenic
1004368084 6:15028918-15028940 AGAGCTTCTCTGCACTCTCCAGG - Intergenic
1006161057 6:32040784-32040806 ACATTTTCACGGCAGGCCCCCGG - Intronic
1008731712 6:54491126-54491148 ACAGCGTCACTGGACTCACCTGG - Intergenic
1008731814 6:54491902-54491924 ACAGGTTCTCTGCTGTCCCAAGG + Intergenic
1015255258 6:131172149-131172171 ATAGCTTCAGTGAAGTCCCTAGG + Intronic
1015364780 6:132385507-132385529 ACAGTTTCACTCCATTACCCAGG + Intronic
1016907575 6:149166987-149167009 AGAGCTGCACTGCAGCCCTCAGG - Intergenic
1016969527 6:149749590-149749612 CCGGCCTCCCTGCAGTCCCCTGG + Exonic
1017738799 6:157386399-157386421 ACAGCTTCACAGAGGTTCCCTGG - Intronic
1017838532 6:158202403-158202425 ACAGCAGCACTGCCATCCCCTGG - Intergenic
1018227254 6:161640046-161640068 ACAAGACCACTGCAGTCCCCAGG - Intronic
1018420026 6:163633180-163633202 ACACCTTGGCTGCAGCCCCCTGG - Intergenic
1018913613 6:168118977-168118999 ACAGCTTCACAGCAGCCCATGGG + Intergenic
1019723823 7:2589582-2589604 ACATCTTCCCTCCTGTCCCCTGG - Intronic
1022334105 7:29406494-29406516 ACAGCTGCACTGGACTCCACAGG - Intronic
1023892830 7:44405820-44405842 ACGGCCTCACTGCATTGCCCAGG + Intronic
1028269135 7:88766267-88766289 GCCACTTCACTGCAGCCCCCAGG + Intronic
1028740332 7:94267339-94267361 ACAGTTTCACTCCATTACCCAGG - Intergenic
1031605636 7:123764006-123764028 ACAGTTTCACTCCAATGCCCAGG + Intergenic
1032584692 7:133135352-133135374 AGAGCTTCATTCCAGGCCCCAGG + Intergenic
1034099779 7:148440555-148440577 ACCGCTTCACAGCAGCCCCAAGG - Intergenic
1034729313 7:153370247-153370269 GCAGCTTCCCTGCACTCCCCAGG - Intergenic
1034730063 7:153379409-153379431 ACAGCTTCATTCCAGAACCCAGG + Intergenic
1035077132 7:156187543-156187565 CCAGCAACACTGCAGTCCCCAGG + Intergenic
1037260583 8:17002601-17002623 ACAGCATCACCGCTGTCCCAAGG - Intergenic
1038104259 8:24415272-24415294 ACGGCTTTACTGCAGGCCTCCGG + Intergenic
1040351750 8:46575936-46575958 TTAGCCTCACTGCAGTCCCTGGG + Intergenic
1040364925 8:46705510-46705532 TTAGCCTCACTGCAGTCCCTGGG - Intergenic
1041522060 8:58767861-58767883 ACTGCTTCACTTCATCCCCCAGG + Intergenic
1043516037 8:80996088-80996110 TCAGATGCACTGCAGTCCTCAGG + Intronic
1043830553 8:84983495-84983517 AAAGCTTCACTTCAGACCCTCGG + Intergenic
1044345836 8:91103217-91103239 AAAGCTTCAGGACAGTCCCCAGG - Intronic
1044618352 8:94165173-94165195 ACAGCTCCACTGCTGTGCTCTGG + Intronic
1045254614 8:100509226-100509248 ACAGCTCTACGGCATTCCCCAGG - Intergenic
1045345335 8:101288795-101288817 TCATCCTCACTGCAGACCCCTGG - Intergenic
1047210694 8:122837683-122837705 AGAGCTTCATTTCAGTCCCTTGG + Intronic
1047771697 8:128035153-128035175 ACAGGTTTACTGCTGTGCCCTGG - Intergenic
1047784607 8:128141831-128141853 ACAGCTTCACAGGTGTGCCCAGG - Intergenic
1048342670 8:133552892-133552914 CCAGCTTCACAGCAGTCCTCTGG + Intronic
1048880818 8:138871164-138871186 CCAGCCTCCCTGCCGTCCCCTGG + Intronic
1049050281 8:140189233-140189255 ACAGTTTCCCTGCTGTCTCCAGG + Intronic
1049498141 8:142946285-142946307 ACAGCAGCACTGCCGGCCCCTGG - Intergenic
1049758855 8:144322818-144322840 ACAGCCTCACTGCATGGCCCAGG - Intronic
1050667187 9:7952903-7952925 ACAGCTGCACTCCAGAGCCCAGG + Intergenic
1053165090 9:35838930-35838952 ACAGCTTCTCTGCTTTCTCCAGG + Intronic
1053760833 9:41349181-41349203 CCAGCTTCATACCAGTCCCCAGG + Intergenic
1054816939 9:69484440-69484462 ACCACTTCCCTGCAGACCCCGGG + Intronic
1055058309 9:72043756-72043778 ACATGTTCACTGCTGCCCCCTGG + Intergenic
1056332315 9:85531127-85531149 ACCCCTTCACAGCAGTACCCAGG + Intergenic
1057571773 9:96209463-96209485 ACAGCTTGACTGCAGCCTCATGG + Intergenic
1058136422 9:101312947-101312969 ACAGGGCCACTGCAGTGCCCAGG - Exonic
1059006827 9:110411518-110411540 CCAGCTTCTCTGCAATGCCCAGG - Exonic
1059973618 9:119693000-119693022 CCATCTTCACTGCAGCCTCCTGG - Intergenic
1060782629 9:126424027-126424049 ACAGGTTCACTGCAGACTTCAGG + Intronic
1061701921 9:132422620-132422642 GCTGCTTCACTGCAGCCCCCTGG - Intronic
1202792698 9_KI270719v1_random:97815-97837 CCAGCTTCATACCAGTCCCCAGG - Intergenic
1185586405 X:1244751-1244773 ACAGCTTGACTCCAGCCCCGGGG + Intergenic
1185732834 X:2474979-2475001 ACATCTTCAGTGCATTCCCTTGG - Intronic
1185733321 X:2478490-2478512 ACATCTTTAGTGCAGTCCCTTGG - Intronic
1186482407 X:9905979-9906001 GCAGCGGCACTGCAGTGCCCTGG + Intronic
1186522703 X:10220365-10220387 ACTGCTTCACCGCAGACTCCGGG - Intronic
1187709829 X:22042044-22042066 ACAGCTGTTCTGCAGACCCCTGG - Intronic
1187877862 X:23819087-23819109 TCAACTTGACTACAGTCCCCAGG + Intergenic
1188625849 X:32284288-32284310 ATAGCTTCATTCCATTCCCCAGG + Intronic
1190167375 X:48084389-48084411 AAAACTTCACTGCAGGCCCTGGG - Intergenic
1192380872 X:70614548-70614570 ACAGCTTCTCTGGACTCACCTGG + Intronic
1192449333 X:71233677-71233699 ACATCTTCCCTGCACTCCCCAGG - Intergenic
1194717526 X:97304407-97304429 ACAGCTTCACTGCAGTCCCATGG - Intronic
1197727543 X:129786323-129786345 ACTGCTACACTGCAGTCCCCAGG + Intronic
1198944006 X:141989436-141989458 ACAGCTTGACTGCAACCCCATGG + Intergenic