ID: 1165113292

View in Genome Browser
Species Human (GRCh38)
Location 19:33514304-33514326
Sequence CCGTGCTGTGCTGTGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165113292_1165113299 -8 Left 1165113292 19:33514304-33514326 CCTGCCCTCACAGCACAGCACGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1165113299 19:33514319-33514341 CAGCACGGTGAAGTGGTCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 158
1165113292_1165113301 16 Left 1165113292 19:33514304-33514326 CCTGCCCTCACAGCACAGCACGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1165113301 19:33514343-33514365 ACCTCACACTCACCTCACATGGG 0: 1
1: 0
2: 1
3: 17
4: 160
1165113292_1165113297 -10 Left 1165113292 19:33514304-33514326 CCTGCCCTCACAGCACAGCACGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
1165113292_1165113303 27 Left 1165113292 19:33514304-33514326 CCTGCCCTCACAGCACAGCACGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1165113303 19:33514354-33514376 ACCTCACATGGGACCCTCAGAGG 0: 1
1: 0
2: 0
3: 22
4: 142
1165113292_1165113300 15 Left 1165113292 19:33514304-33514326 CCTGCCCTCACAGCACAGCACGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1165113300 19:33514342-33514364 CACCTCACACTCACCTCACATGG 0: 1
1: 0
2: 0
3: 31
4: 254
1165113292_1165113298 -9 Left 1165113292 19:33514304-33514326 CCTGCCCTCACAGCACAGCACGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1165113298 19:33514318-33514340 ACAGCACGGTGAAGTGGTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165113292 Original CRISPR CCGTGCTGTGCTGTGAGGGC AGG (reversed) Intronic
900287910 1:1910568-1910590 CTGTGCGGTGCTGGGAGTGCAGG + Intergenic
900319673 1:2076331-2076353 CCAGCCTGTGCTGTGAGGGACGG - Intronic
901653642 1:10756820-10756842 CGTTGGTGAGCTGTGAGGGCTGG - Intronic
902247669 1:15131957-15131979 GGGTGCTGTGCTGTGAGGGCCGG - Intergenic
903741950 1:25563533-25563555 CCGGGCTCTGCTGGGAGGCCTGG + Intronic
904120336 1:28193965-28193987 CCGGGCTCTGCTGGGTGGGCAGG + Intergenic
904322480 1:29706895-29706917 CTCTGCTGTCCTGGGAGGGCGGG - Intergenic
904376740 1:30086402-30086424 CTCTGCTGTCCTGGGAGGGCGGG + Intergenic
904445950 1:30573030-30573052 CAGTGCTGTGATTTGAGTGCAGG - Intergenic
904826291 1:33275956-33275978 GCCTGCTGTGCTGTGAGGCTGGG + Intronic
904841089 1:33372411-33372433 CCGTGCTGGGCTGTCTGTGCAGG + Exonic
905797695 1:40824665-40824687 CCATCCTGGGGTGTGAGGGCAGG + Intronic
906903232 1:49861031-49861053 CAGTGCTGTTCTGTTAGAGCTGG + Intronic
908386083 1:63643275-63643297 CTGTGCTCATCTGTGAGGGCAGG + Intronic
909756576 1:79232872-79232894 CTGTGCTGTGCTGTGCAGGTTGG + Intergenic
911057781 1:93722711-93722733 CCGGGCTGGGCTCTCAGGGCAGG + Intronic
913263045 1:117018221-117018243 CTGTCCTGTGTCGTGAGGGCCGG + Exonic
914463440 1:147906004-147906026 CCAGCCTGTGCTGTCAGGGCAGG - Intergenic
915106417 1:153537483-153537505 CCATGCAGTGGTGCGAGGGCAGG - Intronic
915626305 1:157115974-157115996 CTGAGCTGGGCTGTGGGGGCGGG + Intergenic
915724971 1:158010991-158011013 CAGAGCTGAGCTGTGGGGGCAGG + Intronic
917061820 1:171049428-171049450 CAGTGCTGTCCTGTTAGAGCGGG + Intronic
919855448 1:201703324-201703346 CCGGGCTGGGCTCAGAGGGCTGG - Intronic
924383300 1:243482669-243482691 CTACGCTGTGCTGTGAGGGCCGG + Intronic
1064658498 10:17580631-17580653 CCTGGCAGTGCTGTTAGGGCAGG - Intergenic
1065047029 10:21754112-21754134 CAGAGCTGTGCTCTGAGAGCTGG + Intergenic
1066203066 10:33160377-33160399 TCCTGCTGAGCTGTGAGAGCGGG - Intergenic
1067079552 10:43205423-43205445 CAGTGCTCTGCTGACAGGGCAGG + Intronic
1067842253 10:49690356-49690378 GCCTGCTGTGCGGTGAGTGCTGG - Intronic
1070919070 10:80172691-80172713 CTGGGCCGTGCTGTGAGGGGAGG + Intronic
1072660608 10:97361367-97361389 GCGTGCTGTGCAGGGAGGGCAGG + Intronic
1072782252 10:98258971-98258993 CCAAGCTGTGGTGTGAGTGCAGG + Intronic
1075647143 10:124104082-124104104 CCCTGCAGCGCTGTCAGGGCAGG - Intergenic
1075983981 10:126767249-126767271 AGGTACTGTGCTGTGAGGGATGG - Intergenic
1076018028 10:127044761-127044783 CCATGCTGTGCTGTTGGGGAAGG + Intronic
1076512585 10:131023023-131023045 CTGTGCTGTGTTATCAGGGCTGG - Intergenic
1076573938 10:131451648-131451670 CCCAGCAGTGCTGTGAGGTCAGG - Intergenic
1077142456 11:1030562-1030584 CCGGCCTGTGCTGTGAGTCCAGG - Exonic
1077231704 11:1460733-1460755 CAGTGCTGTGCTGGGGGGGGGGG - Exonic
1077740309 11:4839047-4839069 CAGTGCTGTCCTGTTAGAGCAGG + Intronic
1078596781 11:12694059-12694081 CCCTGCTCTGCTGTGCGGCCCGG + Intronic
1080836391 11:35944361-35944383 TCGTGTTGTGCTGTGTGCGCGGG + Intronic
1082005021 11:47414587-47414609 TGGGGCTGGGCTGTGAGGGCTGG + Intronic
1083111253 11:60410052-60410074 TCTTGCTATGCTGTCAGGGCTGG + Intronic
1083489810 11:63007998-63008020 GCGTGCCGTGCTCTGAGGCCTGG + Intronic
1084356492 11:68642026-68642048 CCGTGCTGGCCTGAGATGGCTGG - Intergenic
1085516767 11:77116208-77116230 CCGAGCTGGGGTGTCAGGGCCGG - Exonic
1085537212 11:77229302-77229324 CCTTGCTCTGCTGCCAGGGCTGG + Intronic
1086902640 11:92385024-92385046 CCATGCTGTGCTGTGCAGTCAGG - Intronic
1087453529 11:98353915-98353937 CCCTTCTGAGCTGTTAGGGCAGG - Intergenic
1091321680 11:134656608-134656630 CCCGGCTGTGCTGTGAGTGTGGG + Intergenic
1091321770 11:134656944-134656966 CCCGGCTGTGCTGTGAGTGTGGG + Intergenic
1091321776 11:134656972-134656994 CCCGGCTGTGCTGTGAGTGTGGG + Intergenic
1091393972 12:142394-142416 TGGTGCTGGGTTGTGAGGGCTGG + Intronic
1091399824 12:175048-175070 CCCTGCTGTCCTGGGAGGGCTGG + Exonic
1096365559 12:51026167-51026189 CCGTGCGGGGCTGTGAGGGGAGG - Intronic
1104769149 12:131349874-131349896 CCGTGCTGGGCTGGTGGGGCAGG + Intergenic
1108519658 13:51234902-51234924 CTGTGCAGTTCTGTGAGGGGAGG - Intronic
1108989751 13:56640252-56640274 CAGTGCTGTTCTGTTAGAGCAGG + Intergenic
1114278673 14:21170080-21170102 CTGTGGTGTGCTGTAAGCGCAGG - Intergenic
1118262163 14:64257811-64257833 CCTTGGTTTTCTGTGAGGGCTGG - Intronic
1118499826 14:66349636-66349658 CCATGCTGTGCTGTTGGGGAGGG - Intergenic
1121124579 14:91397833-91397855 ACGTGCTGTCCTGTAAAGGCTGG - Intronic
1121547617 14:94773276-94773298 CCATGCTGAGCTGTGCGTGCGGG - Intergenic
1122279427 14:100612459-100612481 CCAGGCTTTGCTATGAGGGCTGG + Intergenic
1122551638 14:102553222-102553244 GCATGGTGTGCTGTAAGGGCAGG - Intergenic
1123026436 14:105426472-105426494 CCTTGCTGTCCTCTGAAGGCAGG - Intronic
1123108186 14:105852639-105852661 CTGCCCTGTGCTGTGGGGGCTGG + Intergenic
1123488213 15:20759704-20759726 TGGTGCTGTGCTGTGAGGCTGGG + Intergenic
1123544711 15:21328777-21328799 TGGTGCTGTGCTGTGAGGCTGGG + Intergenic
1123697868 15:22892027-22892049 CCGGGCTCTGCGGTGGGGGCAGG - Intronic
1127812501 15:62576858-62576880 CCTTGCTGTCCCGTGAGAGCAGG + Intronic
1128095013 15:64947475-64947497 CCGTTCTGTGCTGTGGCGGCTGG + Exonic
1129771874 15:78207938-78207960 CTGTGCTGTGCTGGGTGTGCTGG - Intronic
1130063292 15:80584751-80584773 CCGTGGGGTGCTGTCAGGACTGG - Intronic
1130956720 15:88632031-88632053 CTGTGCTGTGCTGACAGGGAGGG - Exonic
1202953055 15_KI270727v1_random:56048-56070 TGGTGCTGTGCTGTGAGGCTGGG + Intergenic
1132638885 16:968019-968041 CCCTGCTGTGCTGTGGGAGCCGG - Intronic
1133770378 16:8864303-8864325 GCGTGCTGTGCGGTGAGGTGAGG - Intronic
1135850269 16:25957144-25957166 CAGTGCTTTGCGGTCAGGGCTGG + Intronic
1136173401 16:28502068-28502090 CCATGCCCTGCTGGGAGGGCTGG - Exonic
1137828854 16:51524931-51524953 CCTTGCTGAGCTGTGAAGCCTGG - Intergenic
1139451309 16:67029649-67029671 CGGCGCTGCGCTGGGAGGGCGGG + Intronic
1139967929 16:70755919-70755941 CCGAGCTGTGCTGTGAGGAATGG - Intronic
1140475545 16:75237867-75237889 CCATGCTGTGCTGTGGGGCAGGG - Intronic
1141576149 16:84964607-84964629 ACGTGCTGCCCTGGGAGGGCTGG + Intergenic
1141678343 16:85529550-85529572 CCCTGCTATGCCGAGAGGGCAGG + Intergenic
1141966925 16:87451969-87451991 CCGTGCCGTGCAGGGAGAGCCGG - Intronic
1142156757 16:88535806-88535828 CCCTGCTGGGCTGTATGGGCCGG + Exonic
1142243969 16:88960217-88960239 ACCTGCTGGGCTGGGAGGGCAGG + Intronic
1142581697 17:947048-947070 CCGTGCTGGGCCCTGAGTGCTGG - Intronic
1142830974 17:2548847-2548869 CCTTTCTGTGCTGTGGAGGCTGG + Intergenic
1143120643 17:4604422-4604444 CCCTGCTCTGCTGTGCTGGCTGG - Intronic
1143585381 17:7848042-7848064 CTGTGCTGGGCTGGGAGGCCGGG - Exonic
1145269816 17:21398798-21398820 CAGAGCTGTGGTGTGAGAGCAGG + Intronic
1146457300 17:33017834-33017856 CAGAGCTGTGCCGTGAGGGAAGG - Intronic
1146793478 17:35765818-35765840 CCATCCTTTGCTGTGAGAGCAGG - Intronic
1147019598 17:37520896-37520918 CCGTGCAGTGCCATGAGTGCTGG + Intronic
1147497232 17:40928237-40928259 CCGTGCTGTACTGTGTCTGCAGG + Exonic
1148610584 17:48961988-48962010 CCGTGCTGACCAGAGAGGGCGGG + Intronic
1151608982 17:75158713-75158735 CTGTTCTGAGTTGTGAGGGCTGG + Intronic
1152679099 17:81656513-81656535 GGGGGCTGTGCTGTGAGTGCTGG + Exonic
1152726379 17:81948799-81948821 CCCTGCCGTGCTGTGGGAGCTGG - Intergenic
1153788786 18:8558475-8558497 TCCTGCTCTGCTGTGAAGGCTGG - Intergenic
1154297844 18:13165808-13165830 CGGTGCTGTCCTGTGGGGGATGG + Intergenic
1154445858 18:14434967-14434989 TGGTGCTGTGCTGTGAGGCTGGG + Intergenic
1155415435 18:25593800-25593822 CCATGCAGTGCTTTGAGGGTTGG + Intergenic
1157954442 18:52081454-52081476 CAGTGCTGTCCTGTTAGAGCAGG + Intergenic
1160733773 19:652644-652666 CCGTTCTCTTCTGTGATGGCCGG - Intronic
1161170983 19:2812463-2812485 CCCTGCTGGGCTGTGAAGACAGG - Intronic
1163655127 19:18541591-18541613 CCCATCTGTGCTGTGAGGGTTGG - Intronic
1163676275 19:18656790-18656812 CCGCCCTGTGCTGGGAGGGCAGG - Intronic
1164548399 19:29187771-29187793 CCCAGCTGTCCTGTGAGGGAAGG - Intergenic
1165113292 19:33514304-33514326 CCGTGCTGTGCTGTGAGGGCAGG - Intronic
1167713712 19:51127401-51127423 CTGTGCTCAGCTGTGAGGTCTGG + Intronic
1167716595 19:51146218-51146240 CTGTGCTCAGCTGTGAGGCCTGG + Intronic
1167761955 19:51455299-51455321 CTGTGCTCAGCTGTGAGGCCTGG - Intronic
1168113749 19:54209385-54209407 CCCGGCTGTGCTGAGAGGGAGGG + Intronic
1168116329 19:54222948-54222970 CAGAGCAGGGCTGTGAGGGCGGG + Exonic
1168138700 19:54369959-54369981 ACGTGCTGAACTGTGAGGACCGG - Intronic
926830017 2:16951506-16951528 CCCTGCTATGCTGTGGGGGAAGG - Intergenic
927199822 2:20571335-20571357 TCAGGCTGTGCTGTGAGGGAGGG - Intronic
927574486 2:24190051-24190073 CTGTGCTTTCCTGTGAGTGCTGG + Intronic
927955498 2:27204780-27204802 GGCTGCTGTGCTGTGAGTGCAGG - Exonic
930031910 2:47063628-47063650 CCCTGCTGTGGAGTCAGGGCAGG + Intronic
930766325 2:55089353-55089375 CAGTGCTGTCCTGGGAGGGGAGG - Intronic
930990742 2:57650889-57650911 CAGTGCTGTTTTGTGAGGCCTGG - Intergenic
932432327 2:71683385-71683407 CCCTGATGAGCTGTGCGGGCTGG - Intronic
932591738 2:73071574-73071596 CCGGGCTGTGGTCTGCGGGCCGG - Intronic
933586092 2:84180801-84180823 GCATGCTGTGGTGTGAGGGGAGG - Intergenic
934517056 2:94995233-94995255 GTGTGCTGTGCTGTGTGTGCTGG + Intergenic
934937432 2:98475685-98475707 GCATGCTGGGCTGTGTGGGCAGG + Intronic
936152010 2:110027167-110027189 CCTTGCTGTTCTGTGGTGGCTGG + Intergenic
936192668 2:110344246-110344268 CCTTGCTGTTCTGTGGTGGCTGG - Intergenic
937914483 2:127092215-127092237 CCGTCCTGTGCTGTGTGGTAAGG + Intronic
938317742 2:130341806-130341828 CCATGCTGGGCTGGGTGGGCGGG - Intronic
938370360 2:130764388-130764410 CTGTGCTGAGCTGCAAGGGCTGG - Exonic
944618339 2:201485132-201485154 CAGTGCTGTGCCATGAGGGAAGG - Intergenic
946560150 2:220903848-220903870 CCGGGCTCTGCTTTGAGGACAGG - Intergenic
947670759 2:231934057-231934079 CCCTGCTGTGCCCTGAGGCCCGG - Intergenic
947870469 2:233434765-233434787 CCATGCTGTACTGGGTGGGCTGG - Exonic
948213822 2:236214418-236214440 CCGTGCGCTGCGGTGAGGCCTGG + Exonic
948686252 2:239671521-239671543 CCTTCCTTTGCTGTGAGAGCAGG + Intergenic
1169690566 20:8326387-8326409 TTGTGCTGTGCTGTAAGCGCTGG - Intronic
1172114436 20:32565196-32565218 CCTGGCTGGGCTGGGAGGGCGGG - Intronic
1175721238 20:61288705-61288727 CCTTCATGTGCTGTGAGGTCTGG - Intronic
1176126550 20:63478050-63478072 CCGTGGTCAGCTGTGACGGCTGG + Intergenic
1176163710 20:63662018-63662040 CCATGCTGTGCTGTGGTGGAGGG + Intronic
1176450119 21:6854890-6854912 TGGTGCTGTGCTGTGAGGCTGGG - Intergenic
1176828288 21:13719908-13719930 TGGTGCTGTGCTGTGAGGCTGGG - Intergenic
1180750233 22:18119483-18119505 ACTTGCTGTGCTGTGTGGCCTGG - Intronic
1183271358 22:36864554-36864576 CCTGGCTGTGCTGTGGGTGCAGG - Intronic
1183676115 22:39299677-39299699 CTGTGCAGTGGTGTGAGGGCTGG - Intergenic
1184130240 22:42513126-42513148 CCCAGCTCTGCTGTGGGGGCAGG + Intronic
1184140416 22:42574949-42574971 CCCAGCTCTGCTGTGGGGGCAGG + Intergenic
1184248821 22:43248954-43248976 CTGTGCTGTGCCCTGAGGGGGGG + Intronic
1184497209 22:44848910-44848932 CAGTGCTGTGTTGTGTGTGCAGG + Exonic
1185139737 22:49093577-49093599 CCTTGGTGTGCAGTGAGGCCGGG - Intergenic
1185272055 22:49934337-49934359 GCGTGCTGAGCTGTGAGGAGGGG + Intergenic
950601032 3:14035672-14035694 CTGTGGTGTGCTGTAAGGTCAGG + Intronic
950658254 3:14450675-14450697 TCGGCCTGTGCTGTGAAGGCAGG - Intronic
951984584 3:28604034-28604056 CAGTGCTGAGCTGTGAGGGGTGG - Intergenic
952023270 3:29048601-29048623 CCCTGCTTTGTAGTGAGGGCTGG + Intergenic
953457731 3:43055976-43055998 CCTGGCTTTGCTGTGAAGGCAGG - Intronic
954274900 3:49535757-49535779 CATTTCTGTGCTGGGAGGGCTGG + Intergenic
958862257 3:99458113-99458135 CAGTGCTGTCCTGTTAGAGCAGG - Intergenic
961060555 3:123824951-123824973 TCTTGCTGTGTTGTCAGGGCTGG - Intronic
962343025 3:134601278-134601300 CCCTGCGGTGCTTTGAGGGGCGG + Intronic
962474967 3:135747511-135747533 CCTTGCTATGGTGTGTGGGCGGG - Intergenic
965659554 3:171027081-171027103 CCGTGCTGTGCTGTGGAGCATGG + Intergenic
967316130 3:188153821-188153843 CCGTGCGGTGCCCTGAGCGCTGG - Intronic
967971909 3:195005431-195005453 CCAGGTGGTGCTGTGAGGGCAGG + Intergenic
968137910 3:196232360-196232382 GCGTTCTGTGCCGTGAGGGCAGG + Intronic
968524988 4:1052193-1052215 CCCTGCGCTGCTGTGAGGACAGG - Intergenic
968754438 4:2408160-2408182 CATTGCTGTCCAGTGAGGGCAGG - Intronic
968808296 4:2788754-2788776 CAGTGCTGGGCTGTGTGGCCAGG + Intergenic
969045620 4:4334438-4334460 CAGGGCTTTGCTATGAGGGCGGG - Intergenic
969160621 4:5255056-5255078 CCCTACTGGGCTGTGAGGTCTGG - Intronic
969414691 4:7050694-7050716 CCGTGATGTGCAGTGAACGCAGG - Intronic
972243740 4:37222915-37222937 CAGTGCTGTGCTGTGGGCACTGG - Intergenic
973534636 4:51868261-51868283 CCATTCTGAGCTGTGGGGGCAGG - Intronic
976254324 4:83084262-83084284 CAGTGCTGTCCTGTTACGGCAGG - Intergenic
978808078 4:112821242-112821264 TCTTGCTGTGTTGTCAGGGCTGG + Intronic
980733179 4:136848498-136848520 AAGTGCTGTGCTGGGAGGTCTGG + Intergenic
982026650 4:151258630-151258652 CCCTGCTGTCCTGGGAGAGCAGG - Intronic
982028583 4:151276932-151276954 CCCTGCTGTCCTGGGAGAGCAGG - Intronic
985558162 5:568289-568311 CAGGGCTCTGCTGTGAGTGCAGG - Intergenic
992086852 5:73285152-73285174 CCCTACTGAGCTGGGAGGGCTGG + Intergenic
994106602 5:95956507-95956529 CAGTGCTGTGCTGGCAGGTCTGG + Intronic
995229601 5:109744203-109744225 CCCTGCTGTTTTCTGAGGGCTGG - Intronic
997581208 5:135018576-135018598 CTGTGCTGTGGGGTGAGGGGTGG + Intergenic
997950840 5:138241640-138241662 CCATGAAGTGCTGTGAGGGTGGG + Intergenic
999515427 5:152297347-152297369 CAGTAATGTGCTGTGAGGCCTGG - Intergenic
1001158587 5:169294427-169294449 CTGGGCTCTGCTGTGGGGGCAGG + Intronic
1002445767 5:179288900-179288922 CCGTGCTGTGCTGTGCAGGCAGG - Intronic
1002459833 5:179367827-179367849 CCTTGCTGTGCGGGGAGGGGCGG - Intergenic
1006106517 6:31720148-31720170 CTGTGCTGGGCTGTGTGGACCGG - Exonic
1006190118 6:32202330-32202352 CCCTGGAGAGCTGTGAGGGCAGG + Exonic
1007277908 6:40689141-40689163 CCGCTCTGTGCTGTGGGGGGTGG + Intergenic
1008519059 6:52345443-52345465 CAGTGCTGTGGTGTGAGGGAGGG + Intergenic
1011791303 6:90902014-90902036 CTGTGCTGAGCTGTGAGAGCAGG + Intergenic
1017084796 6:150704176-150704198 TGGTGCTGTCCTCTGAGGGCAGG + Intronic
1017487604 6:154917526-154917548 CCATGCATTGCTGGGAGGGCTGG + Intronic
1018904176 6:168065453-168065475 CCGTGCTGGGCGGTGAGCTCTGG - Intronic
1019108522 6:169690398-169690420 CCCTGCTGTGTTGTAAGAGCTGG - Intronic
1019328614 7:452026-452048 CCGTGCTCTGCTCTTGGGGCGGG - Intergenic
1024507908 7:50178527-50178549 CGGTGCTCTGCTGAGAGAGCAGG + Intergenic
1026774982 7:73225836-73225858 CCGAGAGGTGCTGGGAGGGCAGG - Intergenic
1026905619 7:74061183-74061205 CAGTCCTGTGCTGTCAGGGATGG - Intronic
1027489563 7:78805878-78805900 GACTGCTGTGATGTGAGGGCTGG - Intronic
1034558913 7:151867218-151867240 CTGCGCTGTGCTTTGAGGGCAGG + Intronic
1035204255 7:157284554-157284576 TCGTGCTGTGTTGCCAGGGCTGG + Intergenic
1035466994 7:159085905-159085927 CCGCGCGATGCTGTGATGGCGGG + Intronic
1037156365 8:15704347-15704369 CGGTGCTGTGCTGTGGGGCAGGG + Intronic
1041874782 8:62675572-62675594 CCATGCTGGGCTTTGAGGGCTGG + Intronic
1042647462 8:71003588-71003610 CTGTGTTGTGCTTTGGGGGCTGG + Intergenic
1043340374 8:79230258-79230280 CAGTGCTGTCCTGTTAGAGCAGG - Intergenic
1043481744 8:80660013-80660035 CCCTGCTATACTGTGAGGGTGGG + Intronic
1047015269 8:120717599-120717621 CCGTTCTCTGCTGCAAGGGCTGG - Intronic
1049272738 8:141704606-141704628 CACTGCTGTCCTGTGAGGACAGG + Intergenic
1049597565 8:143491760-143491782 CCGTGCAGGGCTGTGGGGCCGGG + Intronic
1049599351 8:143499883-143499905 GCCTCCTGGGCTGTGAGGGCCGG - Intronic
1049616417 8:143577574-143577596 CCGTGCTGGACTGTGGCGGCGGG - Intronic
1052641275 9:31167972-31167994 ACATGCTGTTCTGGGAGGGCTGG + Intergenic
1053165523 9:35841386-35841408 CCGCTCTGTGCTGGGAGGGAGGG - Intronic
1053167421 9:35854304-35854326 CTGTGCTGTGCTGTGGAGGAGGG + Exonic
1053546900 9:39032605-39032627 CCTTGCTGTTCTGTGAGAGTGGG + Intergenic
1053808015 9:41822933-41822955 CTGTTCTGTGAAGTGAGGGCCGG - Intergenic
1053811219 9:41854258-41854280 CCTTGCTGTTCTGTGAGAGTGGG + Intergenic
1054619375 9:67333181-67333203 CCTTGCTGTTCTGTGAGAGTGGG - Intergenic
1054622577 9:67364495-67364517 CTGTTCTGTGAAGTGAGGGCCGG + Intergenic
1054804379 9:69383827-69383849 CCCTGCTGTTCTCTGGGGGCAGG - Intronic
1056786157 9:89593934-89593956 ACATATTGTGCTGTGAGGGCTGG + Intergenic
1057311844 9:93947955-93947977 CCGGGCTGAGCTGGGAGGGAGGG + Intergenic
1059653028 9:116333221-116333243 AAGTGATGTGCTGTGAGGACAGG - Intronic
1060169956 9:121453320-121453342 CTGTGCTGTGCTCAGAGAGCTGG + Intergenic
1060931887 9:127494325-127494347 CGGAGCTGTTCAGTGAGGGCTGG - Intronic
1060956498 9:127644723-127644745 CCCTCCTGGGCTGTGAGGGTGGG + Intronic
1061216620 9:129225411-129225433 CCCTGCTGCCCTATGAGGGCAGG - Intergenic
1061577603 9:131517198-131517220 CCTGGCTTTGCTGTGAGGGCTGG - Intronic
1062046199 9:134425595-134425617 CCTTGCTGGGCTGGGAGGGAGGG + Intronic
1062695408 9:137873416-137873438 AGGTGCTGTGCTGGGAGGGTGGG + Intergenic
1203519063 Un_GL000213v1:29627-29649 TGGTGCTGTGCTGTGAGGCTGGG + Intergenic
1192369745 X:70503529-70503551 CAGTTCTGTGCTGGGATGGCGGG + Exonic
1198977312 X:142351300-142351322 CCGGGCTTTGCTGTGTGGGTTGG - Intergenic