ID: 1165113297

View in Genome Browser
Species Human (GRCh38)
Location 19:33514317-33514339
Sequence CACAGCACGGTGAAGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165113292_1165113297 -10 Left 1165113292 19:33514304-33514326 CCTGCCCTCACAGCACAGCACGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 110
1165113290_1165113297 21 Left 1165113290 19:33514273-33514295 CCTGGGGACTGCAGTGAAGCTGT 0: 1
1: 1
2: 2
3: 27
4: 216
Right 1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165113297 Original CRISPR CACAGCACGGTGAAGTGGTC TGG Intronic
900917873 1:5651092-5651114 AGTAGCACGGTGCAGTGGTCTGG + Intergenic
902882227 1:19379970-19379992 CACATCACAATGATGTGGTCAGG - Intronic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903627181 1:24739622-24739644 CACAGTATGGTGCAGTGATCAGG + Intergenic
905231469 1:36517170-36517192 CACAGCAGAATGGAGTGGTCAGG - Intergenic
906718529 1:47988426-47988448 CACAACACAGTGAGGTGCTCTGG + Intronic
907285727 1:53378285-53378307 CACAGCACGGTGTACTGTTAGGG - Intergenic
907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG + Intergenic
910225420 1:84931171-84931193 CACAGCAGGGTGGATTGGTTTGG - Intronic
913981341 1:143520030-143520052 CAGAGGACAGTGAAGTGGCCAGG + Intergenic
920437076 1:205953959-205953981 CTCAGAACAGTGAAGTGGTGGGG + Intergenic
921580869 1:216894724-216894746 GAGAACACGGTCAAGTGGTCAGG + Intronic
922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG + Intronic
1064284963 10:13984106-13984128 CTGACCACGGTGAAGTGGCCTGG + Intronic
1064328381 10:14372105-14372127 CACAGGATGGTGAGGTAGTCTGG + Intronic
1069750181 10:70740456-70740478 CACAGCAAGGCTAAGTGGCCTGG + Intronic
1071948207 10:90672083-90672105 CACAGCACAGTAAAATGGTGGGG - Intergenic
1072317940 10:94221944-94221966 AACAGCACTGGGAAGTGTTCAGG + Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1075411731 10:122233462-122233484 CCCAGCACGGTTGAGTGGTGTGG + Intronic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1078472446 11:11602347-11602369 CAGAGCATGGTTGAGTGGTCTGG - Intronic
1080212680 11:29805282-29805304 CACAGCACTCTGAACTGGTTAGG + Intergenic
1083538953 11:63498302-63498324 CACCACAGGGTGAAGTGCTCTGG - Intergenic
1088920287 11:114255557-114255579 CACAACTCGGGGAAGTGGGCTGG - Intergenic
1091407885 12:220470-220492 CTCAGCACGGTGATGGGGGCGGG - Intergenic
1091755050 12:3045847-3045869 AACAGCAGGGAGAGGTGGTCAGG + Intergenic
1100946325 12:99787995-99788017 CACTGCAGGCTGAAGTGCTCTGG + Intronic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1108522659 13:51259671-51259693 CACAGCGAGGTGAAGGGGACGGG - Intronic
1117384346 14:55195633-55195655 CACAGCAGGCTGAAGTGCTCTGG - Intergenic
1118096828 14:62546555-62546577 CACTGCAGGCTAAAGTGGTCTGG + Intergenic
1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG + Intronic
1121255643 14:92528317-92528339 AACAGTACGGTGTGGTGGTCAGG + Intronic
1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG + Exonic
1131928117 15:97408496-97408518 CGCAGGAAGGGGAAGTGGTCCGG + Intergenic
1134818751 16:17228468-17228490 CACAGAACGGTGATGGGGTTGGG + Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136863278 16:33715802-33715824 CAGAGGACAGTGAAGTGGCCAGG - Intergenic
1137044611 16:35643561-35643583 AAGAGCATGGTGAAGTGGTGGGG + Intergenic
1137275968 16:46933704-46933726 GACAGCACTGAGAAGTGGTCAGG - Intergenic
1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG + Intronic
1203124769 16_KI270728v1_random:1563953-1563975 CAGAGGACAGTGAAGTGGCCAGG - Intergenic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1143413612 17:6728605-6728627 CACTGCAGGCTGAAGTGCTCTGG + Intergenic
1145689474 17:26722935-26722957 CAGAGGACAGTGAGGTGGTCAGG + Intergenic
1147562948 17:41520124-41520146 TGCAGCATGGTGAAGTGGACAGG + Exonic
1147659796 17:42111462-42111484 CCCAGCATGGTGAAGAGTTCAGG - Exonic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1149090804 17:52776122-52776144 CACAGCAAAGTGCTGTGGTCAGG - Intergenic
1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG + Intronic
1158030896 18:52963515-52963537 CACAGGAGTCTGAAGTGGTCAGG + Intronic
1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG + Intronic
1160393636 18:78556539-78556561 CACAGCACAGTGAACAGATCGGG - Intergenic
1160424638 18:78771588-78771610 CAACGCACGGTGAAGTGATTCGG - Intergenic
1161826685 19:6572271-6572293 CACTGCAGGGTGGAGTGCTCTGG - Intergenic
1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG + Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
926459862 2:13115628-13115650 CACAGCACGATGAAAGGCTCAGG - Intergenic
927985746 2:27409379-27409401 CCCAACACGGTGAAGTGCTCCGG - Exonic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG + Intergenic
943127729 2:183816509-183816531 AACAGCACAGGGAAGAGGTCTGG + Intergenic
945575580 2:211525068-211525090 CACTGCAAGCTGAAGTGTTCTGG + Intronic
1169285713 20:4305555-4305577 CAGAGCACGGTGAGATGGTTCGG + Intergenic
1171130807 20:22651674-22651696 CAGAGCACAGTGGAGTTGTCTGG + Intergenic
1173070204 20:39756935-39756957 CACACCACAGTGTAGTGTTCTGG - Intergenic
1174720983 20:52812314-52812336 CACAGCTCGGTGACATTGTCAGG + Intergenic
1175445429 20:59016441-59016463 CACTGCAGGTTGAAGTGCTCTGG + Intergenic
1175604202 20:60299052-60299074 CTCTGCACTGTGAAGAGGTCAGG - Intergenic
950097368 3:10337932-10337954 GGCAGCACGGGGAAGTGGTAGGG - Intronic
954641041 3:52098020-52098042 CACAGCAGAGTGCAGTGGTGAGG + Intronic
959584831 3:108016182-108016204 CACAGCACAATCAAGTGGTGGGG - Intergenic
959645522 3:108695445-108695467 CTCAGCAGGGTGGAGTGTTCTGG - Intergenic
962878301 3:139552933-139552955 CAGAGCACAGGGAAGTGGCCAGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968087364 3:195879865-195879887 AACAGCACGATGAAGTGGGCGGG - Intronic
973870306 4:55159558-55159580 CACAGTTGGGTGAAGTGGACTGG - Intergenic
974309559 4:60187499-60187521 CACTGCAAGCTGAAGTGCTCTGG + Intergenic
975172885 4:71252985-71253007 CACTGCACTGTGAAGTGCTATGG - Intronic
977314363 4:95426680-95426702 CACAGAACGTTTTAGTGGTCTGG + Intronic
978617686 4:110612638-110612660 CACAGCGGGGTGAAGCTGTCGGG + Intergenic
982012006 4:151114617-151114639 CACAGCCCTGAGAAGTGGCCAGG - Intronic
982828380 4:160028095-160028117 CACAGCAGGCTGAAGTGCTTTGG - Intergenic
994668910 5:102743175-102743197 CACAGTAAGCTAAAGTGGTCTGG + Intergenic
996790037 5:127282525-127282547 CACAGCGCTGCGAATTGGTCAGG - Intergenic
999697867 5:154202339-154202361 CACAGCTCGGTGTGGTGGCCAGG + Intronic
1001087710 5:168713218-168713240 CACAGCACGTTGGAGGGGCCGGG + Intronic
1010980624 6:82365136-82365158 CACAGCGCGGGGCACTGGTCCGG - Exonic
1012472452 6:99587675-99587697 CACTTCAGGGTGAAGTTGTCAGG + Intergenic
1012801733 6:103838563-103838585 CACAGCACAGTGTAGCGGACTGG - Intergenic
1013359224 6:109378462-109378484 GACAGTAAGTTGAAGTGGTCAGG + Intronic
1014255860 6:119159629-119159651 CCCAGCATGGTGAAGTGGTGTGG - Intergenic
1017229081 6:152052798-152052820 GACAGCACGGGCAAGTGTTCTGG + Intronic
1019024820 6:168950683-168950705 CACAGAAGGGTGCAGGGGTCTGG - Intergenic
1019637410 7:2083456-2083478 CACAGCACGGAGAGGAGGTGCGG + Intronic
1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG + Intronic
1021641779 7:22744574-22744596 CACAGCACTGTGTGGTGGTGTGG + Intergenic
1032076284 7:128837669-128837691 GTCTGCACGGTGAAGTGGGCAGG - Exonic
1033014387 7:137657313-137657335 CACAGCAGGGCCAAGTGGTCTGG + Intronic
1033022145 7:137736470-137736492 CACAGCAACGTGAAGAGGTAAGG - Intronic
1035687594 8:1537017-1537039 CACACCTCGGAGAAGTAGTCAGG + Intronic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1040973622 8:53165022-53165044 CACAGCATGGTGAAGGGGAAGGG - Intergenic
1041256336 8:55982615-55982637 CACAGCAAGGAGGAGTGTTCGGG - Intronic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1049915332 9:311960-311982 CACAGCACGTTTAAGTGGCGGGG - Exonic
1054755160 9:68950319-68950341 AACAGCAGAGTGAAATGGTCAGG - Intronic
1057880586 9:98790193-98790215 TCCAGCACGCTGAGGTGGTCAGG + Exonic
1059044075 9:110845245-110845267 AACAGCAAGATGAAGTTGTCAGG + Intergenic
1186040095 X:5466507-5466529 CACTGCACTGGGAAGTGTTCAGG - Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1199325115 X:146490115-146490137 CACCGCACACTGAAGTGCTCTGG + Intergenic
1200473682 Y:3618973-3618995 CACAGCTTGGTGAGGTGGTTTGG - Intergenic
1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG + Intergenic
1201845891 Y:18422656-18422678 CACTCCACGGTGAACTGGTGAGG - Intergenic