ID: 1165113312

View in Genome Browser
Species Human (GRCh38)
Location 19:33514384-33514406
Sequence GCTCATGTGACCCTGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 498}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165113312_1165113319 23 Left 1165113312 19:33514384-33514406 CCTCCTGCCAGGGTCACATGAGC 0: 1
1: 0
2: 2
3: 26
4: 498
Right 1165113319 19:33514430-33514452 GGCTCCAATACGACCTTTTCCGG 0: 1
1: 0
2: 1
3: 1
4: 43
1165113312_1165113321 27 Left 1165113312 19:33514384-33514406 CCTCCTGCCAGGGTCACATGAGC 0: 1
1: 0
2: 2
3: 26
4: 498
Right 1165113321 19:33514434-33514456 CCAATACGACCTTTTCCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 13
1165113312_1165113316 2 Left 1165113312 19:33514384-33514406 CCTCCTGCCAGGGTCACATGAGC 0: 1
1: 0
2: 2
3: 26
4: 498
Right 1165113316 19:33514409-33514431 GTCACACCTCCTGCACATCTTGG 0: 1
1: 0
2: 1
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165113312 Original CRISPR GCTCATGTGACCCTGGCAGG AGG (reversed) Intronic
900330110 1:2129987-2130009 GATCACCTGAGCCTGGCAGGTGG - Intronic
900338810 1:2178057-2178079 CCCCATGTGACCTTGGCAGAAGG + Intronic
900480258 1:2894740-2894762 GCACATGTGCCCCAGGAAGGAGG - Intergenic
900536728 1:3182332-3182354 GCTCGTGTGGCCCTGGCAGGTGG + Intronic
900759503 1:4461554-4461576 GCTCATCTGACCTTTGCATGTGG - Intergenic
901442586 1:9287539-9287561 TCTCATGTGACCCTCCTAGGAGG - Intergenic
901773035 1:11540459-11540481 GCTCAGGGAACCTTGGCAGGGGG - Intergenic
902188960 1:14747361-14747383 GATCATTTGAGCCTGGGAGGTGG - Intronic
903251237 1:22054300-22054322 GCTCACTTGACCCCGGGAGGCGG - Intronic
903255520 1:22096044-22096066 AATCATGTGAACCTGGGAGGTGG - Intergenic
903524654 1:23984012-23984034 GATCATTTGAGCCTGGGAGGTGG - Intergenic
904232266 1:29085635-29085657 GATCACTTGAGCCTGGCAGGTGG - Intronic
905064924 1:35172358-35172380 GATCATTTGAACCTGGGAGGTGG - Intergenic
905796023 1:40817192-40817214 GCCAAGGTGCCCCTGGCAGGGGG - Intronic
906170220 1:43718772-43718794 AATCATGTGAACCTGGGAGGTGG - Intronic
906514109 1:46428938-46428960 GCTAATGTGACCTCTGCAGGTGG - Intergenic
906542205 1:46595836-46595858 GATCACTTGAGCCTGGCAGGTGG - Intronic
909118375 1:71569001-71569023 AATCATGTGAACCTGGAAGGTGG - Intronic
912312530 1:108638163-108638185 GCTCATTTGAGCCTGGGAGTTGG - Exonic
912355960 1:109054258-109054280 GATCATTTGAACCTGGGAGGTGG + Intergenic
912392799 1:109316302-109316324 AATCATGTGAACCTGGGAGGTGG - Intronic
912728116 1:112077005-112077027 GTCCATGTGGCACTGGCAGGAGG + Intergenic
912947954 1:114100307-114100329 GCTCCTGTGAATCTGTCAGGAGG + Intronic
913159590 1:116133037-116133059 GCTTATGTGGCCTTGGAAGGAGG - Intronic
913372977 1:118121175-118121197 CCTCCTCTGACCCTGGCTGGAGG - Intronic
915226410 1:154414909-154414931 GGTCATGTGGCGCTGGAAGGAGG + Intronic
915244564 1:154547236-154547258 TCTCATTTGATCCTGGCAGCAGG + Intronic
916617106 1:166453381-166453403 ACTCACTTGAACCTGGCAGGTGG - Intergenic
916799798 1:168205827-168205849 AATCATGTGAACCTGGGAGGCGG + Intergenic
918784250 1:188744641-188744663 GATGATGTGAACCTGGGAGGCGG + Intergenic
919661693 1:200253910-200253932 CCTCCTGTGACACTGGCAGAGGG + Intergenic
920123911 1:203678488-203678510 GGTCATTTGAGCCTGGGAGGTGG - Intronic
920926281 1:210344529-210344551 GCTCATCTGTCCAAGGCAGGGGG + Intronic
921987144 1:221324459-221324481 GATCACGTGAGCCTGGGAGGCGG + Intergenic
922086047 1:222347767-222347789 GCACATGGGATGCTGGCAGGTGG + Intergenic
922510545 1:226162881-226162903 GATCATTTGAGCCTGGGAGGCGG - Intronic
922706858 1:227794770-227794792 GGTGGTGTGGCCCTGGCAGGAGG + Intergenic
922847064 1:228695054-228695076 GATCATTTGAGCCTGGGAGGCGG - Intergenic
924285049 1:242477215-242477237 GCTCTTGTCACCCAGGCTGGAGG - Intronic
924625911 1:245696328-245696350 ACTCATGTCATCATGGCAGGAGG - Intronic
924686334 1:246294683-246294705 AATCATGTGAACCTGGGAGGTGG - Intronic
924707628 1:246512169-246512191 GGTCATCTGACCCTTCCAGGAGG + Intergenic
1063072994 10:2685752-2685774 GATCACCTGAGCCTGGCAGGTGG - Intergenic
1063683615 10:8214256-8214278 GATCATTTGATCCTGGAAGGCGG + Intergenic
1063689235 10:8270118-8270140 GCTCACTTGAGCCTGGAAGGAGG - Intergenic
1063827689 10:9916726-9916748 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1063951733 10:11229674-11229696 AATCATGTGAACCTGGGAGGTGG - Intronic
1064618683 10:17191971-17191993 CCTCATCTGACACTGTCAGGGGG - Intronic
1064763017 10:18641450-18641472 GATCATTTGAGCCTGGGAGGTGG - Intronic
1066100106 10:32110134-32110156 GCTCCTGTACGCCTGGCAGGTGG + Intergenic
1067112668 10:43411191-43411213 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1067223921 10:44363286-44363308 GCCCATGTGACCCAGGCTGAGGG + Intergenic
1070113575 10:73507902-73507924 GGTCACGTGAACCTGGAAGGTGG + Intronic
1070214069 10:74357407-74357429 GCTCAGGTGACCCTCCCAGCTGG + Intronic
1070310203 10:75267496-75267518 GATCATTTGACCCTGGGAGGTGG - Intergenic
1071989379 10:91085998-91086020 AATCATGTGAACCTGGGAGGTGG - Intergenic
1072543710 10:96417959-96417981 GCTAATGTAACACTAGCAGGAGG + Intronic
1073037209 10:100572389-100572411 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1073259041 10:102174801-102174823 GATCATTTGAGCCTGGCTGGAGG - Intergenic
1073321894 10:102620666-102620688 GCTCTTCAGACCCTGGGAGGGGG + Intronic
1074495059 10:113972907-113972929 GCTCATGTGTACCTGCCTGGTGG - Intergenic
1075102406 10:119515721-119515743 GCTCCTGTGGGCCTGGCTGGAGG - Intronic
1075568453 10:123521242-123521264 GCCCATGTGCCCCTGGGAAGGGG - Intergenic
1076350970 10:129815095-129815117 CCTCCAGCGACCCTGGCAGGAGG + Intergenic
1076771199 10:132665966-132665988 GATCGTGTGAGCCTGGGAGGTGG + Intronic
1077182141 11:1221522-1221544 GCCCATGTGTCCCTGGGCGGAGG - Intergenic
1077539258 11:3138995-3139017 GCTCAGGTGCCCCTGGAGGGCGG - Intronic
1077633694 11:3827550-3827572 CCTCTTGTGACCCTGGCACTTGG - Exonic
1077897222 11:6462492-6462514 GATCATTTGAGCCTGGGAGGTGG - Intronic
1078158533 11:8819305-8819327 GCTCACTTGAGCCTAGCAGGAGG + Intronic
1078526016 11:12102103-12102125 GCTCATGTGTTGCTGGCATGGGG - Intronic
1078593863 11:12670000-12670022 GCTCACTTGAGCCTGGGAGGTGG + Intergenic
1078734191 11:14004913-14004935 ACTCAGGAGACCCAGGCAGGAGG - Intronic
1080729696 11:34936873-34936895 ACTCACGTGAACCTGGGAGGTGG - Intronic
1081838134 11:46174886-46174908 GATCATTTGACTCTGGGAGGTGG - Intergenic
1083251567 11:61471346-61471368 GCCCATGAGATCCTGGCTGGAGG - Intronic
1083631111 11:64095976-64095998 GCTCATGGGCCCCTGGGGGGTGG - Intronic
1084286333 11:68133582-68133604 GCTGGAGTGACCCTGGGAGGTGG - Intergenic
1084548491 11:69826346-69826368 GGTCATGCCACCCTGCCAGGGGG - Intergenic
1084693368 11:70739620-70739642 GCCCAGCTGACCCTGGCTGGTGG - Intronic
1084711764 11:70847955-70847977 GCTGAGGTGACCGTGGCTGGAGG + Intronic
1084737373 11:71114203-71114225 GCTCAGGCCACCCTGGGAGGTGG - Intronic
1085097100 11:73770077-73770099 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1085209595 11:74763825-74763847 GCTCATGAGGCCCTAGCAAGAGG + Intronic
1085241993 11:75064605-75064627 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1086739089 11:90344596-90344618 GATCATTTGAGCCTGGGAGGTGG - Intergenic
1087416395 11:97861534-97861556 GCTTATGTGACTGTGGCAGCTGG + Intergenic
1087516790 11:99174083-99174105 GATCATTTGAACCTGGGAGGCGG - Intronic
1087783054 11:102321439-102321461 AATCATGTGAGCCTGGGAGGTGG - Intronic
1088240766 11:107771633-107771655 GATCACGTGAGCCTGGGAGGCGG + Intergenic
1089270343 11:117297531-117297553 ACTCACTTGACCCTGGGAGGTGG + Intronic
1089756721 11:120692762-120692784 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1089912693 11:122118229-122118251 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1090353740 11:126124932-126124954 GCTCCTGTCACCCTGGTTGGAGG + Intergenic
1090680859 11:129056331-129056353 GACCACGTGAGCCTGGCAGGTGG - Intronic
1093481283 12:19606465-19606487 ACTCACTTGAACCTGGCAGGTGG - Intronic
1093616341 12:21230361-21230383 GCTCTTGTTACCCAGGCTGGAGG + Intronic
1096169375 12:49454791-49454813 GATCATCTGAGCCTGGGAGGTGG + Intronic
1097168261 12:57097094-57097116 GCTCATCTGGCCCAGGCTGGGGG + Exonic
1097235591 12:57537245-57537267 GGTCACTTGAGCCTGGCAGGTGG + Intronic
1097674485 12:62583871-62583893 GATCATTTGAACCTGGGAGGTGG + Intronic
1098097029 12:66969484-66969506 GATCACTTGACCCTGGGAGGTGG - Intergenic
1099606794 12:84812868-84812890 GATCGTGTGAACCTGGGAGGCGG - Intergenic
1100267130 12:92988201-92988223 GGGCAAGTGAGCCTGGCAGGAGG + Intergenic
1100622712 12:96294747-96294769 GCTCCTGAGACCCTTGTAGGAGG - Intronic
1101626460 12:106447629-106447651 GCTCATGTGAACTTGGCATCGGG - Intronic
1101916672 12:108901401-108901423 GATCATTTGAGCCTGGGAGGCGG - Intergenic
1101964000 12:109269664-109269686 CCTCATGTGACCCTTGGAGGTGG + Intergenic
1102160463 12:110764575-110764597 GATCACTTGACCCTGGGAGGTGG - Intergenic
1102357407 12:112250361-112250383 GCTCAGGTGCCAGTGGCAGGTGG - Exonic
1103496551 12:121367164-121367186 ACTCATTTGAACCTGGGAGGCGG + Intronic
1103588941 12:121976798-121976820 GCTCAGGAGGCCATGGCAGGAGG + Intronic
1103657392 12:122484177-122484199 GATCGTTTGAGCCTGGCAGGTGG - Intronic
1105695368 13:22883466-22883488 GCTCTTGTTGCCCAGGCAGGAGG + Intergenic
1106279488 13:28251972-28251994 AATCATTTGACCCTGGGAGGTGG - Intronic
1107721493 13:43253195-43253217 TCTAAATTGACCCTGGCAGGCGG - Intronic
1108067117 13:46589631-46589653 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1109296634 13:60541198-60541220 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1110364558 13:74667397-74667419 GCTCAGGTGGCCCAGGCAGGAGG - Intergenic
1111936574 13:94564055-94564077 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1111967749 13:94878060-94878082 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1113832178 13:113304687-113304709 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1114338306 14:21715671-21715693 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1114557414 14:23569965-23569987 TATCATGTGTCCCAGGCAGGAGG + Intronic
1115612871 14:35065776-35065798 AATCATTTGACCCTGGGAGGTGG - Intronic
1115675221 14:35666100-35666122 GATCATTTGACCCTGGGAGGTGG - Intronic
1116498278 14:45588930-45588952 GATCATGTGAGTCTGGGAGGTGG + Intergenic
1117180334 14:53185116-53185138 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1118063229 14:62163518-62163540 TCTCAGGTCAACCTGGCAGGGGG + Intergenic
1118905604 14:70021112-70021134 TCTCATGGCTCCCTGGCAGGAGG + Intronic
1119484235 14:74977803-74977825 GCTCCTGTGACCCTGCCTGCAGG - Intergenic
1119813144 14:77541113-77541135 GATCACTTGAGCCTGGCAGGCGG - Intronic
1120267103 14:82265027-82265049 GCTCATGTGAGGCTCTCAGGGGG - Intergenic
1120994920 14:90409836-90409858 GATCATTTGAACCTGGGAGGTGG - Intergenic
1121368886 14:93338820-93338842 GATCATTTGAGCCTGGGAGGTGG + Intronic
1121379666 14:93452411-93452433 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1122280551 14:100619883-100619905 GCCCAAGGGACCCTGGCTGGAGG + Intergenic
1122320485 14:100852416-100852438 GCTCATGTGGCCCTGACACGTGG - Intergenic
1122470969 14:101965354-101965376 GCTCATGTGACACTGGAGGCAGG - Intronic
1122584757 14:102797767-102797789 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1122951643 14:105048174-105048196 GATCATTTGAGCCTGGGAGGTGG - Intergenic
1122954309 14:105063011-105063033 GATGATGTGAGCCTGGGAGGTGG - Intronic
1122964439 14:105115413-105115435 TCTCAGCTCACCCTGGCAGGTGG - Intergenic
1123125732 14:105944821-105944843 GCTGCTGTGGCCCTGGCAAGAGG - Intergenic
1124231854 15:27952763-27952785 GATCACGTGACCCTGGGAGGCGG - Intronic
1125517824 15:40332596-40332618 GCTCGTCTGACCCTGGAATGAGG - Intronic
1125657688 15:41371594-41371616 GCACATGTGACCGTGTCTGGGGG + Exonic
1125932177 15:43608180-43608202 GCTCTGGGCACCCTGGCAGGAGG - Exonic
1125945275 15:43707654-43707676 GCTCTGGGCACCCTGGCAGGAGG - Intergenic
1125996595 15:44167279-44167301 GATCATGTGAGCCTGGGAAGTGG + Intronic
1126826278 15:52552499-52552521 AGTCATGTGAACCTGGGAGGTGG + Intronic
1127906064 15:63377136-63377158 GCTCTTGTGACCCTGCCTGCCGG + Intronic
1128169613 15:65499649-65499671 GATCATTTGAGCCTGGGAGGCGG - Intronic
1128659473 15:69487609-69487631 CCTCATGTCAGCCTGGGAGGTGG - Intergenic
1128977749 15:72165899-72165921 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1129089092 15:73130080-73130102 ACTCATTTGATCCTGGGAGGCGG - Intronic
1129905679 15:79185647-79185669 GATCATTTGAGCCTGGGAGGTGG - Intergenic
1130252337 15:82307683-82307705 GCTCAAGTGTCCCTTCCAGGAGG - Intergenic
1130536329 15:84787475-84787497 GCCCATGTGTCCAGGGCAGGGGG + Intronic
1131076243 15:89496605-89496627 GCTTTTGAGACCCGGGCAGGGGG + Exonic
1131091352 15:89627056-89627078 GCTCATGGGAACCTGGCTGGAGG + Exonic
1131270814 15:90946685-90946707 GCCCATGTGACGCTGGCAACCGG + Exonic
1131805388 15:96116561-96116583 CCCCATGTCACCCTGGCTGGAGG - Intergenic
1132681037 16:1141818-1141840 CCTCCTGAGACCCTGGCAGTGGG + Intergenic
1132907150 16:2288500-2288522 GCACAGGTGACCCTGCCATGTGG - Intronic
1133192774 16:4146735-4146757 GCTCCTGTCACCCAGGCTGGAGG + Intergenic
1133274880 16:4632045-4632067 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1133839682 16:9396207-9396229 CCTCAGGTGTTCCTGGCAGGTGG - Intergenic
1134034562 16:11019734-11019756 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1135169742 16:20173328-20173350 GATCATTTGAGCCTGGAAGGTGG - Intergenic
1135735766 16:24930954-24930976 GCTCCTCAGACCCTGGCAGGGGG - Exonic
1136112000 16:28069329-28069351 GCTCACTTGAGCCTGGGAGGTGG + Intergenic
1136427332 16:30177702-30177724 GCTCACTTGAGCCTGGGAGGTGG + Intergenic
1137419378 16:48318430-48318452 GATCATTTGAACCTGGGAGGCGG + Intronic
1138781321 16:59791657-59791679 CCTCACATGGCCCTGGCAGGGGG - Intergenic
1140287161 16:73614844-73614866 GATCATCTGAGCCTGGGAGGTGG - Intergenic
1140747996 16:77998044-77998066 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1140870592 16:79102890-79102912 GCACATGCAACCCTGGCTGGTGG + Intronic
1140930822 16:79626213-79626235 GTTCATGAGACCCTTGCAGTAGG - Intergenic
1143358471 17:6348544-6348566 GATCTTGGGAGCCTGGCAGGGGG - Intergenic
1144264156 17:13552164-13552186 AATCATGTGAACCTGGGAGGCGG - Intronic
1144299117 17:13906599-13906621 GCTCATGTCACTGTGGCAAGAGG - Intergenic
1144547583 17:16212231-16212253 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1145220840 17:21087117-21087139 AATCATGTGAACCTGGGAGGTGG + Intergenic
1146362593 17:32189817-32189839 AATCATGTGAACCTGGGAGGCGG - Intronic
1146844342 17:36173842-36173864 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146856647 17:36261777-36261799 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146863970 17:36326598-36326620 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1146872557 17:36385688-36385710 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146879915 17:36436773-36436795 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147075441 17:37986312-37986334 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147078362 17:38006747-38006769 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147086966 17:38065858-38065880 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG + Intergenic
1147102911 17:38189821-38189843 GCTCCCTTGACCCTGGCGGGGGG - Intergenic
1147132347 17:38416967-38416989 GATCATTTGAGCCTGGGAGGTGG + Intergenic
1147934463 17:44003901-44003923 GATCATTTGAACCTGGGAGGTGG + Intronic
1148499960 17:48082621-48082643 GATCATTTGAACCTGGGAGGTGG - Intronic
1148664402 17:49363428-49363450 GCTTATGTGAGCGTGGTAGGAGG - Intergenic
1148712214 17:49690068-49690090 GCTCCTGTTGCCCTGGCTGGAGG - Intergenic
1149509897 17:57231693-57231715 GCTCACTTGAGCCTGGGAGGTGG + Intergenic
1149589191 17:57815979-57816001 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1151101668 17:71562926-71562948 GCTCATGTGATTATGGCAGCTGG + Intergenic
1151255062 17:72870378-72870400 TATCATGAGACCCTTGCAGGTGG - Intronic
1151493753 17:74447243-74447265 GCCGAGGTGATCCTGGCAGGAGG - Exonic
1151878030 17:76878332-76878354 GCTCCTGAGCCCCTGGCACGGGG + Intronic
1151909585 17:77073248-77073270 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1152505336 17:80746127-80746149 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1153007224 18:508174-508196 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1153987384 18:10365290-10365312 GCTCATGAAGCCCTGGCAGATGG - Intergenic
1155297891 18:24401980-24402002 GATCACTTGAACCTGGCAGGTGG + Intergenic
1158465470 18:57686173-57686195 AATCATGTGAACCTGGGAGGCGG + Intronic
1160106494 18:75983077-75983099 ACTCTGGTGAACCTGGCAGGTGG + Intergenic
1160188490 18:76695314-76695336 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1160364069 18:78309312-78309334 TCTTACGTGACACTGGCAGGCGG + Intergenic
1160986225 19:1840185-1840207 GCTCAGAAGAGCCTGGCAGGGGG - Intronic
1161003773 19:1924427-1924449 GGTTCTGTGGCCCTGGCAGGAGG - Exonic
1161212488 19:3074743-3074765 GATCATTTGAGCCTGGGAGGTGG - Intergenic
1162066207 19:8126741-8126763 GCAAATGTGGCCCTGGCAGCCGG - Exonic
1162277894 19:9672810-9672832 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1162468932 19:10860446-10860468 AATCATGTGAACCTGGGAGGCGG + Intronic
1162653120 19:12106813-12106835 GATCATTTGAGCCTGGAAGGTGG + Intronic
1163027847 19:14523702-14523724 GATCATTTGAACCTGGGAGGTGG - Intronic
1163280069 19:16310646-16310668 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1164074349 19:21800471-21800493 GCTCATGTGCCCATGCCAGCAGG - Intergenic
1165023524 19:32942968-32942990 GATCATCTGAGCCTGGCAGCTGG - Intronic
1165054524 19:33165866-33165888 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1165113312 19:33514384-33514406 GCTCATGTGACCCTGGCAGGAGG - Intronic
1165173920 19:33913520-33913542 GATCATTTGAGCCTGGGAGGTGG - Intergenic
1165355957 19:35304216-35304238 GCTGATGTGATCCTGGCGCGGGG + Intronic
1165802267 19:38560274-38560296 ACTCATTTGACCCTGGGAGGTGG + Intronic
1166393872 19:42424846-42424868 GCTCCTGTGAAGCAGGCAGGGGG + Intronic
1166931891 19:46305990-46306012 GATCATGTGAGCCTGGGAGGTGG + Intronic
1167624496 19:50578494-50578516 GATCACGTGAACCTGGGAGGCGG + Intergenic
1167645245 19:50702276-50702298 GCTCAGATGACCCTGTCAGGAGG - Intronic
1167750649 19:51377897-51377919 GCTCAGTTGAGCCTGGGAGGTGG + Intergenic
1167821666 19:51933883-51933905 AATCATTTGAACCTGGCAGGTGG - Intronic
1167950652 19:53024598-53024620 GATCATGTGAACCTGGGAGAGGG + Intergenic
1168080421 19:54006001-54006023 GATCATTTGAACCTGGGAGGTGG + Intronic
1168123981 19:54272736-54272758 ACTCATGTGGCACTGGCAGGTGG + Intronic
1168178385 19:54642798-54642820 ACTCATGTGGCACTGGCAGCTGG - Intronic
1168528831 19:57110061-57110083 GCTCACGTGAGCCTGGGAGGTGG - Intergenic
925798081 2:7568304-7568326 GAACATGGGACTCTGGCAGGAGG - Intergenic
925867465 2:8241392-8241414 GCTCTGGTGTCTCTGGCAGGTGG - Intergenic
926147131 2:10403568-10403590 ACTCATTTGAACCTGGGAGGCGG - Intronic
926266964 2:11331837-11331859 ACTCACGTGAACCTGGGAGGCGG + Intronic
926346216 2:11948197-11948219 GCTCTTGTCGCCCTGGCTGGAGG + Intergenic
926547867 2:14264219-14264241 TCACCTCTGACCCTGGCAGGAGG - Intergenic
927508149 2:23627938-23627960 GCTCTTGTCACCCAGGCTGGAGG + Intronic
927596319 2:24401100-24401122 GATCGTTTGAACCTGGCAGGTGG + Intergenic
927789771 2:26001196-26001218 GATCATTTGAACCTGGGAGGTGG - Intergenic
927964063 2:27258304-27258326 CATCATTTCACCCTGGCAGGCGG - Exonic
928172952 2:29015022-29015044 TCTCAGGTGACCTTGGAAGGTGG + Intronic
930009087 2:46921864-46921886 GCTGATCTGACACTGACAGGAGG + Intronic
930017715 2:46982285-46982307 GATCATCTGAGCCTGGCAGGCGG + Intronic
930320214 2:49844382-49844404 GCTCTTGTGGCCCAGGCTGGAGG - Intergenic
931206096 2:60147390-60147412 CCTCATGAGAACCTGGCAAGAGG - Intergenic
931388213 2:61816290-61816312 GCTAATGTGACCCAGGCAGTGGG - Intergenic
932237856 2:70135520-70135542 GATGGTGTGAACCTGGCAGGCGG - Intergenic
933748687 2:85589233-85589255 GCTCCAGGGACCCTGGAAGGAGG - Intronic
933782436 2:85811707-85811729 GCGCATGTGTGCCTGGCACGTGG - Intergenic
933821191 2:86113716-86113738 GCTCACTTGATCCTGGGAGGTGG + Intronic
934117893 2:88813223-88813245 GCTCATGTGGCCATGGCAGAAGG - Intergenic
934567066 2:95346886-95346908 GCTCACATGCCCCCGGCAGGCGG - Intronic
934717677 2:96552915-96552937 GCCCAGGTTCCCCTGGCAGGAGG + Intergenic
934791175 2:97061724-97061746 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
934815268 2:97320806-97320828 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
934822427 2:97387677-97387699 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
935274719 2:101466220-101466242 GCTCATTTGAACCTGGGAGGTGG + Intronic
935747105 2:106198103-106198125 GCTCTTGTGAGCCTGTCAGCTGG - Intergenic
937580097 2:123474737-123474759 CTTTATGTGACTCTGGCAGGAGG + Intergenic
938002190 2:127751272-127751294 GATCACTTGAGCCTGGCAGGTGG + Intronic
938222212 2:129580182-129580204 GCTGATGAGAGCCTGGCAGAAGG + Intergenic
939238386 2:139526962-139526984 TCTCATCTGACACTGGCAGAAGG + Intergenic
941563213 2:167075672-167075694 GCTCTTGTCACCCAGGCTGGAGG + Intronic
943629782 2:190238495-190238517 GCTCTTGTCACCCAGGCTGGAGG + Intronic
944041892 2:195365279-195365301 GCTGATGTGAGCCTGGAAGTTGG - Intergenic
944124858 2:196281551-196281573 GATCATTTGAGCCTGGGAGGTGG + Intronic
944166799 2:196731475-196731497 GATCATTTGAGCCTGGGAGGCGG - Intronic
944542437 2:200766732-200766754 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
945296222 2:208174037-208174059 GATCATTTGAGCCTGGGAGGTGG - Intronic
947587063 2:231362894-231362916 GCTTCTGTGAGCCTGGCAGAAGG - Intronic
947731322 2:232433132-232433154 GCTGCTGTGATCCTGGCAGAGGG + Intergenic
1169138766 20:3214451-3214473 GATCACCTGAGCCTGGCAGGTGG - Intronic
1169168783 20:3447095-3447117 GATCACGTGAGCCTGGGAGGTGG + Intergenic
1170252667 20:14302740-14302762 AATCATTTGAACCTGGCAGGCGG - Intronic
1170390145 20:15863680-15863702 TCACAGGTGACTCTGGCAGGTGG + Intronic
1171064513 20:22001174-22001196 TCTCATGTGACCATGGTATGAGG - Intergenic
1172139137 20:32709462-32709484 AATCATCTGAGCCTGGCAGGTGG + Intronic
1172299243 20:33837262-33837284 GATCATTTGAGCCTGGGAGGTGG + Intronic
1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG + Intergenic
1172724842 20:37030957-37030979 GATCATCTGAACCTGGGAGGCGG + Intronic
1172858366 20:38026244-38026266 AATCATTTGAACCTGGCAGGCGG - Intronic
1173196756 20:40920440-40920462 GGTCATGTGACCAGGACAGGTGG - Intergenic
1173511585 20:43633308-43633330 GCTCTTGTGGCCCAGGCTGGAGG - Intronic
1173785835 20:45792160-45792182 GCTCCTGGGACCCTGGCCCGCGG + Intronic
1174878840 20:54254678-54254700 GATCATTTGAGCCTGGGAGGAGG + Intergenic
1175111194 20:56649310-56649332 GATCATTTGAGCCTGGGAGGCGG - Intergenic
1175444698 20:59012036-59012058 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1175492542 20:59388929-59388951 GATCATTTGAGCCTGGGAGGCGG + Intergenic
1175704333 20:61164995-61165017 TCTCCTGAGCCCCTGGCAGGAGG + Intergenic
1175825768 20:61935989-61936011 CCTCCTGTGACCCTGGGAGAGGG - Intronic
1176937393 21:14882930-14882952 AATCATGTGAACCTGGGAGGCGG + Intergenic
1177114973 21:17074234-17074256 ACCCATGTGACCGTGGCTGGAGG + Intergenic
1178838546 21:36119797-36119819 GATCACTTGAGCCTGGCAGGTGG - Intergenic
1179366107 21:40759729-40759751 GCTCATGGGATGATGGCAGGAGG - Intronic
1179792963 21:43766089-43766111 GCTCATTTGAGCCTGGGCGGGGG + Intergenic
1180543712 22:16478399-16478421 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1181642979 22:24214499-24214521 GCACATCTGACCCTGCCTGGAGG - Intergenic
1182166460 22:28179244-28179266 AATCATGTGACCCTGGGAGGCGG - Intronic
1182210389 22:28671760-28671782 AATCATGTGAACCTGGGAGGTGG - Intronic
1182514563 22:30847062-30847084 GATCATTTGAACCTGGGAGGTGG - Intronic
1182711766 22:32327711-32327733 GCACATTGGACCCTGTCAGGAGG - Intergenic
1182873932 22:33673933-33673955 GGTCGTGTAACCCAGGCAGGTGG - Intronic
1183308608 22:37097464-37097486 GCTTCTTTGGCCCTGGCAGGGGG - Intronic
1183574267 22:38677159-38677181 AATCATGTGAACCTGGGAGGTGG + Intergenic
1183740746 22:39667203-39667225 CCTCCTGTGCCCTTGGCAGGGGG + Intronic
1183972850 22:41491294-41491316 GCTCATGGGCCCCTGGCAGTGGG - Intronic
1184038065 22:41927904-41927926 GCTCACGTCATCCTGGAAGGTGG + Intergenic
1184147098 22:42618087-42618109 GCTCATCTGACCCTGACAGGAGG + Exonic
1184584779 22:45440528-45440550 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
949520140 3:4844205-4844227 GATCACTTGATCCTGGCAGGTGG - Intronic
950309227 3:11941466-11941488 GATCACCTTACCCTGGCAGGTGG - Intergenic
950617337 3:14171734-14171756 GCTCACTTGAACCTGGGAGGCGG + Intronic
952242812 3:31551300-31551322 GATCATTTGAGCCTGGGAGGCGG - Intronic
952485668 3:33807394-33807416 GCTCCTGTCACCCTGGCCAGTGG + Intronic
953528433 3:43715191-43715213 GCTCTTGTCACCCAGGCTGGAGG + Intronic
953934842 3:47032395-47032417 GATCATCTGAGCCTGGTAGGTGG + Intronic
954574751 3:51669848-51669870 GCTTAGGTGCCCCAGGCAGGCGG - Intronic
957459757 3:80501356-80501378 GATCATTTGAACCTGGGAGGTGG - Intergenic
958790740 3:98648245-98648267 GCTCATGTCGCCCAGGCTGGAGG + Intergenic
959066108 3:101658608-101658630 GGTCATTTGAACCTGGGAGGTGG - Intronic
961542964 3:127612663-127612685 GCTCATGGTACCCATGCAGGTGG + Intronic
961688206 3:128650299-128650321 GCTGACGTGGCCCAGGCAGGAGG + Intronic
961785189 3:129343301-129343323 GGGGATGTGAGCCTGGCAGGCGG - Intergenic
962620662 3:137174873-137174895 TCTCTTGTGATCCTGGCTGGGGG - Intergenic
962765469 3:138558276-138558298 AATCATGTGAACCTGGGAGGTGG + Intronic
963986232 3:151597882-151597904 GCTCCTGTCACCCAGGCTGGAGG - Intergenic
965159457 3:165113285-165113307 GCTCATGTGATGATGGAAGGTGG + Intergenic
965344917 3:167536591-167536613 GATCACTTGAACCTGGCAGGTGG + Intronic
966855046 3:184188157-184188179 GCGGATGTGAACCTGGCATGGGG + Exonic
967232117 3:187349210-187349232 GATCATTTGAACCTGGGAGGCGG + Intergenic
968140453 3:196251994-196252016 GATCATTTGAGCCTGGGAGGTGG - Intronic
968145721 3:196297091-196297113 GCTGGTGTGAACCTGGGAGGCGG + Intronic
968210236 3:196842689-196842711 GCTCTTGTGGCCCAGGCAGGAGG - Intergenic
968739306 4:2319355-2319377 GCTCTTGGGGCCTTGGCAGGTGG - Intronic
969308530 4:6339201-6339223 TCTCCTGTGGCACTGGCAGGAGG + Intronic
969394885 4:6914051-6914073 GCTCACTTGAGCCTGGGAGGTGG + Intronic
969667196 4:8566489-8566511 GATCATTTGAACCTGGGAGGTGG + Intronic
969943891 4:10762860-10762882 GAGCATGTGAATCTGGCAGGGGG + Intergenic
970388237 4:15578710-15578732 GCTCACTTGAGCCTGGGAGGCGG - Intronic
970958187 4:21839664-21839686 AATCATGTGAACCTGGGAGGTGG + Intronic
971367975 4:25992907-25992929 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
972232710 4:37093754-37093776 GCTCCTGTCACCCTTGCAGTAGG - Intergenic
972478693 4:39477494-39477516 GCTCTTGTCACCCAGGCTGGAGG - Exonic
974426843 4:61752845-61752867 GATCACGTGAGCCTGGGAGGTGG + Intronic
976273009 4:83249078-83249100 GATCATTTGAGCCTGGGAGGTGG - Intergenic
976845478 4:89484120-89484142 ACTCATGTCACCATGGCAGCAGG - Intergenic
977413815 4:96703524-96703546 GCTCATGTGACTGTGCCAGCAGG + Intergenic
977700205 4:100013486-100013508 GCTCATCTAACCCTGGCTTGGGG + Intergenic
978118265 4:105048481-105048503 GATCATTTGAGCCTGGGAGGTGG + Intergenic
979938611 4:126730697-126730719 GCTCTTGTGCCCCAGGCTGGCGG + Intergenic
981806165 4:148717949-148717971 CCTCTAGAGACCCTGGCAGGTGG + Intergenic
982005568 4:151059901-151059923 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
982503954 4:156194966-156194988 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
983134976 4:164068636-164068658 GCGCATGAGCCCATGGCAGGTGG - Intronic
983703169 4:170623551-170623573 GCTGATCTGACACTGACAGGAGG + Intergenic
984508005 4:180643368-180643390 GATCCTGTGAGCCTGGTAGGTGG + Intergenic
984652950 4:182289141-182289163 GATCACTTGAGCCTGGCAGGCGG + Intronic
984978725 4:185256710-185256732 GATCATTTGAGCCTGGGAGGTGG - Intronic
984982127 4:185292429-185292451 GCTCTTGTCACCCGGGCTGGAGG + Intronic
985827189 5:2201219-2201241 TCACAGGTGACCCTGGCAGGAGG + Intergenic
985884094 5:2663094-2663116 GATCATCTGAGCCTGGAAGGCGG - Intergenic
986170103 5:5308064-5308086 GGTCATGCAACCCTGGCCGGAGG - Intronic
986289746 5:6390284-6390306 GTGCATGTGCCCCTGGCAGAGGG + Intergenic
986551341 5:8959375-8959397 ACCTATGTGACACTGGCAGGAGG + Intergenic
987150239 5:15031417-15031439 GCTCAGTTGAGCTTGGCAGGAGG - Intergenic
989030697 5:37115681-37115703 AATCATTTGACCCTGGGAGGTGG - Intronic
989153770 5:38324924-38324946 CCTCCTGTAACCCTGGTAGGTGG - Intronic
990076167 5:51848230-51848252 AATCATGTGAACCTGGGAGGTGG + Intergenic
991493273 5:67204176-67204198 CCTCATGTGAACCCGGGAGGTGG - Intergenic
991576750 5:68112527-68112549 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
992431457 5:76715352-76715374 GCGCAGGTGACCCCGGCGGGCGG + Intergenic
992539734 5:77752448-77752470 GATCATTTGAACCTGGGAGGCGG - Intronic
992746099 5:79822378-79822400 GCTCACTTGAACCTGGGAGGTGG - Intergenic
992957460 5:81924660-81924682 GTGCATCTGTCCCTGGCAGGAGG + Intergenic
993909596 5:93664911-93664933 GATCATTTGAGCCTGGGAGGCGG - Intronic
995143351 5:108758807-108758829 GATACTGTGACCCTGGAAGGAGG + Intronic
997387746 5:133486948-133486970 TGACATGTGACACTGGCAGGAGG + Intronic
998470533 5:142380391-142380413 GATCATTTGAGCCTGGGAGGTGG + Intergenic
1000312741 5:160061092-160061114 GCTCAGGACAGCCTGGCAGGAGG + Intronic
1000331243 5:160207259-160207281 AGTCATGTGACCCTGGGAGTCGG - Intronic
1000791221 5:165609794-165609816 AATCATGTGAGCCTGGGAGGCGG - Intergenic
1000856576 5:166405272-166405294 GATCATTTGAACCTGGGAGGCGG + Intergenic
1002169044 5:177365223-177365245 GCTCTTGTCACCCGGGCTGGAGG + Intronic
1003174448 6:3744728-3744750 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1004351127 6:14891424-14891446 GATCACTTGACCCTGGGAGGTGG - Intergenic
1004437633 6:15612717-15612739 GGTCATGTGACCCTAGAAGGTGG - Intronic
1004636933 6:17478219-17478241 GATCATTTGAGCCTGGGAGGCGG - Intronic
1005776462 6:29137533-29137555 TCTCAGGTGACTCTGACAGGAGG + Intergenic
1006391426 6:33761268-33761290 GGGCATGGGTCCCTGGCAGGTGG - Intergenic
1006628586 6:35414967-35414989 GCCCAGGGGACCCTGGCAAGTGG - Intronic
1006686235 6:35836666-35836688 GATCATTTGAACCTGGGAGGTGG + Intronic
1007068655 6:39018592-39018614 GCTCTGGTGACCTTTGCAGGAGG - Intronic
1007534589 6:42574780-42574802 GATCACTTGAACCTGGCAGGTGG - Intronic
1007760185 6:44128577-44128599 GCCCAGGGGACCCAGGCAGGGGG - Intronic
1007784312 6:44271084-44271106 GCTCAGGGGTCCCGGGCAGGGGG + Intronic
1008082402 6:47208316-47208338 CCACATGTGAGCCTGGCTGGAGG - Intergenic
1008223491 6:48882219-48882241 GCTCATGTGATGATGGCAGCTGG - Intergenic
1008744474 6:54652435-54652457 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1009395409 6:63193757-63193779 GCTCTTGTGGCCCAGGCAGGAGG + Intergenic
1009461842 6:63922474-63922496 AATCATGTGAACCTGGGAGGCGG + Intronic
1010472223 6:76242199-76242221 TTTCATATGGCCCTGGCAGGAGG - Intergenic
1010966266 6:82213112-82213134 ATTCATGTGAACCTGGGAGGTGG - Intronic
1015567947 6:134593221-134593243 CCTCCCGGGACCCTGGCAGGAGG - Intergenic
1016751994 6:147640462-147640484 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1017441300 6:154466704-154466726 GATCATTTGAGCCTGGGAGGTGG - Intronic
1017814503 6:158007050-158007072 GATCATCTGAACCTGGGAGGTGG - Intronic
1018450185 6:163900641-163900663 GCTCATCTCACCCTGCCAGGGGG + Intergenic
1019047546 6:169160412-169160434 TCTCATGTGATCCTCGCAGCAGG + Intergenic
1019584446 7:1790089-1790111 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1019692103 7:2421521-2421543 GACCATTTGAACCTGGCAGGTGG - Intronic
1019787580 7:2987178-2987200 AATCATGTGAACCTGGGAGGCGG - Intronic
1020013413 7:4818208-4818230 GCCCATGCAGCCCTGGCAGGCGG - Intronic
1020101529 7:5396908-5396930 GATCCTGTGCCCCTGGGAGGCGG - Intronic
1020578756 7:9968474-9968496 AATCATTTGAACCTGGCAGGCGG + Intergenic
1022204060 7:28146375-28146397 GCTCATGTCACCCTCACAGTGGG - Intronic
1022213416 7:28234158-28234180 GATCACTTGAGCCTGGCAGGTGG - Intergenic
1023074686 7:36471135-36471157 GATCATCTGAACCTGGGAGGTGG + Intergenic
1024579288 7:50788752-50788774 GCTGATGTGCCCCTGGGATGTGG - Intronic
1024849325 7:53692078-53692100 GCCCTCCTGACCCTGGCAGGGGG + Intergenic
1025107166 7:56181012-56181034 GATCATTTGAACCTGGGAGGTGG + Intergenic
1025279266 7:57615048-57615070 ACGTCTGTGACCCTGGCAGGGGG + Intergenic
1025305465 7:57850452-57850474 ACGTCTGTGACCCTGGCAGGGGG - Intergenic
1026052954 7:66962220-66962242 GCTCAGGAGACCGAGGCAGGAGG - Intergenic
1026144610 7:67735772-67735794 GATCATGTGAGCCTGGGAGGTGG - Intergenic
1026974255 7:74487122-74487144 AATCATGTGAACCTGGGAGGCGG - Intronic
1027011471 7:74748876-74748898 GCTCTTGTTACCCAGGCTGGAGG - Intronic
1027076569 7:75197166-75197188 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1028080011 7:86563508-86563530 GATCATTTGAACCTGGGAGGTGG + Intergenic
1029357278 7:100061433-100061455 GATCATTTGAGCCTGGGAGGTGG + Intronic
1030055394 7:105580070-105580092 GATCACGTGAACCTGGGAGGCGG - Intronic
1030674116 7:112366745-112366767 GCTCATGTAACTCATGCAGGAGG + Intergenic
1030716674 7:112815881-112815903 GATCATCTGAGCCTGGGAGGCGG - Intergenic
1031313736 7:120231509-120231531 GATCATCTGAGCCTGGGAGGTGG + Intergenic
1031458477 7:122013778-122013800 GCTGATGGGATCCTGGCAGCAGG + Exonic
1032003672 7:128283323-128283345 GCTTGTGTGAGCCTGGGAGGTGG - Intergenic
1032168955 7:129568211-129568233 GCTCTTGTCACCCAGGCCGGAGG - Intergenic
1034631342 7:152532789-152532811 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1034646132 7:152649573-152649595 GTGCATGTGAGCCTGGCCGGAGG - Intronic
1035354121 7:158266867-158266889 GCTCCAGTGGCCCTGGCTGGTGG + Intronic
1035922358 8:3691278-3691300 GATCACTTGACCCTGGGAGGCGG + Intronic
1036188037 8:6642338-6642360 GCACAGGTGATCCTGGCAGCTGG - Intronic
1036763145 8:11526630-11526652 GATCACGTGAACCTGGGAGGTGG + Intronic
1037449906 8:19006259-19006281 GCTCTTGTCACCCAGGCCGGGGG - Intronic
1037703949 8:21299509-21299531 AATCATGTGAACCTGGGAGGTGG + Intergenic
1038578824 8:28729206-28729228 GATCACTTGAGCCTGGCAGGTGG + Intronic
1042297638 8:67239091-67239113 AATCATGTGAACCTGGGAGGCGG - Intronic
1042950462 8:74196057-74196079 GATCATTTGAGCCTGGGAGGTGG - Intergenic
1044090725 8:87996760-87996782 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1045492969 8:102684423-102684445 GATCATATGAGCCTGGGAGGTGG - Intergenic
1045609957 8:103827803-103827825 GCTCTTGTCACCCAGGCTGGTGG - Intronic
1046805515 8:118475150-118475172 AATCACGTGACCCTGGGAGGTGG + Intronic
1047885273 8:129243413-129243435 GCTCATGTGTCCCTCTCTGGTGG - Intergenic
1049099367 8:140568195-140568217 GCTCACTTGAGCCTGGGAGGTGG + Intronic
1049218404 8:141418013-141418035 GCGCGGGTGAGCCTGGCAGGTGG + Intronic
1049485617 8:142858397-142858419 GTTGATGTGACGCTGCCAGGTGG - Intronic
1049823824 8:144654415-144654437 GATCAATTGACCCTGGGAGGTGG + Intergenic
1050468190 9:5954999-5955021 AATCATGTGAACCTGGGAGGTGG + Intronic
1050507921 9:6366604-6366626 GATCACCTGACCCTGGAAGGTGG + Intergenic
1050507943 9:6366740-6366762 GATCACCTGACCCTGGAAGGTGG + Intergenic
1051202497 9:14643159-14643181 GATCACGTGAACCTGGCAGGTGG + Intronic
1051645318 9:19262516-19262538 AATCATGTGAACCTGGGAGGTGG - Intronic
1053235924 9:36454208-36454230 AATCATTTGAACCTGGCAGGTGG - Intronic
1053240616 9:36491921-36491943 ACTCATTTGAACCTGGTAGGTGG - Intergenic
1053243368 9:36515168-36515190 GATCATTTGAACCTGGGAGGTGG + Intergenic
1053367318 9:37532385-37532407 GATCACGTGAGCCTGGGAGGCGG - Intronic
1053596105 9:39563299-39563321 GATCATCTGAACCTGGGAGGTGG + Intergenic
1053854072 9:42319938-42319960 GATCATCTGAACCTGGGAGGTGG + Intergenic
1054844779 9:69782366-69782388 AATCATGTGAACCTGGGAGGTGG + Intergenic
1054959439 9:70951426-70951448 GATCATTTGAACCTGGGAGGTGG - Intronic
1055002685 9:71470744-71470766 AATCATGTGAACCTGGGAGGCGG - Intergenic
1055073364 9:72189752-72189774 GATCATTTGAGCCTGGGAGGTGG + Intronic
1056160160 9:83882273-83882295 GATCATTTGAGCCTGGGAGGAGG + Intronic
1056309105 9:85321557-85321579 CCTCATGTCACCCAGGCTGGGGG + Intergenic
1056360064 9:85847562-85847584 GATCATTTGAGCCTGGGAGGAGG - Intergenic
1056384502 9:86084433-86084455 GGTTATGTATCCCTGGCAGGAGG - Intronic
1056645419 9:88407845-88407867 GATCATTTGAGCCTGGGAGGTGG - Intronic
1057195498 9:93113984-93114006 GCGCATGGCAGCCTGGCAGGTGG - Intergenic
1057207400 9:93181930-93181952 GCTCCTGGGATCCTGGCAGATGG - Intergenic
1057933646 9:99218379-99218401 GTTCATCTGATCGTGGCAGGTGG - Exonic
1059084115 9:111281708-111281730 GCTCACTTGAACCTGGGAGGCGG - Intergenic
1060193055 9:121605104-121605126 GATCATTTGAGCCTGGAAGGCGG - Intronic
1060427605 9:123519522-123519544 GATCACTTGAACCTGGCAGGTGG - Intronic
1061265267 9:129501094-129501116 GCAGATCTGAGCCTGGCAGGAGG - Intergenic
1062092596 9:134686338-134686360 GCTCGTTTGACCCTGGGTGGTGG - Intronic
1062235772 9:135506867-135506889 TCTCATGTCATCCTGGCTGGAGG + Intergenic
1062678426 9:137762441-137762463 CCTCTTGAGACCCTGTCAGGGGG + Intronic
1185473835 X:401361-401383 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1185578517 X:1192527-1192549 AATCATTTGACCCTGGGAGGTGG + Intronic
1185983282 X:4803386-4803408 AATCATGTGAACCTGGGAGGTGG - Intergenic
1186430402 X:9499889-9499911 TCTCATTTGAACCTGGGAGGTGG + Intronic
1187874212 X:23790297-23790319 GCTCACGTGAACCCGGGAGGTGG + Intergenic
1188095590 X:26017300-26017322 GTGGATATGACCCTGGCAGGTGG + Intergenic
1188304663 X:28547497-28547519 GATCATTTGAGCCTGGGAGGTGG - Intergenic
1188489641 X:30723707-30723729 GATCATTTGAGCCTGGGAGGTGG - Intronic
1189494074 X:41493508-41493530 GATCACTTGAGCCTGGCAGGTGG + Intergenic
1190093796 X:47462842-47462864 GATCATCTGAGCCTGGGAGGTGG - Intronic
1190543328 X:51499701-51499723 GCTCCTGTTACCCAGGCTGGAGG - Intergenic
1190755459 X:53397492-53397514 GATCATTTGAGCCTGGGAGGCGG + Intronic
1190932618 X:54962179-54962201 GCACATGGGACACTGGCAGACGG - Intronic
1192839840 X:74843499-74843521 GATGATGTGAACCTGGGAGGTGG - Intronic
1192844725 X:74894209-74894231 GATCACTTGAGCCTGGCAGGCGG + Intronic
1192994654 X:76500244-76500266 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1193138665 X:78002154-78002176 GATCACTTGACCCTGGGAGGTGG - Intronic
1193468542 X:81874028-81874050 CATCATGTGACACTGGAAGGAGG - Intergenic
1193902922 X:87204442-87204464 GCAAAAGTGACCCAGGCAGGTGG - Intergenic
1195296419 X:103482649-103482671 GATCACTTGAGCCTGGCAGGTGG - Intergenic
1198130701 X:133692033-133692055 GATCATTTGAACCTGGGAGGTGG - Intronic
1198332596 X:135635387-135635409 GGTAATTTGGCCCTGGCAGGAGG + Intergenic
1198386894 X:136137406-136137428 GATCATTTGAGCCTGGGAGGTGG + Intergenic
1199238449 X:145517798-145517820 TCTCCTGTGGCTCTGGCAGGAGG + Intergenic
1199942587 X:152639935-152639957 AATCAGGTGCCCCTGGCAGGAGG + Intronic
1200122383 X:153797323-153797345 GCTGCAGTGTCCCTGGCAGGAGG - Intronic
1200761693 Y:7044730-7044752 GATCATGTGACCCCAGGAGGCGG - Intronic