ID: 1165113501

View in Genome Browser
Species Human (GRCh38)
Location 19:33515249-33515271
Sequence CCTGGAGTCCCAGCCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 0, 2: 15, 3: 99, 4: 770}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165113497_1165113501 -1 Left 1165113497 19:33515227-33515249 CCGCAGCAGGGCAGGAAGCAGCC 0: 1
1: 3
2: 6
3: 71
4: 432
Right 1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG 0: 1
1: 0
2: 15
3: 99
4: 770
1165113495_1165113501 8 Left 1165113495 19:33515218-33515240 CCACATCAGCCGCAGCAGGGCAG 0: 1
1: 0
2: 3
3: 31
4: 307
Right 1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG 0: 1
1: 0
2: 15
3: 99
4: 770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165113501 Original CRISPR CCTGGAGTCCCAGCCTGCCC AGG Intronic
900099119 1:953584-953606 CAGGCAGTCCCTGCCTGCCCGGG - Intronic
900207689 1:1438605-1438627 TCTGGAGGCGCTGCCTGCCCTGG - Intronic
900247240 1:1642429-1642451 ACTGGAGTCGCAGCCCGCCTCGG - Exonic
900258464 1:1709561-1709583 ACTGGAGTCGCAGCCCGCCTCGG - Exonic
900287237 1:1907529-1907551 CCTGCAGGCCCAGCCTCCCCAGG - Intergenic
900422859 1:2563109-2563131 CGTGGAGACCCTGCCTGCTCAGG - Intronic
900947047 1:5836954-5836976 CCAGGGGTTGCAGCCTGCCCGGG + Intergenic
901083612 1:6597506-6597528 CCTGGAATCTCAGCCAGCTCTGG - Intronic
901190859 1:7408986-7409008 CCTCCTGTCCCAGCCTCCCCTGG + Intronic
901210828 1:7525130-7525152 CCTGGAGCCTCAGCCAGCCCTGG - Intronic
901636819 1:10674395-10674417 CGTGGGGTCCGAGCCTTCCCCGG + Intronic
901687098 1:10949013-10949035 CCAGGAGTTCCAGACTGGCCTGG + Intronic
901857645 1:12054506-12054528 CCTGAAGGCCCAGTCTGGCCTGG - Intergenic
902223413 1:14981147-14981169 GCTGGAGGCCCAGCCTTGCCGGG + Intronic
902549458 1:17210756-17210778 CCAGCAGCCCCAGCCAGCCCCGG + Intronic
902670917 1:17972942-17972964 CCAGGAGTTCCAGACTACCCTGG - Intergenic
902872705 1:19324172-19324194 CCTGGAGACCCGGCGTGCCCAGG + Intronic
902874277 1:19331622-19331644 CCCGAAGCCCCAGCTTGCCCTGG + Intergenic
903204423 1:21770111-21770133 CCAGGAGTTCCAGACTGGCCTGG + Intronic
903263274 1:22142645-22142667 CCCGGGGTCCCCTCCTGCCCGGG - Intronic
903384844 1:22919538-22919560 GCTGGAGGCCCCGCCTGGCCAGG - Intergenic
903548561 1:24142176-24142198 CCTGGAGACGCAGGCAGCCCTGG + Intronic
903862926 1:26375988-26376010 CCTGTAGTCCCAGCTTGAACAGG - Intergenic
903936164 1:26896574-26896596 CCTGAAGTCCCAGCTTACTCGGG + Intronic
904166610 1:28560403-28560425 CCTGTAGTCCCAGCTTACTCGGG - Intronic
904370743 1:30046021-30046043 CCTGGGGTCCCTGCCAGCCCCGG - Intergenic
904487229 1:30834602-30834624 CCTGGAGGCCCTCCCAGCCCAGG + Intergenic
904592249 1:31621419-31621441 CCGTGAGCCCCACCCTGCCCTGG - Intronic
905169039 1:36099022-36099044 CCTGGGGCCCCAGGCAGCCCGGG + Exonic
905182437 1:36175531-36175553 CCTGCATTCCCACCATGCCCTGG + Intronic
905442600 1:38004990-38005012 CCTCGAGTCCCTGCCTGTCTCGG + Intronic
905568641 1:38986541-38986563 TCAGGAGTCCTAGCCTGTCCTGG - Intergenic
905873377 1:41417317-41417339 CCTGGAGTCCACACCCGCCCAGG - Intergenic
906046979 1:42838697-42838719 CCCAGTGACCCAGCCTGCCCGGG - Intronic
906196139 1:43931889-43931911 GCTGGAGTCCCGGCCATCCCAGG + Intergenic
906306438 1:44722948-44722970 CCTGTAATCCCAGCCTACTCGGG + Intronic
906380442 1:45328962-45328984 GCTGAACTCCCAGCCAGCCCCGG - Intergenic
906529647 1:46516257-46516279 CCTGGAGACACTGCCTGCTCAGG - Intergenic
906645581 1:47472167-47472189 CCTGGTGACCCAGCAGGCCCAGG - Intergenic
906944848 1:50286966-50286988 CTTTGAGCCCCAGCCAGCCCAGG + Intergenic
907008574 1:50941424-50941446 TCAGGAGTCCCAGACTGGCCTGG - Intronic
907178070 1:52544161-52544183 CCTGTAGTCCCAGGCTACTCGGG + Intronic
910691745 1:89972595-89972617 CCTGTAGTCCCAGCTACCCCGGG + Intergenic
910793415 1:91074502-91074524 CATGGTGTCCAAGTCTGCCCTGG + Intergenic
911076033 1:93876078-93876100 CCTGTAGTCCCAGCCACCCAGGG - Intronic
911313222 1:96323434-96323456 CCTGTAGTCCCAGCTTCCCAAGG + Intergenic
911976975 1:104510003-104510025 CCAGGAGTTCCAGACTACCCTGG + Intergenic
912133716 1:106633632-106633654 CCAGGAGTTCCAGCCTAGCCTGG - Intergenic
912414024 1:109496021-109496043 CCTTGAGACCCTGGCTGCCCGGG - Exonic
913004194 1:114612475-114612497 CCTGTAGTCCCAGCCTACTCTGG - Intronic
914834674 1:151197401-151197423 CCTGTAGTCCCAGGCTACTCGGG - Intergenic
915736679 1:158089658-158089680 ACTGCAGTACCAGCCCGCCCAGG - Intronic
916536534 1:165708880-165708902 CCTGTAATCCCAGCTTACCCGGG + Intergenic
916571261 1:166029785-166029807 TCTGCAGCCCCAGCCTTCCCAGG - Intergenic
917884175 1:179367095-179367117 CCTGTAGTCCCAGCTTACTCTGG + Intronic
918044127 1:180931077-180931099 CCTGGAGTCCCTGTCTGTTCAGG - Intronic
919757989 1:201077849-201077871 CCGGGAGTGCCAGCCGACCCCGG + Intronic
919850896 1:201671686-201671708 CCTAGAGACCCAGCGTGCCCAGG - Intronic
920051230 1:203166217-203166239 TCTGCAGTCTCAGCCTCCCCAGG - Exonic
920115890 1:203621151-203621173 CCAGGAGTTCAAGCCTGGCCTGG - Intergenic
920173658 1:204087045-204087067 CCTGTAGTCCCAGCTTACTCGGG - Intronic
920191532 1:204196944-204196966 CCTGGAGACCCACGCTGACCTGG - Intergenic
920609958 1:207426330-207426352 CCAGGAGTTCCAGACTGGCCTGG + Intergenic
920869189 1:209779457-209779479 CCTGGAGTCCCAGCCAGTTCTGG + Exonic
921473113 1:215571753-215571775 CCTGTAGTCCCAGCTTACTCAGG - Intronic
921480356 1:215658056-215658078 CCTGTAGTCCCAGGCTACTCGGG - Intronic
921725167 1:218515412-218515434 CCTGTAATCCCAGCTTACCCGGG + Intergenic
922550103 1:226488445-226488467 CCTGGAAGCCCTGCCTGCCCTGG + Intergenic
922655803 1:227382583-227382605 CCAGGAGTCCAAGACTGGCCTGG - Intergenic
922719183 1:227891656-227891678 CCCCGACTCCCTGCCTGCCCTGG - Intergenic
922808296 1:228401817-228401839 CCTGGGGTCCCAGCATGCTTGGG - Intronic
923036769 1:230289988-230290010 CCTGTAGTCCCAAGCTACCCGGG - Intergenic
923089031 1:230724699-230724721 CCTGTAGTCCCAGCTTCCTCAGG + Intergenic
923573803 1:235140391-235140413 CCTGCAGGCCCTGCCGGCCCCGG + Intronic
924775454 1:247112293-247112315 CCTGGAGCCCGAGCATGGCCGGG - Exonic
1062759917 10:10581-10603 CCTGGACTGCCCGCCCGCCCGGG + Intergenic
1062919200 10:1266466-1266488 GGTGGGGTCCCAGCCGGCCCTGG - Intronic
1062934928 10:1378523-1378545 CCTGCAGTCCCATCCTCACCTGG - Intronic
1063710566 10:8473823-8473845 CCAGGAGTTCCAGCCTAGCCTGG - Intergenic
1064005045 10:11692658-11692680 CCAGGTGTCCCAGTCTGCTCTGG + Intergenic
1064088114 10:12360876-12360898 TCTGCAGTCCCGGCCTGGCCCGG - Intronic
1064620424 10:17210968-17210990 CCTATAGTCCCAGCCTACTCAGG - Intergenic
1065235648 10:23648916-23648938 TCTGAACTCCCAGGCTGCCCTGG + Intergenic
1066314382 10:34229341-34229363 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1067037074 10:42928422-42928444 CCCAGAGTCCCAGGCTGTCCTGG - Intergenic
1067039847 10:42943507-42943529 CCTGGACTTCCACCCTGGCCAGG + Intergenic
1067453120 10:46394567-46394589 CCTGTAGTCCCAGCTTACTCGGG + Intergenic
1067584113 10:47465192-47465214 CCTGCAGTCCCAGCTTACTCAGG - Intronic
1068444010 10:57096356-57096378 CCTGGACACCAAGCCTGCCAAGG - Intergenic
1068617309 10:59133430-59133452 CCTGGTTCCTCAGCCTGCCCTGG + Intergenic
1068665397 10:59669710-59669732 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1068737946 10:60435961-60435983 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1069604026 10:69728801-69728823 CATGAAGCCCCAGCCTGCCAAGG - Intergenic
1069677454 10:70258798-70258820 TTTGGAGTCAGAGCCTGCCCTGG + Intronic
1069936535 10:71921482-71921504 CCTCCAGTCCCAGGCTGTCCTGG + Intergenic
1069972940 10:72188963-72188985 CCAGGAGTTCAAGACTGCCCTGG - Intronic
1070116708 10:73535751-73535773 CCTGGAGTTCGAGCCTAGCCTGG - Intronic
1070727576 10:78802803-78802825 CCAGCAGTCCCTGCCTGGCCTGG - Intergenic
1071336079 10:84601440-84601462 CCTGAGGTCTCAGCCTCCCCGGG - Intergenic
1071977245 10:90967447-90967469 CCTGTAGTCCCAGGCTACTCAGG + Intergenic
1072099488 10:92215871-92215893 CCTGTAGTTCCAGCCTACTCGGG - Intronic
1072278485 10:93845289-93845311 CCGGCAGGCCCTGCCTGCCCCGG + Intergenic
1072705517 10:97678000-97678022 CCTGGAGCCCCACTCTGCACTGG - Exonic
1072744891 10:97933079-97933101 CCAGGGGTCCCAACCAGCCCAGG - Intronic
1072787450 10:98293878-98293900 CCATCAGCCCCAGCCTGCCCAGG - Intergenic
1072969740 10:100006988-100007010 CCTGCAGTCCCAGCTTACTCGGG + Intronic
1073334170 10:102692831-102692853 CCTGTAGTCCCAGCCTACTAGGG - Intronic
1074230631 10:111531625-111531647 CCTGGGGTCCCAGCCTACAAAGG + Intergenic
1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG + Intronic
1075389973 10:122084907-122084929 CAGGGAATCCCATCCTGCCCAGG + Exonic
1075414000 10:122249210-122249232 CCAGAGGTCCCAGCCTGCCTGGG - Intronic
1075486051 10:122822866-122822888 CCTAGAGGCTTAGCCTGCCCGGG - Intergenic
1076050344 10:127328554-127328576 CCTGGCGTCCCTGCCATCCCTGG - Intronic
1076074981 10:127526442-127526464 CCTGGGCTCCCAGCCTCCCATGG + Intergenic
1076125300 10:127969456-127969478 CCAAGAGTCCCAGACTACCCTGG + Intronic
1076444813 10:130507220-130507242 CCTGGAGTTCCAGCCTTACCTGG - Intergenic
1076516313 10:131046713-131046735 CCTGGAAGCCCATCCTGCCCTGG - Intergenic
1076526804 10:131117234-131117256 CCTGGAGTGAGGGCCTGCCCAGG - Intronic
1076627160 10:131829222-131829244 CCTGGAATCCCGGCCAGACCTGG - Intergenic
1077061732 11:620507-620529 CCGGGCGTCCCTGCCTGCCTAGG + Intronic
1077165020 11:1130978-1131000 CCTGGGGTCACAGGCTGGCCTGG + Intergenic
1077183833 11:1227806-1227828 CCTGGAGGCCGTCCCTGCCCAGG - Intronic
1077344579 11:2040327-2040349 CCTGGTGTCCCAGCCCCCCAAGG + Intergenic
1077472226 11:2769446-2769468 CCTGGAGCTCCAGCCTCACCTGG - Intronic
1077506493 11:2932068-2932090 CCTGGAGGCCAGGCCTCCCCAGG + Intergenic
1078061516 11:8048613-8048635 CCAGGAGTTCCAGACTGGCCTGG - Intronic
1078821996 11:14891941-14891963 CCTGGCGGCCCTCCCTGCCCGGG + Intronic
1079060770 11:17247044-17247066 CCTTTAGTCCCAGCCTGCTTGGG - Intronic
1079217260 11:18525033-18525055 CCTGTAATCCCAGCCTACTCGGG - Intronic
1079774731 11:24510550-24510572 CATGGAGAACCAGCCAGCCCTGG - Intronic
1080644895 11:34181391-34181413 TCTGGGGTCCCTGCCTACCCCGG - Intronic
1081898586 11:46608567-46608589 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1083432578 11:62621967-62621989 CCTGCAGACCCCGCCTGCTCGGG - Exonic
1083611267 11:64005536-64005558 GCTGGACACCCAGCCAGCCCAGG - Intronic
1083634852 11:64115065-64115087 CCTGAAGTCCCAGCCTGGGAGGG - Intronic
1084185910 11:67471068-67471090 CCTGTAATCCCAGCCTCCTCGGG - Intergenic
1084296640 11:68216454-68216476 CCAGGAGTGCCAGCCTAGCCCGG + Intergenic
1084314971 11:68340352-68340374 CCTGGATTCAAAGCCTGGCCTGG - Intronic
1084438165 11:69156052-69156074 CCTGGAGCCCCTGCCTGGACTGG - Intergenic
1084454129 11:69257683-69257705 CCTGGAGCCTCTGCATGCCCTGG + Intergenic
1084533140 11:69741174-69741196 GATGGAGTCCTAGCCTTCCCTGG + Intergenic
1084662164 11:70552323-70552345 CCAGGAGTCCCAACCTCCCGAGG - Intronic
1084837579 11:71813844-71813866 CCTGGAGACCCGGCCCGCCGAGG + Intergenic
1084910822 11:72387933-72387955 CCTGGAGGGACAGCCTGCCATGG - Intronic
1085030077 11:73265691-73265713 CCTGCAGCCCCTTCCTGCCCAGG - Intronic
1085351807 11:75802565-75802587 CCAGAAGCCCCAGCCTGCCCGGG + Intergenic
1085396799 11:76210506-76210528 CCGGGTGCCCCGGCCTGCCCAGG + Intronic
1085667869 11:78431656-78431678 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1085698874 11:78728836-78728858 CCTGGAGTCCTAGCCTCTCTTGG - Intronic
1085743965 11:79099197-79099219 CCTGGATTCCCCTCCTGCCAGGG + Intronic
1086049848 11:82577320-82577342 CTTGGAATCCCAGCCAGCCAAGG + Intergenic
1087269957 11:96100953-96100975 CCAGGAGTTCCAGACTACCCTGG - Intronic
1087709283 11:101530674-101530696 CCTGGAAGTCCAGTCTGCCCAGG + Intronic
1088489152 11:110370121-110370143 CCTGTAGTCCCAGCCACCCAGGG + Intergenic
1088739329 11:112754014-112754036 CCAGGTGTCCCAGTTTGCCCAGG - Intergenic
1089144303 11:116313164-116313186 GAGGCAGTCCCAGCCTGCCCTGG - Intergenic
1089152486 11:116374638-116374660 CCTGGGCTCCCATCCTGCCCTGG + Intergenic
1089299658 11:117490908-117490930 CCTCCAGCCCCAGCCTGCCCTGG - Intronic
1089543694 11:119206393-119206415 CCTGGGCTCCGACCCTGCCCAGG + Exonic
1089579166 11:119470810-119470832 TCAGGTGTCCCAGCCTCCCCTGG + Intergenic
1089587604 11:119520258-119520280 CCCAGAGTCTCAGGCTGCCCTGG + Intergenic
1089638611 11:119832467-119832489 CCTGGGTTCCCAGCCTTTCCAGG - Intergenic
1089720616 11:120416773-120416795 CCTGTAGTCCCAGGCTACTCAGG - Intronic
1090049237 11:123362831-123362853 CCTGGAGATACAGGCTGCCCCGG + Intergenic
1090356936 11:126146643-126146665 CCTGGAGGCCCAGCCAGGCCTGG - Intergenic
1090357244 11:126148125-126148147 TCAGGAGTCCCAGGCAGCCCAGG + Intergenic
1090901242 11:131033555-131033577 CCTGCTGACTCAGCCTGCCCTGG - Intergenic
1091133352 11:133165402-133165424 CCTGGAGACCCTCCCTGGCCAGG + Intronic
1091147820 11:133295376-133295398 CCTGGAATGCCAGCCTTCCTTGG - Intronic
1091302093 11:134514395-134514417 CCTGGAGAGTCAGCCTGCACTGG - Intergenic
1091361432 11:134981223-134981245 CCTGGTGACAAAGCCTGCCCTGG + Intergenic
1202827565 11_KI270721v1_random:95516-95538 CCTGGTGTCCCAGCCCCCCAAGG + Intergenic
1091705173 12:2688717-2688739 CCTGGGGCCCCAGCCTGGCTGGG - Exonic
1091928002 12:4371019-4371041 CCTGGAGGCCCGGGCTGGCCTGG + Intronic
1092401119 12:8180225-8180247 CCTGGAGACCCGGCCCGCCGCGG - Intronic
1092645064 12:10561703-10561725 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1093576124 12:20732036-20732058 TCTGGAGACCCAGCTTGCCTGGG - Intronic
1094008011 12:25775991-25776013 CCTGGAGTCCCTTCCTGTCTGGG + Intergenic
1094411308 12:30170624-30170646 CCTGCAGTCCCAGCCTCCCTTGG + Intergenic
1094647925 12:32345075-32345097 CCAGGAGTCCGAGACTGGCCTGG + Intronic
1096839943 12:54374014-54374036 CCTGGAGACCCAGCTCCCCCAGG - Exonic
1097078453 12:56412331-56412353 CCTGGATTCCATGCCTGCCATGG + Intergenic
1097771934 12:63597095-63597117 CCTGTAGTCCCAGCCTGAGTAGG - Intronic
1097845792 12:64364101-64364123 CCAGGAGTTCCAGACTGGCCTGG + Intronic
1098150926 12:67545461-67545483 CCTGGTGTGCCAGCCTCCCTCGG - Intergenic
1098383154 12:69890608-69890630 CCTGTAGTCCCAGCTTACTCAGG + Intronic
1098886037 12:75961817-75961839 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1099836847 12:87917266-87917288 CCTGTAATCCCAGCCTACTCGGG + Intergenic
1100349298 12:93763777-93763799 CCTGGAGTCCCCTTCTGCCAGGG - Intronic
1100397365 12:94196703-94196725 CCTCGAGTCCAGGCCTGGCCAGG + Intronic
1100462927 12:94818730-94818752 CCTGTAATCCCAGCTTCCCCGGG + Intergenic
1101316705 12:103635547-103635569 CCAGGAGCCCCAGACTGCGCAGG + Intronic
1101318305 12:103649957-103649979 CCTGTCGTCCCAGCTTCCCCAGG + Intronic
1102004653 12:109581439-109581461 GCTGGAGCCCAAGCCCGCCCCGG - Exonic
1102207619 12:111101204-111101226 CCTGGGGCACCAGCCTCCCCCGG - Intronic
1102254754 12:111409120-111409142 CCAAGAGTTCCAGCCTCCCCAGG + Intronic
1102577243 12:113863488-113863510 GCAGGACTCCCAGCCTGCCCAGG - Intronic
1102579793 12:113879103-113879125 CCTGGCCACCCATCCTGCCCTGG + Intronic
1103212797 12:119179012-119179034 CCAGGCTTCCCAGGCTGCCCAGG - Exonic
1103401145 12:120643638-120643660 CCAGGATTTCCAGACTGCCCGGG - Intronic
1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG + Intergenic
1103960001 12:124603468-124603490 GCTGCAGTCCCTCCCTGCCCTGG - Intergenic
1104001611 12:124863923-124863945 CCTGAAGCCCAAGGCTGCCCGGG - Intronic
1104062627 12:125281236-125281258 CCGGGCTTCCCTGCCTGCCCTGG - Intronic
1104062799 12:125282294-125282316 CCTGGTGCCCCCGCCTTCCCCGG + Intronic
1104699930 12:130895042-130895064 CCAGGAGTTCCAGGCTGGCCTGG + Intergenic
1105007407 12:132729735-132729757 CCTTGAGTCCCAGCAGCCCCAGG - Exonic
1105010054 12:132749615-132749637 TCTGGAGTACCAGCCCGCCAGGG + Intronic
1105304505 13:19159302-19159324 CCTGGAGTGTCTGTCTGCCCAGG - Intergenic
1105330228 13:19409262-19409284 CCTGGAGCCCCAGCCTGACAGGG + Intergenic
1105334553 13:19454456-19454478 GCCTGATTCCCAGCCTGCCCAGG + Intronic
1105408640 13:20151578-20151600 CCTGGAGCCCCGGTCTGCTCTGG - Intronic
1105490595 13:20884163-20884185 CCAGGAGTTCAAGACTGCCCTGG + Intronic
1105524936 13:21168648-21168670 CCTGTAGTCCCAGCTACCCCAGG - Intronic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105860363 13:24404880-24404902 GCCCGATTCCCAGCCTGCCCAGG - Intergenic
1105861577 13:24419792-24419814 CCTGGAGCCCCAGCCTGTCAGGG - Intergenic
1105918312 13:24938087-24938109 CCTGGAGCCCCAGCCTGTCAGGG + Intergenic
1106155154 13:27148002-27148024 CCTGTAGTCCCAAGCTGCTCAGG + Intronic
1106231703 13:27825840-27825862 CCTGGAGTCCCCGCCAGCCCAGG - Intergenic
1107876998 13:44799702-44799724 CCTAGAGTCCCACCCTGTACAGG - Intergenic
1108310231 13:49182104-49182126 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1108386475 13:49903908-49903930 CCTGTAGTCCCAGCCTGCTCTGG - Intergenic
1109061439 13:57626257-57626279 CCTGTAATCCCAGCCTACTCGGG + Intergenic
1109426362 13:62169182-62169204 CCTGGATTCCATGCCTGCCAAGG - Intergenic
1109740622 13:66549808-66549830 CCAGGAGTTCCAGCCAGCCTGGG + Intronic
1110221173 13:73075729-73075751 CCTCCAGTCGCAGCCTTCCCAGG - Exonic
1110433511 13:75454143-75454165 CCTGTAGTCCCAGGCTCCCAGGG - Intronic
1110610194 13:77479370-77479392 CCTGGAGTTCCAGACTAGCCTGG + Intergenic
1110871085 13:80452744-80452766 ACTTGAGGACCAGCCTGCCCAGG + Intergenic
1111072037 13:83182966-83182988 CCTGGATCCCAAGCCTGCCAAGG + Intergenic
1111599136 13:90449014-90449036 CCAGGAGTTCCAGACTGGCCTGG + Intergenic
1111965582 13:94858479-94858501 CCTGGTGACCCTGCCTGCCTTGG + Intergenic
1112076788 13:95922696-95922718 CCTGCAGTCCCAAGCTGCCCAGG + Intronic
1113113151 13:106846177-106846199 CCTTCAGGCCCAGCTTGCCCTGG + Intergenic
1113424730 13:110198598-110198620 CCAGGGGCACCAGCCTGCCCAGG + Exonic
1113457024 13:110456689-110456711 CCTGGTGTCCCACCCAGCCCAGG - Intronic
1113462529 13:110492075-110492097 CCTGGAGGCCCAGTCAGCCCTGG - Exonic
1113612903 13:111660439-111660461 CAGGGAGTCCCAGCCTGCCCTGG - Intronic
1113707215 13:112442685-112442707 CCTGCAGTCCCTCCCTGCACGGG + Intergenic
1115790089 14:36868795-36868817 CCTGGTTTCCCAGACTTCCCTGG + Intronic
1117072460 14:52069097-52069119 CCTGGAGTCCCGCCCCGCCCAGG - Intronic
1117295217 14:54372827-54372849 CCTGCAGTCCCAGCTTACTCAGG - Intergenic
1117689426 14:58290903-58290925 CCTGTAGTCCCAAGCTACCCAGG + Intronic
1119422687 14:74516961-74516983 CCCTGAGTCACAGCCAGCCCTGG + Intronic
1119682811 14:76605423-76605445 TCTGGAACCCCAGCCTGCTCAGG + Intergenic
1119775000 14:77242804-77242826 GCTGTGGACCCAGCCTGCCCTGG - Intronic
1121114928 14:91336859-91336881 CCTGGGCTCACAGCCTTCCCCGG + Intronic
1121276327 14:92670485-92670507 CCTGGGGTTCCAGGCTGCTCAGG + Intronic
1121441463 14:93952360-93952382 CCTGGAATCCGTGCCTGCCAGGG - Intronic
1121640258 14:95480546-95480568 GCTGGAGACACAGCCTCCCCAGG + Intergenic
1122003719 14:98685108-98685130 CCTGTAGTCCCAGCTTACTCAGG + Intergenic
1122043454 14:99007089-99007111 CCAGGAGTCCCACACTCCCCGGG - Intergenic
1122079148 14:99254716-99254738 CCTGGAGGGACAGCCGGCCCGGG + Intronic
1122274866 14:100586328-100586350 CCTGGACCCCCAGTCTGCACTGG + Intronic
1122297060 14:100711697-100711719 CCTGGGGCCCCAGCCGGCCTGGG - Intergenic
1122540126 14:102493428-102493450 CCTGGAGCCCCTGCATCCCCTGG + Intronic
1122550578 14:102547011-102547033 CCTGTAGTCCCAGCTGGCTCGGG + Intergenic
1122640192 14:103155386-103155408 CCTGGGGTCCCAGCCTGTCCTGG - Intergenic
1122640198 14:103155404-103155426 CCTGGGGTCCGAGCCTGTCCTGG - Intergenic
1122640205 14:103155422-103155444 CCTGGGGTCCCAGCCTGTCCTGG - Intergenic
1122640216 14:103155458-103155480 CCTGGGGTCCGAGCCTGTCCTGG - Intergenic
1122640223 14:103155476-103155498 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640229 14:103155494-103155516 CCTGGGGTCCGAGCTTGTCCTGG - Intergenic
1122640236 14:103155512-103155534 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640243 14:103155530-103155552 CCTGGGGTCCGAGCCTGTCCTGG - Intergenic
1122640250 14:103155548-103155570 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640258 14:103155566-103155588 CCTGGGGTCCCAGCCTGTCCTGG - Intergenic
1122640264 14:103155584-103155606 CCTGGGGTCCGAGCCTGTCCTGG - Intergenic
1122640271 14:103155602-103155624 CCTGGGGTCCCAGCCTGTCCTGG - Intergenic
1122640277 14:103155620-103155642 CCTGGGGTCCGAGCCTGTCCTGG - Intergenic
1122640284 14:103155638-103155660 CCTGGGGTCCCAGCCTGTCCTGG - Intergenic
1122640290 14:103155656-103155678 CCTGAGGTCCGAGCCTGTCCTGG - Intergenic
1122640301 14:103155692-103155714 CTTGGGGTCCGAGCCTGTCCTGG - Intergenic
1122740469 14:103869016-103869038 CCCTGAGCCCCAGCTTGCCCAGG - Intergenic
1122906891 14:104805736-104805758 CCAGGAGGCCCACCCTGGCCAGG - Intergenic
1122932666 14:104941872-104941894 CCTGGAGGTCCAGGCTGGCCAGG - Exonic
1122933477 14:104945337-104945359 CCTGGAGGTCCAGGCTGGCCAGG - Exonic
1123699794 15:22905882-22905904 CCTGTAGTCCCAGCTTACTCGGG - Intronic
1123715607 15:23028164-23028186 CCTGCAATCCCAGCCTGGGCTGG + Intronic
1123781624 15:23634165-23634187 CCTAGACTTCCAGCCTGGCCTGG + Intergenic
1123895668 15:24827389-24827411 CCTGTAGTCCCAGCATACTCAGG + Intronic
1123939170 15:25208487-25208509 CCTGGAGTCCCCACATGGCCTGG - Intergenic
1124041926 15:26113471-26113493 CCTGGAGCCTCAGCATGCCCTGG + Intergenic
1124368535 15:29090531-29090553 GCTGGCCTCCCAGCCTCCCCAGG + Intronic
1124830501 15:33144511-33144533 CCTGTAGTCCCAGGCTACTCGGG + Intronic
1125324039 15:38517828-38517850 CCTGGAATCCCATCCAGCTCTGG + Intronic
1127175068 15:56345546-56345568 CCTGTAGTCCCAGCCTACTTGGG - Intronic
1127187929 15:56499370-56499392 CCTGTAGTCCCAGCTTACTCAGG + Intergenic
1127306364 15:57709447-57709469 CCTGTAGTCCCAGGCTACTCAGG + Intronic
1128013146 15:64317620-64317642 CCTGTAGTCCCAGCCATCCTGGG - Intronic
1128316062 15:66660143-66660165 CCTGTAGTCCCAGCTTCTCCAGG - Intronic
1128757276 15:70191565-70191587 CCAGCAGTCCCAGCATGGCCAGG + Intergenic
1128937425 15:71758715-71758737 CTTGGAGAACCAGCCAGCCCTGG - Intronic
1129108237 15:73323227-73323249 CCGGGAGTCCCAGGCCTCCCCGG + Exonic
1129178511 15:73856981-73857003 CCAGGTGTGCCAGGCTGCCCTGG + Intergenic
1129814709 15:78541153-78541175 CCTGGAGAGCCCGCGTGCCCAGG - Intronic
1130040757 15:80404105-80404127 CCTGCGGTCCCAGCCCGGCCAGG + Intergenic
1130512384 15:84600576-84600598 CATGGATTCCCTTCCTGCCCAGG + Intergenic
1130546416 15:84859921-84859943 CCCGGGGTCTCAGCCTGGCCTGG + Intronic
1130642783 15:85694738-85694760 TCTGGAGTTCCAGCCAGTCCAGG + Intronic
1130992935 15:88887318-88887340 CCTGGGGCCCCAGCCTGGCCCGG - Exonic
1131065390 15:89431710-89431732 CCTGGAGACACAGCCTGCACCGG + Intergenic
1131109798 15:89758240-89758262 CATGGAGTCCCTCCCTCCCCTGG + Intergenic
1131979320 15:97979923-97979945 TGCGGAGGCCCAGCCTGCCCTGG + Intergenic
1132222717 15:100116984-100117006 CCTGGAGGCACACACTGCCCGGG - Exonic
1132468189 16:87355-87377 CCTGTAGTCCCAGCTTACCTGGG - Intronic
1132618760 16:854729-854751 CCGGGAGTCCCAGCAGGCCCTGG - Intronic
1132624164 16:882304-882326 CCTGGAATCCCAGCCGACCTTGG + Intronic
1132793475 16:1706692-1706714 CCCGGACCCCCAGCCAGCCCCGG + Intronic
1132939533 16:2499986-2500008 CCAGGAGCACCCGCCTGCCCTGG + Intronic
1133119285 16:3596283-3596305 CCTGGAGCCACAGCCTGCAGTGG + Exonic
1133402906 16:5501837-5501859 CCTGTAGTCCCAGCATGTACTGG - Intergenic
1133761401 16:8801459-8801481 CCAGGAGTTCCAGACTGGCCTGG + Intronic
1134047140 16:11109238-11109260 CCTGGAGTTCCAGGTTGCACTGG - Intronic
1134173432 16:11987186-11987208 CCTGTAGTCCCAGCCTCCTGGGG - Intronic
1134284570 16:12849277-12849299 CCTGTAGTCCCAGCCTGTTAGGG - Intergenic
1134447515 16:14342215-14342237 CCAGGAGTTCCAGACTACCCTGG - Intergenic
1134840354 16:17396843-17396865 GGTGGAGTCCCACTCTGCCCAGG - Intronic
1135022507 16:18974568-18974590 CCTGTAGTCCCAGCTTACTCGGG - Intergenic
1135238299 16:20779297-20779319 CCTGTAGTCCCAGCCTACTCGGG + Intronic
1135574054 16:23571446-23571468 CCTAGAGGCCCAGCCTGGCATGG + Exonic
1135820538 16:25681378-25681400 CCTGTAGTCACAGGCTGCTCGGG + Intergenic
1136003583 16:27313897-27313919 CGCGGAGACCCAGCCCGCCCCGG - Exonic
1136049891 16:27642675-27642697 CCTGGTGTCCCATGTTGCCCTGG - Intronic
1136079867 16:27844884-27844906 GCTGAAGTCCCAGCGTGCCTTGG + Intronic
1136387137 16:29935716-29935738 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1137611909 16:49823956-49823978 CCTGTAGTCCCAAGCTGCTCAGG + Intronic
1137670348 16:50274831-50274853 CCTGGAGGCCTTTCCTGCCCTGG + Intronic
1137794003 16:51199427-51199449 CCAGGAGTTCCAGACTACCCAGG - Intergenic
1137862349 16:51858741-51858763 CCTAGACTCCCAGCCTGCCCAGG + Intergenic
1138589554 16:57992342-57992364 TTTGGTGGCCCAGCCTGCCCTGG + Intergenic
1138844416 16:60547939-60547961 CCTGTAGTCCCAGCCTACTCAGG + Intergenic
1139457562 16:67094166-67094188 CCTGGAGTTCCAGACCACCCCGG - Intronic
1139878255 16:70163705-70163727 CCTGGAGACCCTGGCTGGCCAGG - Intergenic
1139956451 16:70695492-70695514 CCATGAGTCCAAGGCTGCCCTGG - Intronic
1140359308 16:74331109-74331131 CCTGGAGACCCTGGCTGGCCAGG + Intergenic
1140420208 16:74813187-74813209 CCAGGTGTCACAGCCAGCCCAGG - Intergenic
1140566537 16:76049205-76049227 CCTGGGGCCCCAGCCTGCATTGG - Intergenic
1141041590 16:80677092-80677114 CCTGTAGTCCCAGCTTTCCAGGG - Intronic
1141428225 16:83957224-83957246 CCTCGAGTCCCAGTGTGGCCTGG - Intronic
1141660279 16:85437623-85437645 GCTGGAGCCTCAGCCTGCGCAGG + Intergenic
1141895684 16:86957421-86957443 CCTGGCTTCCCATCCTGCCGTGG - Intergenic
1141953492 16:87354261-87354283 CCAGGAGTTCCAGACTGGCCTGG + Intronic
1142317947 16:89361028-89361050 CCTGGAGCCCAGGGCTGCCCAGG - Intronic
1142519405 17:494356-494378 CCTGGTATTCCAACCTGCCCAGG + Intergenic
1142683095 17:1561934-1561956 CCGGGAGGCCCTGCCTGCCCCGG + Intronic
1143175342 17:4951852-4951874 CCTGGAGTCCAAGATTTCCCGGG - Exonic
1143222902 17:5277325-5277347 TCAGGAGTTCCAGACTGCCCTGG - Intergenic
1143445337 17:7005956-7005978 CTGGGAGTCCCAGCAGGCCCCGG - Exonic
1143874558 17:9981833-9981855 CCTGGGATTCCAGCCAGCCCTGG - Exonic
1144015294 17:11189597-11189619 CCTGTAGTCCCAGCTTACTCTGG - Intergenic
1144677563 17:17171622-17171644 CCAGGAATCCCACCCTGTCCAGG - Intronic
1144854725 17:18261468-18261490 CATGAGGTCACAGCCTGCCCGGG - Intronic
1144943955 17:18960363-18960385 CCTGGAATCCCGGGCTGCTCCGG - Intronic
1145032567 17:19516092-19516114 CCTGGAGTTCAAGCCTAGCCTGG + Intronic
1145285546 17:21503620-21503642 CCTGGGGTGGCAGCATGCCCAGG - Intergenic
1145948839 17:28799730-28799752 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1146183756 17:30712098-30712120 CTTCTATTCCCAGCCTGCCCAGG + Intergenic
1146258253 17:31404269-31404291 CCTGCAGCCCCAGCCGGCCTTGG + Intronic
1146465585 17:33083785-33083807 TCTGGAGTCCCTGCCTAGCCTGG - Intronic
1146543605 17:33719040-33719062 CCTTGACTCCCTGGCTGCCCGGG + Intronic
1146934992 17:36807897-36807919 CCCAGAGTCTCAGCCGGCCCAGG - Intergenic
1147156092 17:38545125-38545147 TCTGGAGTCCCATCCTGGGCTGG + Intronic
1147188804 17:38726917-38726939 CAAAGAGTCCCCGCCTGCCCAGG + Exonic
1147323664 17:39660295-39660317 CCTGGAGCCCCAGACAGCACAGG + Intronic
1147370030 17:39986168-39986190 CCAGGAGTCTGAGCCTGCACTGG - Intronic
1147423365 17:40333543-40333565 CCAGGAGTCCAAGACTGGCCTGG - Intronic
1148113718 17:45162378-45162400 GCTGCACTCCCAGCCTCCCCAGG + Intronic
1148331556 17:46816945-46816967 CCTGAAGTCCCTGGCTGCCCTGG + Intronic
1148351707 17:46946027-46946049 CCTGGAGGCCCCGCCTTCCAAGG - Intronic
1148554545 17:48570476-48570498 CCTGGATTCCCTGCCTGCCCCGG - Intronic
1149078058 17:52620047-52620069 CCTGTAATCCCAGCCTACTCAGG + Intergenic
1149790712 17:59474587-59474609 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1150108672 17:62479305-62479327 CCTGGAGTCCTCCCCCGCCCGGG - Intronic
1150223036 17:63507920-63507942 CCTGGGGCACCAGCCTACCCTGG + Intronic
1150227440 17:63531613-63531635 CCTGGCGTCCCACCCTCCTCAGG - Intronic
1150270211 17:63859323-63859345 CCTGGAGCTGCAGCCTGCCTGGG + Intergenic
1150445630 17:65225285-65225307 CCTGGCCTCGCAGCCGGCCCAGG + Exonic
1150610250 17:66727768-66727790 CCTGAAGACCCAGCCTTCCCTGG - Intronic
1150615094 17:66764328-66764350 CCTGGAGTCCCATCCTCTCTGGG + Intronic
1150804050 17:68304962-68304984 CCAGGAGTTCCAGACTGGCCTGG + Intronic
1150923645 17:69509916-69509938 ACTGCAGTCTCAGCCTCCCCTGG + Intronic
1151143888 17:72020794-72020816 CCAGCAGTCCCAGCTTGCCCAGG - Intergenic
1151265009 17:72948018-72948040 CCTGAAGACCCAGCATGGCCTGG - Intronic
1151456517 17:74229425-74229447 CCTGTAGAACCAGCCTGCCAGGG + Intronic
1151495981 17:74458358-74458380 CCAGGAGTCCTAGACTGGCCGGG - Intergenic
1151497791 17:74469311-74469333 CCAGGAGTCCGAGACTGGCCTGG + Intronic
1151671476 17:75573793-75573815 CCTGGACTGCCAGCTTGCACAGG - Intronic
1151754830 17:76068165-76068187 CCTGTAATCCCAGCCTACTCGGG + Intronic
1151770695 17:76158637-76158659 CCAGGAGTCCCAGCCCAGCCTGG - Intronic
1151958870 17:77394529-77394551 CCTGGAATTCCACCCTGCCCTGG + Intronic
1152100340 17:78297891-78297913 CCTGGGGGCTCAGCCTGCCAGGG + Intergenic
1152137314 17:78512106-78512128 CATTAAGTCCCAGCCAGCCCAGG - Intronic
1152310253 17:79545547-79545569 CTTGGTGTCCCAGGCTTCCCAGG + Intergenic
1152428042 17:80229316-80229338 CTTCCAGTCCCAGCCTGGCCTGG + Intronic
1152569078 17:81113567-81113589 CCTGCTGTCCCAGCCAGCCTTGG + Intronic
1152573848 17:81131728-81131750 CCTGGGGTCCCACCCTCCCATGG + Intronic
1152811054 17:82383034-82383056 GCTGGAGTCAGAGCCTGCTCAGG + Intergenic
1152920328 17:83063347-83063369 CCCGGACACGCAGCCTGCCCTGG - Intergenic
1152952788 18:10777-10799 CCTGGACTGCCCGCCCGCCCGGG + Intergenic
1153724110 18:7937505-7937527 CCTGGATTCCATGCCTGCCAAGG - Intronic
1153836092 18:8965407-8965429 CGTGGTGTCCCAGCCTGTACAGG - Intergenic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1154003016 18:10500926-10500948 CCAGGAGTCTCAGACTGGCCTGG - Intergenic
1154314596 18:13294580-13294602 CCTGAGGTCCCAGCCTTCCTAGG + Intronic
1154326482 18:13395053-13395075 CCAGGAGGAGCAGCCTGCCCCGG + Intronic
1155183488 18:23368172-23368194 CCGGGAGTCAGAGGCTGCCCTGG - Intronic
1155245410 18:23904166-23904188 TCTGGAGACCCAGCCAACCCAGG - Intronic
1155600191 18:27537191-27537213 CCTGGGGAAACAGCCTGCCCGGG - Intergenic
1157274213 18:46298745-46298767 CCTGGAGTCCCAGCTCTGCCTGG - Intergenic
1157530289 18:48414474-48414496 CCTGTAGACCCAACCTTCCCTGG - Intergenic
1160014126 18:75127722-75127744 CCAGGAGCCCCAGCCTCCCTGGG + Intergenic
1160509208 18:79443895-79443917 CCTGGTGTCCCTGCCTGCCAGGG + Intronic
1160517808 18:79488076-79488098 CCGGGAGTCCCTGCCCCCCCTGG - Intronic
1160571548 18:79820770-79820792 CCTGGAGTCCCAGCTGCTCCAGG - Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160821763 19:1062292-1062314 CCCGGAGGCCCAGGTTGCCCAGG + Exonic
1160862326 19:1242635-1242657 TGTGGAGCCCCAGCCTGGCCTGG - Intronic
1160883112 19:1331540-1331562 TCCGGAGGCCCAGCGTGCCCCGG - Intergenic
1160960467 19:1718601-1718623 CCTGGAGTCCCTTCTGGCCCTGG - Intergenic
1161153743 19:2721891-2721913 CCTGGAGGCCCACCCATCCCAGG + Intronic
1161219232 19:3110425-3110447 CCGGGGGTCCCGGCCGGCCCAGG + Intronic
1161337592 19:3722663-3722685 GCTGCAGTCCCAGTCTACCCTGG - Intronic
1161389391 19:4013362-4013384 CCTCCAGTCGCAGCCTCCCCAGG - Intronic
1161419017 19:4165382-4165404 CCAGGAGTCCCAGCCCAGCCTGG - Intronic
1161466222 19:4432137-4432159 CCTGGAGACCCTGCCGGCCCAGG + Exonic
1161715885 19:5876186-5876208 CCTGGAGCCCCAGCCAAGCCTGG + Intronic
1161813212 19:6482465-6482487 CCTATAGTCCCAGCTTACCCAGG + Intronic
1161844119 19:6702082-6702104 CCTGGGGTCCCTGCCTCCCGGGG + Intronic
1161964544 19:7540954-7540976 CGTGGAGTCCCGGGCCGCCCGGG - Exonic
1162056322 19:8066158-8066180 CCTGGAGCTCCGGCCGGCCCTGG - Exonic
1162495100 19:11019148-11019170 ACTGGAGTTCCAGGCTGTCCTGG - Intronic
1162808662 19:13151720-13151742 CCTGGGGCTCCAGCCTGCTCCGG + Intronic
1162893513 19:13750648-13750670 CCAGGAGTTCCAGACTGGCCTGG + Intronic
1162908297 19:13836247-13836269 CCTGCAGCCCCTGCCTTCCCTGG - Intergenic
1162913017 19:13859993-13860015 CCAGGAGTTCGAGACTGCCCTGG + Intergenic
1162975040 19:14203655-14203677 CTTCTATTCCCAGCCTGCCCAGG - Intronic
1163005246 19:14393410-14393432 CCTGGAGTCCCAGTTTCTCCCGG - Intronic
1163027411 19:14520292-14520314 TCAGGAGTCCCTGTCTGCCCAGG - Intronic
1163155245 19:15436761-15436783 GCTGGAGCCCCATCCTTCCCAGG - Intronic
1163557706 19:18001910-18001932 CCTGGACACCCACCCCGCCCTGG + Intronic
1163584001 19:18154258-18154280 CCAGGAGTCCCAGCCTGGGGAGG - Intronic
1163717578 19:18880819-18880841 CCTGTAGTCCCAGCTTCTCCGGG - Intronic
1163779007 19:19235868-19235890 CCTGTAGTCCCAGCCTACTGGGG - Intronic
1163864201 19:19758460-19758482 CCTGGTGCCCCAGCCTGCTAGGG - Intergenic
1164005556 19:21145350-21145372 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1164442603 19:28291038-28291060 CCCTGAGCCACAGCCTGCCCTGG + Intergenic
1164841147 19:31393309-31393331 CCAGGAGTCAAAGCCTGCCCTGG - Intergenic
1164858439 19:31543522-31543544 CCTAGAGCCCCAGCCTCCGCTGG - Intergenic
1164917102 19:32060665-32060687 CCTGTAGTCCCAGCTTACCCAGG + Intergenic
1165091665 19:33391213-33391235 CCTAGAGTCCCACCCTGCCCTGG + Intronic
1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG + Intronic
1165845416 19:38815173-38815195 CCTGGTCTCCCTGCCTGCCCTGG - Intergenic
1166041636 19:40206307-40206329 CTTGTAGTCCCAGCCTACTCAGG + Intronic
1166683262 19:44781076-44781098 CCCGGAGCCCCATCCTGCCCTGG + Intronic
1166849677 19:45753539-45753561 CCTGGGGGCCCACCCTGACCCGG + Intronic
1167114769 19:47482828-47482850 CCTGTAATCCCAGCCTACTCAGG - Intronic
1167117841 19:47498345-47498367 CCAGGGGCCCCTGCCTGCCCTGG - Intronic
1167139667 19:47641022-47641044 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1167367843 19:49064270-49064292 CCTGGAGTGGCTGCCTGCCCTGG + Intronic
1167792596 19:51690859-51690881 CCTGGGTTCCCAGCATGCCCCGG - Intergenic
1168293514 19:55368515-55368537 CCTGGATTCCCTGCCCACCCTGG - Exonic
1168667911 19:58218263-58218285 CCTAGACGCCCAGCCTGGCCTGG + Intergenic
1168693777 19:58393618-58393640 CCTGGATTCCCACCCTGCATAGG + Intronic
925350519 2:3198019-3198041 CCTGGGTACCCAACCTGCCCTGG - Intronic
925436024 2:3838139-3838161 TCTGGAGCCACTGCCTGCCCCGG - Intronic
925885638 2:8391885-8391907 AGTGGGGGCCCAGCCTGCCCAGG + Intergenic
926310017 2:11668602-11668624 CCTGGAGGCCCAGCAGGGCCTGG + Intronic
927855869 2:26527713-26527735 CCTACACTCCCAACCTGCCCTGG - Intronic
928005889 2:27561205-27561227 CCTGTAATCCCAGCTTCCCCAGG + Intronic
928147254 2:28790154-28790176 CCTGTAGTCCCAGCTTGCTTGGG + Intronic
928324625 2:30309723-30309745 CCTGGTTTTCCAGGCTGCCCTGG + Intronic
928494166 2:31814576-31814598 CCTGTAGTCCCAAGCTACCCAGG - Intergenic
928623908 2:33119679-33119701 CCTGTAGTCCCAGCCTACTCGGG - Intronic
929177953 2:39001184-39001206 CCTGTAGTCCCAGCTTACTCGGG - Intronic
930025365 2:47026156-47026178 GCTAGAGTCCTAGCCTGCCTGGG + Intronic
930198474 2:48530738-48530760 CCCGGAGTCCCCTCCTGCCCTGG + Exonic
930199020 2:48534983-48535005 CCTGGAATTCCAGGCTGGCCAGG - Intronic
930690551 2:54358656-54358678 CCTGTAATCCCAGCATGCCCTGG - Intronic
931541025 2:63328849-63328871 CCTGTAGCCCCAGCCTACTCAGG - Intronic
931638862 2:64363933-64363955 CCTCTAGCCCCACCCTGCCCTGG + Intergenic
932147643 2:69337187-69337209 CCTGTAATCCCAGCATACCCGGG - Intronic
932779076 2:74548948-74548970 CCTGGGCGCCCAGCCTGCGCGGG + Intronic
932793142 2:74673250-74673272 CCTGGTTTCCCTGACTGCCCTGG + Intronic
934163239 2:89271988-89272010 CCTGGACACCATGCCTGCCCTGG - Intergenic
934204034 2:89910536-89910558 CCTGGACACCATGCCTGCCCTGG + Intergenic
934614573 2:95763176-95763198 CCTGGTGACCCACCCAGCCCAGG + Intergenic
934885975 2:98025305-98025327 CCTGTAGTCCCAGCTTCCCTGGG - Intergenic
935268946 2:101417091-101417113 CCGGAAGGCCCAGCCTGCTCAGG - Intronic
936260855 2:110958780-110958802 CTTGGTGTCCCAGGATGCCCAGG - Intronic
936485863 2:112925199-112925221 CCTTGAGTTCCTGCCTCCCCTGG + Intergenic
937010458 2:118558371-118558393 ACTGGAGTCCCAGAGAGCCCTGG - Intergenic
937448193 2:121976107-121976129 CCTGGAGTTCCAGCCAGTGCGGG + Intergenic
938838109 2:135129025-135129047 CATGTAGTCCCAGCCTACCCAGG + Intronic
939017182 2:136916382-136916404 CCTGGAGTGCCTGCCAGGCCAGG + Intronic
939867436 2:147488638-147488660 CCTGGAATCCCAGCCTGGGGAGG - Intergenic
940398540 2:153221648-153221670 CCTGGATCCCCCGCCTGCCAAGG + Intergenic
940755150 2:157673514-157673536 CCTGTAATCCCAGCCTACTCGGG + Intergenic
940807914 2:158208536-158208558 CCTGTCGTGCCACCCTGCCCAGG - Intronic
942176504 2:173339677-173339699 CCTGTAGTCCCAGCTACCCCAGG - Intergenic
943576546 2:189637643-189637665 CCAGGGGACCCAACCTGCCCAGG + Intergenic
944328094 2:198431343-198431365 CCTGTAGTCCCAGCTTACTCGGG - Intronic
944551927 2:200851952-200851974 CCAGGAGTTCCAGACTGGCCTGG + Intergenic
946061800 2:216949050-216949072 CCAGGAGTTCGAGACTGCCCTGG - Intergenic
946157757 2:217818198-217818220 CGGGGAGTCCCAGCCTGGGCCGG - Exonic
946340219 2:219061378-219061400 CCTGGTGCCCCACCCTGGCCCGG + Intergenic
946400443 2:219465633-219465655 CCCGGGGTCTCTGCCTGCCCAGG + Intronic
946639545 2:221768786-221768808 CCTGTAGTCCCAGCTTACTCAGG + Intergenic
946999147 2:225433225-225433247 CCTGTAGTCCCAGCTTACTCAGG + Intronic
947192259 2:227519048-227519070 CCTGTAGTCCCAGCTTACTCAGG + Intronic
947899138 2:233705876-233705898 CCAGGAGTTCAAGACTGCCCTGG + Intronic
947937304 2:234018936-234018958 CCTGTAGTCCCAGCTTTCTCTGG + Exonic
948036108 2:234859371-234859393 CCTGCAGCCTCAGCATGCCCTGG + Intergenic
948345640 2:237295446-237295468 ACTGTAGTCCCAGCCTTCTCAGG - Intergenic
948454180 2:238097128-238097150 CCTGGAGGGCCAGCGTGGCCGGG + Intronic
948632685 2:239312189-239312211 CCTGGTGTCCTGCCCTGCCCAGG - Intronic
948696682 2:239736411-239736433 CCTGGAGTCCCGGCTGCCCCTGG + Intergenic
1169306511 20:4495575-4495597 GGAGGAGTCCCAGCCTGCTCTGG - Intergenic
1170145893 20:13173929-13173951 CCTGGAGTCTCTGCCTTCCTGGG + Intergenic
1171214965 20:23345695-23345717 CCTGTAATCCCAGCTTGCTCAGG - Intergenic
1171263735 20:23753531-23753553 CCTGGACTCCCAGCTGTCCCAGG - Intergenic
1171353568 20:24524519-24524541 CCTGTAGTCCCAGCTACCCCGGG + Intronic
1171425118 20:25044111-25044133 CCTGGAGTCCAACCCTAGCCTGG + Intronic
1171986449 20:31664775-31664797 CCAGGGGTCCCAGCCACCCCGGG - Exonic
1172178134 20:32984911-32984933 CCTGGAGTCCCATTTGGCCCTGG + Intronic
1172251378 20:33481590-33481612 CCTGTAATCCCAGGCTGCTCAGG + Intergenic
1172262523 20:33580726-33580748 CCTGTAGTCCCAGGCTACCTAGG + Intronic
1172440913 20:34965919-34965941 CCTGGAGACCCAGCCTGACCTGG - Intergenic
1172553298 20:35818658-35818680 CCTATAGTCCCAGCCTACTCAGG - Intronic
1172600567 20:36179908-36179930 CCAGGAGCCCCAGCCTGGCTGGG + Intronic
1173207464 20:41006288-41006310 CCTGGATCCCCTGCCTGCCAAGG + Intergenic
1173230546 20:41192691-41192713 CCTGGAGTCCCTGAGTGCCAGGG - Intronic
1174482522 20:50841677-50841699 CCTGGAGTCCCCACCAGCCCAGG + Intronic
1174500797 20:50982467-50982489 CATGGAGCCCCACCCAGCCCCGG + Intergenic
1174617815 20:51849841-51849863 CCTGTAGTCCCAACCTACTCAGG + Intergenic
1175777728 20:61663641-61663663 CCTCGAGTCCCCGCTTCCCCTGG - Intronic
1175804434 20:61819699-61819721 CCAGCAGTCCCAGCCTGGCAGGG - Intronic
1175872522 20:62215194-62215216 CCTGGTGGCCAAGCCTGCCCCGG - Exonic
1175920908 20:62450302-62450324 CCTGAAGACCCTGCCAGCCCTGG - Intergenic
1175969674 20:62678159-62678181 CCTGGAGTCGCCGCTCGCCCAGG - Intronic
1175999565 20:62825849-62825871 CCTGCAGCCCCACGCTGCCCGGG - Exonic
1176084102 20:63288111-63288133 CCTTGAGTCCAAGAATGCCCAGG - Exonic
1176100380 20:63361843-63361865 CCTGCAGCCCCCGCCTTCCCTGG + Intronic
1176219780 20:63964440-63964462 TCAGGAGGCCGAGCCTGCCCCGG + Intronic
1176427988 21:6560500-6560522 CCGGGAGCCCCAGGGTGCCCAGG + Intergenic
1177435678 21:21049141-21049163 CCTGTAGTCCCAGCCTACTCGGG - Intronic
1178491047 21:33052127-33052149 CCTGTGGCCCCAGCCGGCCCCGG + Intergenic
1178552310 21:33551128-33551150 TCTGGCGCCCCAGGCTGCCCTGG - Exonic
1178562152 21:33648634-33648656 CCAGGAGTTCCAGACTGGCCAGG + Intronic
1179664023 21:42897495-42897517 CCTGTAGTCCCAGCTAGTCCTGG - Intronic
1179703479 21:43168817-43168839 CCGGGAGCCCCAGGGTGCCCAGG + Intergenic
1179805619 21:43835305-43835327 CCCGGAGTCACAGCCAGGCCCGG - Intergenic
1179916370 21:44480750-44480772 ACTGGAGCCCCTGGCTGCCCAGG + Intergenic
1180112203 21:45665190-45665212 CCAGGAGTTCAAGACTGCCCTGG + Intronic
1180175490 21:46085156-46085178 CCTGGAGTCACACCGTGTCCTGG - Intergenic
1180175503 21:46085216-46085238 CCTGGAGTCACACTATGCCCTGG - Intergenic
1180175560 21:46085472-46085494 CCTGGAGTCACACTGTGCCCTGG - Intergenic
1180175572 21:46085532-46085554 CCTGGAGTCACACTGTGCCCTGG - Intergenic
1180175587 21:46085600-46085622 CCTGGAGTCACACTATGCCCTGG - Intergenic
1180175599 21:46085660-46085682 CCTGGAGTCACACTGTGCCCTGG - Intergenic
1180175614 21:46085728-46085750 CCTGGAGTCACACTATGCCCTGG - Intergenic
1180175629 21:46085796-46085818 CCTGGAGTCACACTGTGCCCTGG - Intergenic
1180180789 21:46117889-46117911 CCTGGACTCCCTGCTTCCCCCGG - Exonic
1180215534 21:46321607-46321629 CCTGCAGTCCCAGTCTAACCAGG - Intronic
1180564663 22:16652585-16652607 CCTGGAGCCCCAGCCTGACAGGG - Intergenic
1180694317 22:17742297-17742319 ACTGTAGCCCCAGTCTGCCCTGG - Intronic
1180742500 22:18063716-18063738 CCTGGAATCCCTTTCTGCCCTGG - Intergenic
1180902780 22:19386681-19386703 CATGGAGTCCCAGCCTGACTTGG + Intronic
1180995402 22:19962959-19962981 TCTGGAGTCCCAGGGTGCCAGGG + Intronic
1181015622 22:20066830-20066852 CCCAGAGACCCGGCCTGCCCAGG + Intergenic
1181038560 22:20181470-20181492 CCGGCTGGCCCAGCCTGCCCAGG + Intergenic
1182477352 22:30583371-30583393 CCTAGAGTCCCAGCTCCCCCTGG + Intronic
1182594054 22:31404362-31404384 CCTGTAGTCCCAGCTTACTCGGG - Intronic
1182595533 22:31417244-31417266 CCTGTAGTCCCAAGCTGCTCGGG + Intronic
1182669232 22:31982039-31982061 CCTGTAGTCCCAGGCTACTCAGG - Intergenic
1183161185 22:36114403-36114425 CCCTGTGTCACAGCCTGCCCAGG - Intergenic
1183405077 22:37626420-37626442 TCTGGAGCCGGAGCCTGCCCGGG - Intronic
1183477212 22:38042294-38042316 CCGGGAGGCCCAGGGTGCCCTGG + Intergenic
1183527280 22:38330869-38330891 CCTGGAGCCTCACCCTGCCTTGG + Intronic
1183851735 22:40595242-40595264 CCTGTAGTCCCAGCCTACTTGGG - Intronic
1184280493 22:43434884-43434906 ACTGGACGCCCAGCCTTCCCAGG - Intronic
1184518010 22:44975034-44975056 CATGGAGCCACAGCCTGTCCTGG + Intronic
1184585934 22:45448280-45448302 CCTGGATTCCCATCCAGCTCAGG - Intergenic
1184856310 22:47148623-47148645 CCTGGGGTCCCTCCCTCCCCTGG + Intronic
1184856342 22:47148703-47148725 CCTGGGGTCCCTCCCTCCCCTGG + Intronic
1184864612 22:47195375-47195397 CCTGGAGCCCGAGCCTGCTGGGG + Intergenic
1185078146 22:48694361-48694383 CCAGCAGTGCCAGCCTTCCCTGG - Intronic
949535739 3:4995116-4995138 GCTCAAGTCCCAGCCAGCCCAGG + Intergenic
949712056 3:6882469-6882491 CCAGGAGTTCCAGGCTGCCATGG + Intronic
950986137 3:17369606-17369628 CCTGTAATCCCACCCTGCTCGGG - Intronic
951414535 3:22407977-22407999 CCTGGAGTCTCAACCTGCCCTGG - Intergenic
952460308 3:33517861-33517883 CCAGGAGTTCCAGACTGGCCTGG - Intronic
953109669 3:39921755-39921777 CCTGTAGTCCCAGCCTACTCAGG + Intronic
953397999 3:42588278-42588300 CCTGTAGTCCCAGACTACTCGGG + Intronic
953418119 3:42734533-42734555 CCTGGGGCCCCAGGCTACCCTGG + Intronic
953556394 3:43949843-43949865 CTTGGTGTCCCATGCTGCCCGGG - Intergenic
953793546 3:45966381-45966403 CCTGCAGGCCCAGCTCGCCCAGG - Exonic
953793810 3:45967761-45967783 CCTGGAGACCCAGCTGGCACAGG - Exonic
953960792 3:47264213-47264235 CCTGGAGCCTTACCCTGCCCTGG + Intronic
954003908 3:47577980-47578002 CCTGGAGCCCCGGCCCGCCCCGG + Intronic
954016608 3:47697423-47697445 CCTGTAGTCCCAGGCTACTCGGG - Intronic
954121487 3:48502831-48502853 TCTGGAGACCCAGCCAGGCCAGG + Intronic
954381346 3:50220795-50220817 GGGGGAGTCCCAGCCTCCCCAGG - Exonic
954459314 3:50617404-50617426 CCCGCACTCCCAGCTTGCCCCGG + Intronic
954624571 3:52015587-52015609 CCTGGGCCCCCAGCATGCCCTGG + Intergenic
954744158 3:52777678-52777700 CCTGCAGGCCATGCCTGCCCTGG + Exonic
954752739 3:52822900-52822922 CCAGGAGCCCCAGCCTGGCCTGG - Intronic
954896166 3:53976829-53976851 CCTGCAGCAGCAGCCTGCCCAGG - Intergenic
956062331 3:65360105-65360127 CTTGGAGGGCCAGCCTTCCCAGG - Intronic
956609428 3:71107131-71107153 CCCTGTGTCCCAGTCTGCCCAGG - Intronic
956923828 3:73960382-73960404 CCTCGAGTATCAGCCTGCCTTGG + Intergenic
957228321 3:77477478-77477500 CCTGGAGTGCCAGCCTCCCCGGG + Exonic
957535250 3:81493784-81493806 CCTGTAATCCCAGCCTGCCGAGG - Intronic
957653061 3:83034887-83034909 CCTGGATTCCACGCCTGCCAAGG + Intergenic
958892166 3:99794853-99794875 CCTGGGATCCCATCCTGGCCTGG - Exonic
959513819 3:107243622-107243644 CCTGTAGTCCCAGCCTACTTTGG + Intergenic
959539182 3:107521298-107521320 CCTGTAGTCCCAGCTTACTCGGG + Intergenic
959622612 3:108414413-108414435 CCTACAGTCCCAGAGTGCCCTGG - Exonic
960389104 3:117055007-117055029 CCAGGAGTTCCAGACTGGCCTGG + Intronic
960624311 3:119665581-119665603 CCTGGAGTTCAAGACTGGCCTGG - Intronic
960989322 3:123300531-123300553 GCTGCAGGCCCAGGCTGCCCTGG + Intronic
961437052 3:126926517-126926539 CCTGGCTGCACAGCCTGCCCTGG - Intronic
961832690 3:129632318-129632340 CCAGGAGGCCCAGGCTGCCTGGG + Intergenic
963068147 3:141280254-141280276 TCTGGGATGCCAGCCTGCCCCGG + Intronic
963822161 3:149909397-149909419 CCTGTAGTCCCAGCTTCCCCAGG - Intronic
963979296 3:151518354-151518376 ACTGGAGTCTCAGCCTACTCTGG + Intergenic
964525025 3:157608729-157608751 CCTGGCTTCCCAGGCTCCCCGGG - Intronic
964901571 3:161665345-161665367 CCTGTAGTCCCAGCCTACTCAGG - Intergenic
965003515 3:162987455-162987477 CCTGCTGGCCCTGCCTGCCCTGG + Intergenic
965208167 3:165749058-165749080 CCAGGAGTCCGAGACTACCCTGG - Intergenic
965572681 3:170187524-170187546 CCTGTAGTCCCAGCTTACTCGGG - Intergenic
966405025 3:179587743-179587765 CCTGGAGTCCCAGGCTGAGGTGG + Intronic
966912875 3:184569163-184569185 GCTGGAGCCCCGGCCTGCTCCGG + Intronic
967138462 3:186532565-186532587 CCTGGAGTACTAGCCTAGCCAGG + Intergenic
967871355 3:194232355-194232377 CCAGCAGTCCCAGCCTGTCAGGG + Intergenic
967968434 3:194982250-194982272 TTTGAAGTCCCAGCCTGCTCTGG - Intergenic
968046214 3:195625041-195625063 CCTGGAGTCCCCACCGGCTCTGG - Intergenic
968131595 3:196195698-196195720 CCTGGAGTCCCAGCCCACAGGGG - Intergenic
968308439 3:197665046-197665068 CCTGGAGTCCCCACCGGCTCTGG + Intergenic
968321214 3:197770620-197770642 CCTGGAGCCTTGGCCTGCCCTGG + Intronic
968451397 4:677663-677685 CCTGCAGTTCCAGGGTGCCCAGG + Intronic
968457324 4:706219-706241 GCTGGAGTCCCAGCCCTCCCGGG - Intronic
968636997 4:1685593-1685615 CCTGGCTTCGCAGCCTGCACCGG - Intergenic
969297201 4:6277175-6277197 CCTGGAGTCCCTGCCTCACTGGG - Intronic
969360245 4:6658724-6658746 CCTGGAGTGCGAGCGTGCCCGGG + Intergenic
969424110 4:7113920-7113942 CCTGGACTTCTAGCCTCCCCTGG + Intergenic
969778995 4:9381355-9381377 CCTGGAGACCCGGCCCGCCGCGG + Intergenic
970673700 4:18423833-18423855 CCTGGAGTTCAAGACTGGCCTGG + Intergenic
971728772 4:30349231-30349253 ACTGGAGTCTCAGCCTACTCTGG + Intergenic
971919184 4:32914414-32914436 CCTGTAGTCCCAGCCTACTGGGG + Intergenic
974068551 4:57103092-57103114 TCTGGGTTCCCAGCCTGCCATGG - Intronic
975325207 4:73051443-73051465 CCTGTAGTCCCAGCTTACTCGGG - Intergenic
976760765 4:88546633-88546655 CCTGTAGTCCCAGCTTCCCTGGG - Intronic
977956861 4:103037983-103038005 CCTGTAGTCCCAGCCTACTCAGG - Intronic
978460430 4:108945786-108945808 CCTGTAGTCCCAGCCTACTGGGG - Intronic
980101486 4:128545585-128545607 CCTGTAGTCCCAGGCTACTCAGG + Intergenic
980158780 4:129135884-129135906 CCTGGGGACCCAGTCTGCCCTGG + Intergenic
980158816 4:129136214-129136236 CCTGGAGTGCCAGCCAGGCCAGG + Intergenic
982038631 4:151372726-151372748 CCTGTATTCCCAGCTTGCTCTGG - Intergenic
982592952 4:157338399-157338421 CCTGCAGTGCCATCATGCCCAGG - Intronic
983222728 4:165058290-165058312 CCTGTAGTCCCAGCCTACTTGGG - Intergenic
984519761 4:180787669-180787691 ACTGGAGTCTGAGCCTACCCTGG - Intergenic
984612482 4:181856704-181856726 CCAGGAGGAGCAGCCTGCCCAGG - Intergenic
985386644 4:189454603-189454625 CCTGGAGGCCCAGCTGGCCTAGG - Intergenic
985540045 5:483617-483639 CCTGGCGGCCCAGCCTGGCTCGG - Intronic
985667237 5:1187495-1187517 GCAGGGGTCCCAGCGTGCCCTGG - Intergenic
985747096 5:1653834-1653856 CCTGGAGTCCCCACCAGCTCTGG + Intergenic
985839425 5:2295041-2295063 CCTGGAGTGCCAGCTGGCCGGGG - Intergenic
986912546 5:12574736-12574758 CCTGCTGGCCCCGCCTGCCCTGG - Intergenic
987588135 5:19885683-19885705 CCTGTAGTCCTAGCTTGCTCAGG - Intronic
987619938 5:20327826-20327848 CCGGGAGTTCAAGACTGCCCTGG + Intronic
987706825 5:21469341-21469363 CCTGTAGTCCCAGCTTACTCTGG - Intergenic
989058790 5:37389533-37389555 CCTGTAGTCCCAGCTTACTCTGG - Intronic
989514722 5:42328636-42328658 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
989596735 5:43163094-43163116 CCTGTAGTCCCAGCTTACTCAGG - Intronic
989977709 5:50606804-50606826 CCTGGAGTCTCTGCCTCCACTGG + Intergenic
990450478 5:55928173-55928195 CCTGAAATCCCACCCTGCCCTGG - Intergenic
992113132 5:73514822-73514844 CCTGTAGTCCCAGCCTACTGGGG + Intergenic
992291815 5:75287255-75287277 CCTGGAGATCCACCCTGACCTGG + Intergenic
992460325 5:76954033-76954055 CCTGGAGGCTCAGCATGTCCAGG - Exonic
992507165 5:77398444-77398466 CCTGTAGTCCCAGCTTACTCAGG - Intronic
994372452 5:98982751-98982773 CCTGCAGTCCCAGCCTACTCAGG - Intergenic
994606358 5:101972227-101972249 CCTGTAGTCCCAGCTTGCTCGGG - Intergenic
995732988 5:115265428-115265450 ACTGGGGTCTCAGCCGGCCCTGG - Intergenic
995807210 5:116066703-116066725 CCTGGACTTCCACCCTGGCCAGG - Intergenic
997283319 5:132661985-132662007 CCTGGAGTCACCCTCTGCCCTGG - Intergenic
997299357 5:132791177-132791199 CCTGTAGTCCCAGCTTACTCGGG + Intronic
997448930 5:133966094-133966116 CCTGTAGTCCCAGCATACTCGGG + Intronic
997951027 5:138242531-138242553 CTTGGAGTCCCAGGCTGCTTAGG - Intergenic
998052752 5:139049666-139049688 CCTGTAGCCCCAGCCTACTCAGG + Intronic
999306204 5:150521210-150521232 ACCGGAGGCCCGGCCTGCCCTGG - Exonic
1000208063 5:159081190-159081212 CCAGGAGTTCAAGACTGCCCTGG - Intronic
1000509520 5:162164602-162164624 CCTGCAGACCAATCCTGCCCAGG - Intergenic
1001319548 5:170668980-170669002 CCTGGATTCCCAGGCTGGGCTGG + Intronic
1001826871 5:174751969-174751991 CCTGGGCTCCCGGCCTCCCCAGG + Intergenic
1001981504 5:176040910-176040932 CCTCGAGTACCTGCCTGCTCTGG + Intergenic
1002170118 5:177370245-177370267 CCTGGAGGCAGAGCCTGTCCTGG + Intronic
1002235963 5:177803156-177803178 CCTCGAGTACCTGCCTGCTCTGG - Intergenic
1002427223 5:179183543-179183565 ACTGGTGGCCCAGCCTGCTCAGG + Intronic
1002594464 5:180313107-180313129 CCAGGAGTTCCAGACCGCCCCGG - Intronic
1004376133 6:15092304-15092326 GCTGGAATTCCAACCTGCCCAGG - Intergenic
1004408755 6:15360712-15360734 CCAGGAGTCCAAGACAGCCCTGG - Intronic
1005252616 6:23964624-23964646 CCTGTAGTCCCAGCTTACTCGGG + Intergenic
1005491362 6:26350201-26350223 CCTGTAGTCCCAGCTTACTCAGG + Intergenic
1006081851 6:31572413-31572435 CCTGGATCCCCGGCCTGCCTGGG + Intronic
1006296284 6:33171492-33171514 CCTGGAGGCCCAGCAGGACCAGG + Exonic
1006460713 6:34156059-34156081 CATGGAGTGCCTGCCTGCCCTGG - Intergenic
1006671834 6:35734369-35734391 CCAGGAGTTCGAGCCTGGCCTGG - Intergenic
1006792899 6:36715405-36715427 CCTGGCCTCCCACCCAGCCCTGG - Intronic
1007013773 6:38442360-38442382 CCTGTAGTCCCAGCCTACTCGGG + Intronic
1007734021 6:43969286-43969308 GCTGGAGTACTAGCCTTCCCTGG + Intergenic
1007825075 6:44594383-44594405 CCTCGAATCCCTGCCTGCCATGG - Intergenic
1009021399 6:57951158-57951180 CCTGTAGTCCCAGCTTACTCTGG + Intergenic
1009243239 6:61204195-61204217 CCTGGACTCCATGCCTGCCAAGG + Intergenic
1009697320 6:67123715-67123737 CATGAAGTCCCAGCCATCCCAGG + Intergenic
1010209821 6:73354057-73354079 TCGGGAGTCTCAGCCGGCCCGGG - Intronic
1013299163 6:108786969-108786991 CCTGGACTTGCTGCCTGCCCTGG - Intergenic
1013980124 6:116120575-116120597 CCTGGAGGCCCAGGGGGCCCTGG + Exonic
1013980339 6:116121280-116121302 CCTGGAATCCCTGGCTGGCCTGG + Exonic
1014005132 6:116409399-116409421 CCTGTAGTCCGAGCCTACTCGGG - Intronic
1015023125 6:128500999-128501021 CCTGTAGTCCCAGCCTACCTGGG - Intronic
1015945036 6:138490755-138490777 CCTGTAGTCCCAGCCTTCTCAGG - Intronic
1016260967 6:142170707-142170729 ACTGCAGCCTCAGCCTGCCCGGG + Intronic
1017502985 6:155042466-155042488 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1017772568 6:157654292-157654314 CCAGGAATCTCAGCCTGGCCTGG + Intronic
1018404601 6:163465502-163465524 CCTGTAATCCCAGCTTGCTCGGG + Intronic
1018500992 6:164411186-164411208 CCTGGGGTCCCAGTGTGCCTGGG - Intergenic
1018668928 6:166163816-166163838 CCTGGCTGCCCAGCCGGCCCTGG + Intronic
1018867798 6:167759229-167759251 CCAGGTGTGCCAGCCTCCCCTGG - Intergenic
1018899012 6:168041978-168042000 CCTGCAGTGCCACCCTCCCCAGG + Exonic
1019334191 7:475286-475308 CCTGGGGTCCCAGCCAGGGCGGG - Intergenic
1019337333 7:491629-491651 CCTGGACTCCCACCCTGGCCTGG - Intergenic
1019339472 7:502095-502117 CCTGTAGTCCCAGCCTACTTGGG + Intronic
1019510119 7:1413644-1413666 CCCGGCCTCCCAGCCTGCCCTGG - Intergenic
1019637863 7:2086038-2086060 CCAGGAATCCCACCCTGCCCGGG + Intronic
1019641107 7:2104150-2104172 AATGGAGGCCCAGCCTGCCGTGG - Intronic
1019671667 7:2283306-2283328 CCTGGAGGCCAAGCCCGCCCCGG + Intronic
1019703971 7:2488634-2488656 CCTAAATTCCCAGCCTCCCCTGG - Intergenic
1019756115 7:2771457-2771479 CCTGCACTCCCTTCCTGCCCAGG + Intronic
1020088348 7:5323512-5323534 ACTGGACTCCCTGCCTTCCCTGG + Intronic
1020829077 7:13070891-13070913 CCTGTAGTCCCAGCTTACTCGGG - Intergenic
1020834388 7:13130904-13130926 CCTGTAGTCCCAGGCTACCCAGG + Intergenic
1020938957 7:14506681-14506703 CCTAGAGTCCCTGCCAGTCCAGG + Intronic
1021568882 7:22044327-22044349 CCTGTAGTCCCAGGCTACTCAGG + Intergenic
1022366248 7:29721245-29721267 CCTGTAGTCCCAGCCTGAGTAGG + Intergenic
1022415554 7:30173792-30173814 CCTGAAGACCCAGCCTCCCCTGG + Intergenic
1022931498 7:35120795-35120817 CCTGTAGTCCCAGCCTGAGTAGG - Intergenic
1023202610 7:37715337-37715359 CCAGGAGTTCCAGACTGGCCTGG - Intronic
1023605470 7:41927166-41927188 CCTGTAGTCCCATCCAGCCTGGG + Intergenic
1024671594 7:51600486-51600508 CGTGGAGTGCCAGCCTCCCCAGG - Intergenic
1024698087 7:51877384-51877406 CCTGGTGTCACAGTCTGCCAGGG - Intergenic
1025035439 7:55590364-55590386 CCTGGAGGCCCAGCAGGACCAGG - Intergenic
1025205964 7:56993603-56993625 ACTGGACTCCCTGCCTTCCCTGG - Intergenic
1025258991 7:57404731-57404753 ACTGCAATCCCAGCATGCCCCGG + Intergenic
1025665976 7:63583336-63583358 ACTGGACTCCCTGCCTTCCCTGG + Intergenic
1027063579 7:75105071-75105093 CCTGTAGTCCCAGCCACCCGGGG + Intronic
1027256683 7:76435218-76435240 CCTGTAGTCCCAGCCACTCCAGG + Intronic
1027476850 7:78642836-78642858 CCTGTACTGCCAGACTGCCCAGG - Intronic
1028288934 7:89041286-89041308 CCTGGAGTCTGGGTCTGCCCTGG + Intronic
1028809013 7:95062509-95062531 CCTGTAGTCCCAGCTGGCTCAGG - Intronic
1029122124 7:98275541-98275563 CCTGTAGTCCCAGCTACCCCAGG - Intronic
1029205994 7:98869729-98869751 CCTGCAGCCGCAGCCCGCCCGGG - Intronic
1029726224 7:102407088-102407110 CCTGTAGTCCCAGGCTACTCAGG + Intronic
1029827388 7:103213286-103213308 CCTGTAGTCCCAGCCTGAGTAGG - Intergenic
1031188430 7:118513491-118513513 CCTGTAATCCCAGCCAGCCAAGG - Intergenic
1031980637 7:128122165-128122187 CCATGAGCCCCAGCCTGCCCTGG - Intergenic
1032021048 7:128407261-128407283 CTTGGAGGCCAAGCCTCCCCTGG - Intronic
1032160045 7:129502871-129502893 CGTGGAGCCCCAGGCTGTCCCGG + Intronic
1032457150 7:132081856-132081878 CCTGGAGCCCCATTCTGCCCCGG + Intergenic
1033202488 7:139385394-139385416 CCTGGAGTTCAAGACTGCACTGG - Intronic
1033367359 7:140681828-140681850 CCAGGAGTTCAAGACTGCCCTGG - Intronic
1034162296 7:149002487-149002509 CCACAACTCCCAGCCTGCCCTGG + Intergenic
1034182498 7:149149043-149149065 CCTGTAGTCCCAGCTAGGCCGGG + Intronic
1034223184 7:149460814-149460836 CCTGGGGTCCTCGCCTGCCCAGG + Exonic
1034494658 7:151412224-151412246 CCTGGAGTCCCGTGGTGCCCAGG + Intergenic
1034506191 7:151493267-151493289 CCTGGAGTTCCTGCCTGCCTTGG + Intronic
1035040543 7:155923735-155923757 CCGTGAGTACCAGCCTGCCCGGG - Intergenic
1035380123 7:158432707-158432729 CCTGAAGACGCAGCCTGGCCCGG + Intronic
1035456487 7:159012846-159012868 CCTGGAGCCCCAGCGGGGCCGGG - Intergenic
1035634988 8:1137912-1137934 CCTGCAGTCCCAGCTACCCCAGG - Intergenic
1035715193 8:1748702-1748724 CCAGCAGCCCCACCCTGCCCTGG + Intergenic
1036059452 8:5299398-5299420 CTTAGTGTCCCAGCCTGCCTGGG + Intergenic
1036276435 8:7355314-7355336 CCTGGAGACCCGGCCCGCCGCGG + Intergenic
1036327383 8:7791879-7791901 CCTGGAGCTCCCGCCAGCCCCGG + Intergenic
1036344906 8:7955031-7955053 CCTGGAGACCCGGCCCGCCGCGG - Intergenic
1036652105 8:10651194-10651216 CCTGCAGTCTGAGCCTGGCCTGG + Intronic
1036840245 8:12115798-12115820 CCTGGAGACCCGGCCCGCCGCGG - Intergenic
1036862035 8:12362035-12362057 CCTGGAGACCCGGCCCGCCGCGG - Intergenic
1037108680 8:15140232-15140254 CCAGGAGTCCGAGACTGGCCTGG - Intronic
1037790057 8:21930964-21930986 CCTGTAGTCCCAGCCTCACTTGG - Intronic
1038491434 8:27974811-27974833 CCTGGAGTCACAGCGGACCCAGG + Intronic
1038684962 8:29708011-29708033 CCTGGAGTTCCACCCTGGCAAGG - Intergenic
1039212964 8:35236422-35236444 CCCGAGGTCCCAGCCAGCCCTGG + Intronic
1040325229 8:46338255-46338277 CCAGGAGTCCCCACCTGTCCCGG + Intergenic
1044774822 8:95677417-95677439 CCTGGATCCCATGCCTGCCCAGG + Intergenic
1046803018 8:118449673-118449695 CCTGTAGTCCCAGCCTGCCTCGG + Intronic
1046981896 8:120345452-120345474 CCTGGCCTCCCAGGCTCCCCAGG - Exonic
1047754293 8:127906922-127906944 CTGGGATTCCCAGCCTTCCCTGG + Intergenic
1047997819 8:130353744-130353766 CCTGTAGTCCCAGCTGCCCCAGG + Intronic
1048204248 8:132402891-132402913 CCTGTAGTCCCAGCTTACTCAGG + Intronic
1048635158 8:136287520-136287542 CCTGGAGTCCCAACTAGCCAAGG - Intergenic
1048861199 8:138725403-138725425 CCTGGTGTCCCAGGCCCCCCTGG - Exonic
1049146625 8:141005446-141005468 TCTTGAGGCCCAGCATGCCCTGG - Intergenic
1049285640 8:141773715-141773737 CCTTCAGGCCCAGCCTGCGCAGG + Intergenic
1049391608 8:142374553-142374575 CCTGTAGTCCCAGGCTACTCGGG + Intronic
1049418023 8:142504397-142504419 CCTGGTGGCCCTGCCTGCACAGG - Intronic
1049470034 8:142771119-142771141 CCTGGAGTGCCAGCCCAGCCAGG + Intronic
1049470464 8:142773055-142773077 CCTGGAGTCCCTCCCAGCCCTGG + Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049658253 8:143808384-143808406 CTTGGACTCCAGGCCTGCCCTGG - Intronic
1049711280 8:144064466-144064488 CCTGTAGCCCTGGCCTGCCCTGG - Intergenic
1049714336 8:144082817-144082839 CCTCGGGTCCCCGCCTCCCCGGG - Intronic
1049783456 8:144439438-144439460 GCTGAAGTCACAGCCTTCCCTGG + Intronic
1050512602 9:6412026-6412048 CCTGTAGTCCCAGCTACCCCAGG + Intergenic
1051046651 9:12883851-12883873 CCAGGACACCCAGCCTGCACAGG + Intergenic
1051591146 9:18777526-18777548 CCTGGTGGCCCAGCTGGCCCAGG + Exonic
1051629484 9:19128389-19128411 CCTGTAGTCCCAGCTAGTCCCGG + Intronic
1051840990 9:21397912-21397934 CCAGGAGTTCAAGCCTGCCATGG - Intergenic
1052956241 9:34255197-34255219 CCTGGCCTCCCAGCCTCTCCTGG + Intronic
1053069415 9:35092279-35092301 CTTGGACCCCCAGCCAGCCCAGG + Exonic
1053102073 9:35379322-35379344 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1053127162 9:35591533-35591555 CCTGGAGTTCAAGACTGACCTGG - Intergenic
1053323120 9:37118416-37118438 CCTGGAGTCCCAGCTGTTCCTGG - Intergenic
1053428250 9:38025227-38025249 CATGGGGACCCAGCCTGGCCCGG - Intronic
1053447667 9:38165401-38165423 CCCATAGTCCCAGCCTGCTCAGG - Intergenic
1056808054 9:89743961-89743983 CCAGGGGTCCCAGACTTCCCTGG + Intergenic
1056869920 9:90267894-90267916 CCTGGTCTACCAGCCTGCCTGGG - Intergenic
1057228711 9:93305964-93305986 CCTTCCGGCCCAGCCTGCCCTGG + Intronic
1057277809 9:93685392-93685414 ACTGGGGTCCCTGCCAGCCCAGG - Intergenic
1057283029 9:93726355-93726377 CCTGGAGTGCCAGCTGCCCCAGG - Intergenic
1057616465 9:96595024-96595046 CCTGTAGTCCCAGCTTACTCAGG + Intronic
1058835116 9:108853767-108853789 CCTGTAATCCCAGCTTCCCCAGG - Intergenic
1059441191 9:114307817-114307839 CCTCTATCCCCAGCCTGCCCTGG + Intronic
1059466979 9:114475195-114475217 CCTTGGGTCCCAGGCTGCCTGGG - Intronic
1060356613 9:122914250-122914272 CCTGAAGTCCCAGCTTACTCGGG - Intergenic
1060517037 9:124272344-124272366 CATGAAGTCCCTGCCTGCACAGG + Intronic
1060599707 9:124869604-124869626 CCTTGAGTCCCAGTCTCCCTGGG + Intronic
1060636314 9:125202088-125202110 CCTGTAGTCCCAGCTTACTCTGG + Intronic
1060822380 9:126669041-126669063 CCTGGGGTCCAACCCTGCCAAGG + Intronic
1060827088 9:126693631-126693653 CCTCTAGTCCCACCCTACCCGGG - Intronic
1061022082 9:128022486-128022508 CATGGCGGCCCAGCCTGCCCAGG - Intergenic
1061450862 9:130666391-130666413 CCTGGAGACCCTCCGTGCCCTGG - Intronic
1061585377 9:131564021-131564043 CCTGTAGTCCCAGCTTACTCTGG - Intergenic
1061862622 9:133475748-133475770 CCTGCAGCCCCACCCTGCCTGGG - Intronic
1061949562 9:133928863-133928885 CCTGGAGTGCCAGCCTCACCCGG - Intronic
1062162054 9:135086210-135086232 CCTGCAGTCCCAGCTTACACTGG + Intronic
1062264725 9:135681763-135681785 CTTGGGGTCCCTGCCTCCCCTGG - Intergenic
1062326587 9:136015344-136015366 CCTGAGCTCCCACCCTGCCCCGG - Intronic
1062466147 9:136682492-136682514 CCTGGACTCCTTGCCTCCCCGGG + Intronic
1062478609 9:136741470-136741492 CCTGGGGCCCCAACCTTCCCGGG - Intronic
1062586200 9:137251083-137251105 CCAGGACCCCCAGCCTGCCCCGG - Intergenic
1062652101 9:137583239-137583261 CATAGAGTGCCATCCTGCCCAGG + Intronic
1062699459 9:137891383-137891405 CCTGGAGCCCGAGCCTGGACCGG - Intronic
1185961593 X:4550774-4550796 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1186102443 X:6171402-6171424 CCAGCTGTCCCAGCCTGCTCTGG + Intronic
1186306289 X:8262735-8262757 CCTGTAGTCCCAGGCTACTCGGG + Intergenic
1187433436 X:19245305-19245327 CCTGTATTGCCAGCCTGCTCGGG + Intergenic
1189310395 X:40013948-40013970 CCTGGAGTGCCAGAGAGCCCGGG + Intergenic
1189349708 X:40267319-40267341 TCTGGGGTCCCAGCCTAGCCCGG - Intergenic
1189487014 X:41442180-41442202 CCTGGAGTCGCAGAATGCCCGGG - Intergenic
1190334489 X:49253994-49254016 CCTGTCGTCCCAGCCTGGTCTGG - Exonic
1191629303 X:63304111-63304133 CCTGTAGTCCCAAGCTACCCCGG - Intergenic
1192166226 X:68829249-68829271 CCCGGAGTCCCAGTGTGGCCCGG + Exonic
1192342544 X:70276297-70276319 CCTGGAGACCTTGCCTGCCCAGG - Intronic
1193291737 X:79781259-79781281 CCTGGAGTCCCATCATGGCAGGG - Intergenic
1195797454 X:108666510-108666532 CCTGGAGGCCCTGGTTGCCCAGG - Exonic
1195858034 X:109351749-109351771 CCAGGAGGCCCTCCCTGCCCTGG - Intergenic
1199615496 X:149652155-149652177 CCTTGTCTCCCAGCCTGGCCTGG + Intergenic
1199813185 X:151371103-151371125 TGTGGAGTACCAGCCTGCGCTGG - Intergenic
1199953263 X:152722700-152722722 CTCGGAGTGCCAGCCTGCCTGGG - Intergenic
1199956419 X:152745750-152745772 CTCGGAGTGCCAGCCTGCCTGGG + Intergenic
1200056155 X:153462446-153462468 CCTAGAGAAGCAGCCTGCCCGGG + Intronic
1200098585 X:153675931-153675953 CCAGGAGTTCCAGCCTAGCCTGG + Intronic
1200392285 X:155956294-155956316 CCTGGAGCCCATGCCTGCCAAGG + Intergenic
1200690757 Y:6305211-6305233 CCTGCAGTCCCAGCCTCCTGGGG + Intergenic
1200714286 Y:6520303-6520325 CCTGCAGTCCCAGCCTCCCGGGG - Intergenic
1200831159 Y:7689688-7689710 CCTGCAGTCCCAGTCTCCCGGGG + Intergenic
1201019536 Y:9640854-9640876 CCTGCAGTCCCAGCCTCCCGGGG + Intergenic
1201044515 Y:9869505-9869527 CCTGCAGTCCCAGCCTCCTGGGG - Intergenic
1201489474 Y:14524891-14524913 CCTTGCCTCCCAGCCTGACCTGG + Intronic
1201992024 Y:20037461-20037483 CCTGTAGTCCCAGCCAACTCGGG + Intergenic
1202597251 Y:26553671-26553693 GCCTGATTCCCAGCCTGCCCAGG - Intergenic
1202601074 Y:26593541-26593563 CCTGGAGCCCCAGCCTGACAGGG - Intergenic