ID: 1165114030

View in Genome Browser
Species Human (GRCh38)
Location 19:33518279-33518301
Sequence GAGTATCCCTGTGCCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165114030_1165114040 27 Left 1165114030 19:33518279-33518301 CCAGGGAAGGCACAGGGATACTC 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1165114040 19:33518329-33518351 ACCCGTCCCTAGCCCCCAGTCGG 0: 1
1: 0
2: 1
3: 8
4: 85
1165114030_1165114032 1 Left 1165114030 19:33518279-33518301 CCAGGGAAGGCACAGGGATACTC 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1165114032 19:33518303-33518325 GTGGCCAGCCTGCCTCCCATAGG 0: 1
1: 0
2: 2
3: 41
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165114030 Original CRISPR GAGTATCCCTGTGCCTTCCC TGG (reversed) Intronic
900074405 1:801415-801437 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
900885249 1:5410517-5410539 GAGTCTCCCAGGGCCCTCCCTGG - Intergenic
901157822 1:7152377-7152399 AAGTCTCCATTTGCCTTCCCTGG - Intronic
903092090 1:20929900-20929922 AAGTATGCCTGTGCCTACACAGG - Intronic
903886290 1:26542947-26542969 GTGTGCCCCTGGGCCTTCCCTGG + Intronic
904677792 1:32208978-32209000 CAGTCTCCCTCTGCCTTCCTGGG + Intergenic
905024320 1:34839469-34839491 GAGGAACCATGTGCCTTCTCTGG + Intronic
905441845 1:38000871-38000893 GTGTGTCCCTGTAACTTCCCCGG - Intronic
906223942 1:44105760-44105782 CAGAATCCCTGGTCCTTCCCCGG - Intergenic
907426368 1:54381834-54381856 AAGCATTCCTGTGCCTTCCTAGG + Intronic
908665729 1:66487985-66488007 GTGTAGCTCTGTGCATTCCCAGG + Intergenic
908769746 1:67585165-67585187 GAGTGTGCCTATGCCTTTCCCGG + Intergenic
909194941 1:72607416-72607438 GAGAATCCCCTTCCCTTCCCAGG + Intergenic
910112182 1:83694591-83694613 GAATCTCCCTGTGCCTGCACAGG + Intergenic
912388893 1:109287995-109288017 GAGAATTCCTGTTCCTTCCCAGG + Intergenic
914332941 1:146689302-146689324 GAGTCTCCCTGTGCACTCCCAGG - Intergenic
915384083 1:155473517-155473539 GAGTATCACTCTGCCAGCCCAGG + Intronic
915526947 1:156481718-156481740 GAGTAGGCCTGTGGCTTCCCGGG + Intronic
916471338 1:165125634-165125656 GAGTCTCACTCTGTCTTCCCTGG - Intergenic
920269443 1:204752201-204752223 GAGCCTCCCTGTGCCCTTCCGGG + Intergenic
920880197 1:209872634-209872656 GAATATTCCTGTTTCTTCCCTGG - Intergenic
922270252 1:224026319-224026341 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
922744170 1:228035022-228035044 GTGCATCTCTGTGCTTTCCCAGG - Intronic
1065265577 10:23971739-23971761 GAGAATCCCCTTCCCTTCCCAGG + Intronic
1067037740 10:42932383-42932405 GGGTATCCCTGGCCTTTCCCGGG + Intergenic
1067223775 10:44362619-44362641 AAATATCCCTGTGCCATCCAAGG + Intergenic
1069062594 10:63909907-63909929 GGGTGTGCCAGTGCCTTCCCTGG + Intergenic
1072094840 10:92167880-92167902 GAGTCTCACTCTGCCTGCCCAGG - Intronic
1072890221 10:99316809-99316831 GAGTATCCCTCTACCCGCCCAGG + Intergenic
1074193250 10:111156410-111156432 GATTCACCCTGTTCCTTCCCAGG + Intergenic
1075234867 10:120718525-120718547 GAGAATCCCCGTTCCTTACCAGG + Intergenic
1075256109 10:120926958-120926980 GAGTTTCCCTCTGCCTGCCATGG - Intergenic
1075572961 10:123558725-123558747 GGGTGACCCTGTGACTTCCCAGG + Intergenic
1075872314 10:125779820-125779842 GTGTAGGACTGTGCCTTCCCCGG - Intergenic
1078134168 11:8638540-8638562 GAGCGTCCCTGTTCCATCCCTGG - Intronic
1078268993 11:9777218-9777240 GAGGATCCCTTTCCCTTCCCCGG - Intergenic
1079508329 11:21180724-21180746 GAGTTTCCCTGTTCCTTTACTGG + Intronic
1081664096 11:44906482-44906504 AAGTATTCCTGGGTCTTCCCAGG + Intronic
1082727586 11:56755075-56755097 AACTATCCCTGTGCTTTACCTGG - Intergenic
1086641924 11:89169285-89169307 GAGTCTCTCTGAGCCTTCTCTGG - Intergenic
1088570725 11:111221257-111221279 GAGTATACCCATGGCTTCCCTGG + Intergenic
1088905752 11:114154472-114154494 GAGTATTCCTGTCACTTGCCCGG - Intronic
1088966291 11:114724821-114724843 GAGTATTGCTGTGGCTTCCATGG + Intergenic
1089415688 11:118288440-118288462 GAGTCTCCCTGTGCCGGCCAAGG + Intergenic
1089554112 11:119305692-119305714 CAGTATACCTGTGTCTTCTCTGG + Exonic
1089934311 11:122347971-122347993 GAGTCTCACTCTGTCTTCCCAGG + Intergenic
1090017854 11:123101835-123101857 GCTTATGCCTGTGCCTTACCAGG - Intronic
1090060545 11:123460881-123460903 AAGAATCCATCTGCCTTCCCAGG + Intergenic
1090269202 11:125374159-125374181 GCTTAACCCTCTGCCTTCCCTGG + Intronic
1091526688 12:1309335-1309357 CAGTACCCCTGTGAGTTCCCTGG + Intronic
1091614578 12:2039824-2039846 GAGCATCCCTGTGCCTGAGCTGG + Intronic
1098495966 12:71135808-71135830 GAGCATCCCAGACCCTTCCCAGG - Intronic
1101754064 12:107607414-107607436 GGGTAGCCCTCTGTCTTCCCTGG + Intronic
1102799294 12:115717573-115717595 GAGCATCCCTGTCCCCTTCCAGG - Intergenic
1103785927 12:123433014-123433036 AAGTTTCCCTGTAGCTTCCCTGG - Intronic
1105799134 13:23888730-23888752 GCCTATCCCTGTGCGTTCACAGG - Intronic
1106249391 13:27972167-27972189 GACCATCCCTGTCCCTTCCTGGG - Intergenic
1112822229 13:103350872-103350894 GAGTCTCCGTCTGCCTTCCTTGG + Intergenic
1113186228 13:107688692-107688714 GTGTATCTCTGTGCCATTCCAGG + Intronic
1113313860 13:109158147-109158169 GGGCATCTCTTTGCCTTCCCAGG + Intronic
1115684109 14:35776353-35776375 GAGTCTCACTCTGTCTTCCCAGG - Intronic
1115853368 14:37604490-37604512 GAGTCTGCCTGTGCCTTTCCTGG + Intronic
1117286139 14:54287472-54287494 GAGCCTCCGTGTGCTTTCCCTGG - Intergenic
1121629142 14:95409905-95409927 GAGGATCTCTGAGCCTTTCCAGG - Intronic
1121797607 14:96747975-96747997 GCCTTTCTCTGTGCCTTCCCTGG - Intergenic
1124355479 15:28991982-28992004 GAGTGTGATTGTGCCTTCCCGGG + Intronic
1124603482 15:31153130-31153152 GAGAATCCCTTTCCCTTTCCAGG + Intronic
1125312657 15:38397528-38397550 GAGCATGCCTGTGCCTTTCAGGG + Intergenic
1125341353 15:38678747-38678769 GAGAATCCCTTTCCCTTTCCAGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125607280 15:40947692-40947714 CAGGAGCCCTTTGCCTTCCCTGG + Intergenic
1125715306 15:41816663-41816685 GAGGAGCCCTGTGCCATTCCGGG - Intronic
1126721881 15:51590307-51590329 GAGAATCACAGTGACTTCCCTGG - Intronic
1130066150 15:80606616-80606638 ATGTCTCCCTGAGCCTTCCCTGG + Intergenic
1132462303 16:61562-61584 GTGAGCCCCTGTGCCTTCCCTGG - Intronic
1134213942 16:12301377-12301399 GAGTAACCCTGGCCCTTCCTAGG - Intronic
1138447689 16:57074804-57074826 GCCCATCCCTGTGCCCTCCCAGG + Intronic
1140000676 16:71021942-71021964 GAGTCTCCCTGTGCACTCCCAGG + Intronic
1140207855 16:72948147-72948169 GAATGGCCCTGTGCCTGCCCGGG - Intronic
1141205392 16:81929296-81929318 GAGCATGCCCGTGCCTGCCCAGG - Intronic
1141368234 16:83463856-83463878 GAGTGGCCCTGTGACTTACCTGG - Intronic
1142846753 17:2684341-2684363 GTCTAACCCTGTGCCTTGCCTGG + Exonic
1144264395 17:13554259-13554281 GAGTAGCTCTGAGCCTTCCACGG + Intronic
1148367500 17:47067395-47067417 GAGTGGCCCTGTGACTTACCTGG + Intergenic
1149111719 17:53040499-53040521 GTCTATCCCTGTGTCTTCCTGGG + Intergenic
1149643966 17:58225789-58225811 GAGTATCCCTGCCTCTTCCCAGG + Intronic
1152509506 17:80776347-80776369 GAGTCTCACTCTGTCTTCCCAGG + Intronic
1153413787 18:4823403-4823425 GAGAATCCCTATCCCTTTCCAGG - Intergenic
1157084961 18:44570640-44570662 GAGTTTCCCTGGGCCATCCCAGG + Intergenic
1157149013 18:45195947-45195969 GAGTATCCCTGAGCCTACTCTGG - Intergenic
1157699632 18:49752948-49752970 AAGTAAGCATGTGCCTTCCCTGG + Intergenic
1160630677 18:80245154-80245176 GAGGCTGCCTCTGCCTTCCCTGG - Intronic
1161076085 19:2286471-2286493 GCTTCTCCCTGTGCCTTCCCGGG + Intronic
1164182263 19:22829948-22829970 GAGTATCTCTGAGCCTACTCTGG + Intergenic
1165114030 19:33518279-33518301 GAGTATCCCTGTGCCTTCCCTGG - Intronic
1166365928 19:42278489-42278511 GGGGCTCCCTGTGCCTTCCTGGG + Intronic
1167561278 19:50227386-50227408 GAGTCTCTCTGTGCTTCCCCGGG - Intronic
1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG + Exonic
925024246 2:595219-595241 AAGCATCCCTGTGCTTTCCGCGG - Intergenic
928972586 2:37046611-37046633 GAGTTTCCCTGTTGCTGCCCAGG - Intronic
929963026 2:46510871-46510893 AAGTATCTCTGTGCCTGGCCGGG - Intronic
931679922 2:64737533-64737555 GAGTGTCCTTCTGCCTTGCCAGG - Intronic
932908894 2:75784749-75784771 GAGTATCTCGGTGCCTTCCTTGG + Intergenic
934774379 2:96927799-96927821 GAGTGTCCCTGTGTCCTCCTGGG - Intronic
935445197 2:103148987-103149009 GAGAATCTTTGTACCTTCCCCGG - Intergenic
937633807 2:124133261-124133283 GAGTGTCCCTCTCCCTTCCAAGG + Intronic
937929359 2:127192599-127192621 GAGCACCACTGTGCCTTTCCCGG + Intronic
938104048 2:128518040-128518062 GAGGAGCCCTTTGGCTTCCCTGG + Intergenic
938669618 2:133574354-133574376 GAGCATCCCTGCCTCTTCCCTGG - Intergenic
939002264 2:136749954-136749976 GAGTCTCCCTGGGCCTTCACTGG - Intergenic
941432244 2:165426840-165426862 GGGCATCCCTGTGCCTTCGGGGG + Intergenic
944924809 2:204453895-204453917 GAATATCCCTGTTCCCACCCTGG - Intergenic
947530135 2:230903798-230903820 CAGTAGCCCTGCACCTTCCCCGG - Intergenic
948214586 2:236219376-236219398 GAATATCCCTTTGGCTTTCCAGG + Intronic
948939975 2:241190730-241190752 GAGAGGCCCTGTGCCCTCCCTGG - Intronic
1169160481 20:3373362-3373384 GAGTATCCATGTGCCTCCATGGG - Intronic
1170548679 20:17456720-17456742 AAATATCTCTGTGCCTTCACTGG - Intronic
1171313563 20:24166392-24166414 TATTATCCCTGTGCCTGCCATGG + Intergenic
1173577772 20:44124060-44124082 GAGTCTCCCTGTTCCTCCCCCGG - Intronic
1174609901 20:51790483-51790505 GAGAATCCCTGTGACTTTACGGG - Exonic
1175334093 20:58183950-58183972 GAGTCTCTCTGTGGCTGCCCTGG - Intergenic
1179969675 21:44827750-44827772 CAGTAATCCTGTTCCTTCCCTGG - Intergenic
1181429640 22:22871214-22871236 GAGGACCCCAGTGACTTCCCTGG + Intronic
1182925679 22:34122109-34122131 GAGAATCCCTGTGGCTCCACTGG + Intergenic
1183003484 22:34880720-34880742 GAGTTTCCCTTGGCCTTGCCTGG - Intergenic
1183237311 22:36629304-36629326 CAGTCACCCAGTGCCTTCCCTGG + Intronic
1183579414 22:38714788-38714810 GAGCACCCCTGCTCCTTCCCTGG - Intronic
1184933333 22:47698190-47698212 GAGAATCCCTTTCCCTTTCCAGG - Intergenic
949268653 3:2188880-2188902 AAGACTCCCTGTGCCCTCCCAGG + Intronic
950484770 3:13266687-13266709 GGGTCTCCCTGTGCCTACCTTGG - Intergenic
953032111 3:39185932-39185954 CAGTCTCCCTGTGCCTTGACTGG + Exonic
954468760 3:50674505-50674527 GAGCCACCCTGTGCATTCCCAGG - Intergenic
954576062 3:51676965-51676987 AAGTGTCCCTGAGCCATCCCAGG - Intronic
955123498 3:56085489-56085511 GAGTATCCCTCCACCTTTCCAGG - Intronic
958877750 3:99635130-99635152 GAATATTCCTGTGATTTCCCTGG + Intergenic
961374541 3:126455503-126455525 TATTATCCCTGTCCCTGCCCTGG - Intronic
962370839 3:134819670-134819692 GCACATCCCTGTGCCTCCCCAGG + Intronic
962942522 3:140138627-140138649 GAGTGTCCATGTGCTTTCCGGGG - Intronic
965375687 3:167921034-167921056 CAATATCCATGTGCCTTCCTTGG + Intergenic
966659663 3:182400201-182400223 GAGTCTCCCTTTCCTTTCCCAGG + Intergenic
968423485 4:504902-504924 GACTATCCCAGTGGCCTCCCTGG + Intronic
968933009 4:3593190-3593212 GATTTTCCTTGTGTCTTCCCTGG + Intergenic
969309202 4:6342850-6342872 GAGAAGCTCTGTGACTTCCCTGG - Intronic
969438363 4:7201606-7201628 GAGAACCCCTGTGCCTTTTCCGG + Intronic
969527200 4:7709879-7709901 GAGGCTCCCAGAGCCTTCCCTGG + Intronic
972646072 4:40968660-40968682 CTGTATCCCTGTGCCTTTGCTGG + Intronic
973035667 4:45403140-45403162 GAGTATCTCAGAGCCTACCCTGG - Intergenic
973336534 4:48962265-48962287 GAGAATCCCTTTCCCTTTCCAGG - Intergenic
974015622 4:56646374-56646396 GTGTATACCTGTGTCATCCCAGG + Intergenic
975240560 4:72052682-72052704 GAGAATCCCTTTCCCTTTCCAGG + Intronic
975757215 4:77582774-77582796 TAGAATCCCTGTCTCTTCCCTGG - Intronic
976876858 4:89863290-89863312 CAGTATCTCTGGGCCTTCCCTGG - Intergenic
981490730 4:145336699-145336721 GAGAATCCCTTTCCCTTTCCAGG + Intergenic
984659144 4:182353937-182353959 GAGTATCCCTGTTGTTGCCCAGG - Intronic
985609277 5:877906-877928 TCTTTTCCCTGTGCCTTCCCGGG - Intronic
986148075 5:5099092-5099114 GAGCCTCCCTGTCCCTTCCCAGG + Intergenic
987835494 5:23155374-23155396 AAGTTTCCCGGGGCCTTCCCAGG + Intergenic
989444871 5:41515673-41515695 CAGTTTCCCTCTCCCTTCCCAGG - Intergenic
991099407 5:62776127-62776149 GAGGAGCCCTTTGGCTTCCCTGG + Intergenic
991971684 5:72147642-72147664 CAGTATTCCTGTGCCCTCCCAGG + Intronic
992379995 5:76227436-76227458 CAGTAACCCAGTGCCTTCCTAGG + Intronic
995083450 5:108080954-108080976 GAGAATCCCTTTCCCTTTCCAGG - Intronic
995290197 5:110443188-110443210 GAGCATCTCTGGACCTTCCCAGG - Intronic
996754993 5:126926337-126926359 GGGCCTCCCTGTGCATTCCCTGG + Intronic
997093704 5:130886460-130886482 GAGAATGCCTCTGACTTCCCTGG + Intergenic
999582040 5:153049692-153049714 GAGAATCCCTTTCCCTTTCCAGG + Intergenic
1003351183 6:5319102-5319124 GAGGCCCCCTGTGCCCTCCCAGG + Intronic
1003491106 6:6622507-6622529 AAGTATCTCTGTGCTGTCCCAGG - Intronic
1007238356 6:40407059-40407081 GAGAGGCCCTGTGCTTTCCCAGG + Intronic
1012227231 6:96718146-96718168 GGGAATCCCTGTTCCTTTCCAGG + Intergenic
1018003211 6:159597670-159597692 AGGTGGCCCTGTGCCTTCCCTGG + Intergenic
1018357204 6:163030196-163030218 AACTATACCTGTGCCTTACCTGG + Intronic
1018689018 6:166328684-166328706 GAAGATCCCTGTGTCCTCCCAGG - Intronic
1019014518 6:168870313-168870335 GAGAATCCCTCTCCCTTTCCAGG + Intergenic
1019601557 7:1886175-1886197 GACTAGCCCTGTGCCATTCCAGG - Intronic
1019927262 7:4201633-4201655 GAGCCTCCCTGTGCCATGCCAGG - Intronic
1019967470 7:4511609-4511631 AAGTATGGCTGTACCTTCCCAGG + Intergenic
1021533895 7:21681002-21681024 GGGAAACCCTGTGTCTTCCCTGG + Intronic
1023057543 7:36302180-36302202 GATTGTTTCTGTGCCTTCCCCGG + Intergenic
1025036222 7:55594002-55594024 AGGCATCCCTGTGCCATCCCAGG - Intergenic
1027416293 7:77978306-77978328 GAGTTTCCCTGTGGTTGCCCAGG + Intergenic
1029424293 7:100486721-100486743 CAGCAACCCTGTGGCTTCCCAGG - Intronic
1030558124 7:111052220-111052242 GAGAATCCCTTTCCCTTTCCAGG + Intronic
1034945356 7:155258427-155258449 GAGTAACACTGGGCCTGCCCAGG + Intergenic
1035359929 7:158304877-158304899 GAGAATCCCTTTTCCTTTCCAGG - Intronic
1035520496 8:272430-272452 GACTTTCCTTGTGCCTGCCCTGG + Intergenic
1035541237 8:440064-440086 GAGTGACCCTGAGCCCTCCCAGG + Intronic
1036728408 8:11240623-11240645 AAGTAGCCCTTTGGCTTCCCAGG - Intergenic
1039503813 8:38036948-38036970 CAATATTGCTGTGCCTTCCCAGG - Intronic
1042979047 8:74505385-74505407 GAGAATCCCTTTTCCTTTCCAGG + Intergenic
1045126010 8:99089785-99089807 GAGAATCCCTTTCCCTTTCCTGG - Intronic
1045135726 8:99215604-99215626 AAGCATACCTGTGCCTTCACAGG - Intronic
1045502903 8:102757000-102757022 GTGTCTCCCTGCACCTTCCCAGG - Intergenic
1046916552 8:119683796-119683818 GGCTTTCTCTGTGCCTTCCCTGG - Intergenic
1047037600 8:120956535-120956557 GAGTCTCTCTGTGCCTACTCTGG + Intergenic
1048122735 8:131599845-131599867 GAGAATCCCTGGGCTTTCCTGGG - Intergenic
1049321873 8:142001022-142001044 GAGCACCCCTCTTCCTTCCCAGG - Intergenic
1049496051 8:142934121-142934143 GAGTATCCCTGGGCAATCCCTGG - Intergenic
1049585839 8:143432061-143432083 GGGTGTCCCTGGCCCTTCCCTGG + Intergenic
1051992482 9:23169051-23169073 GAGTTTCCCTGCACCATCCCTGG - Intergenic
1054457122 9:65438787-65438809 GATTTTCCTTGTGTCTTCCCTGG - Intergenic
1055013808 9:71594674-71594696 GAGAATCCCCTTTCCTTCCCAGG + Intergenic
1056715615 9:89025871-89025893 GAGAATCCCTTTCCCTTTCCAGG + Intronic
1056937057 9:90923788-90923810 AAATATTCCTCTGCCTTCCCTGG - Intergenic
1057330367 9:94108805-94108827 GAATATCCCTGTGGAGTCCCCGG - Exonic
1059392714 9:114009013-114009035 GAGTCTGCCTGTGGCTGCCCTGG - Intronic
1062344410 9:136108295-136108317 CAGCATCCCTGTGCCTGGCCTGG + Intergenic
1187782499 X:22843650-22843672 CAGTATCCCTGTACTTTCTCTGG - Intergenic
1188513282 X:30959350-30959372 GAGTTTTCCTGTGACTTTCCTGG + Intronic
1188949439 X:36350785-36350807 GATTTTCCCATTGCCTTCCCAGG + Intronic
1189262880 X:39690163-39690185 GAGTGTCCCAGTGGCTTCCAGGG + Intergenic
1190687969 X:52890998-52891020 GAGAATCCCTTTCCCTTTCCAGG - Intergenic
1190698013 X:52964794-52964816 GAGAATCCCTTTCCCTTTCCAGG + Intronic
1191720105 X:64222313-64222335 GAGTGTCCATGTGCCTTCTTGGG + Intergenic
1198077330 X:133206014-133206036 GAGAATCCCTTTCCCTTTCCAGG - Intergenic
1200848481 Y:7857859-7857881 AACTAGCCCTGTGCCCTCCCTGG + Intergenic