ID: 1165116570

View in Genome Browser
Species Human (GRCh38)
Location 19:33532675-33532697
Sequence CACGGTAAACTGTCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165116563_1165116570 0 Left 1165116563 19:33532652-33532674 CCCAGCTTCTGGTTGCAGAGTGA No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data
1165116557_1165116570 26 Left 1165116557 19:33532626-33532648 CCAGCCCATCACCACTGCTGTCC No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data
1165116562_1165116570 5 Left 1165116562 19:33532647-33532669 CCTGTCCCAGCTTCTGGTTGCAG No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data
1165116560_1165116570 15 Left 1165116560 19:33532637-33532659 CCACTGCTGTCCTGTCCCAGCTT No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data
1165116556_1165116570 27 Left 1165116556 19:33532625-33532647 CCCAGCCCATCACCACTGCTGTC No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data
1165116555_1165116570 30 Left 1165116555 19:33532622-33532644 CCACCCAGCCCATCACCACTGCT No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data
1165116564_1165116570 -1 Left 1165116564 19:33532653-33532675 CCAGCTTCTGGTTGCAGAGTGAC No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data
1165116558_1165116570 22 Left 1165116558 19:33532630-33532652 CCCATCACCACTGCTGTCCTGTC No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data
1165116559_1165116570 21 Left 1165116559 19:33532631-33532653 CCATCACCACTGCTGTCCTGTCC No data
Right 1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165116570 Original CRISPR CACGGTAAACTGTCTGGGGA GGG Intergenic
No off target data available for this crispr