ID: 1165119866

View in Genome Browser
Species Human (GRCh38)
Location 19:33552103-33552125
Sequence TAGAAGAGCCCCACTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165119866_1165119875 25 Left 1165119866 19:33552103-33552125 CCATCCTGAGTGGGGCTCTTCTA No data
Right 1165119875 19:33552151-33552173 GCCACTACAGAGGGAGAGACAGG No data
1165119866_1165119877 26 Left 1165119866 19:33552103-33552125 CCATCCTGAGTGGGGCTCTTCTA No data
Right 1165119877 19:33552152-33552174 CCACTACAGAGGGAGAGACAGGG No data
1165119866_1165119873 16 Left 1165119866 19:33552103-33552125 CCATCCTGAGTGGGGCTCTTCTA No data
Right 1165119873 19:33552142-33552164 GCCACTCATGCCACTACAGAGGG No data
1165119866_1165119872 15 Left 1165119866 19:33552103-33552125 CCATCCTGAGTGGGGCTCTTCTA No data
Right 1165119872 19:33552141-33552163 GGCCACTCATGCCACTACAGAGG No data
1165119866_1165119878 27 Left 1165119866 19:33552103-33552125 CCATCCTGAGTGGGGCTCTTCTA No data
Right 1165119878 19:33552153-33552175 CACTACAGAGGGAGAGACAGGGG No data
1165119866_1165119869 -6 Left 1165119866 19:33552103-33552125 CCATCCTGAGTGGGGCTCTTCTA No data
Right 1165119869 19:33552120-33552142 CTTCTAGGCCCTAGAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165119866 Original CRISPR TAGAAGAGCCCCACTCAGGA TGG (reversed) Intergenic
No off target data available for this crispr