ID: 1165119951

View in Genome Browser
Species Human (GRCh38)
Location 19:33552592-33552614
Sequence ACAATTTGATTGGGTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165119947_1165119951 7 Left 1165119947 19:33552562-33552584 CCCATATATTTATGTTATATAAC No data
Right 1165119951 19:33552592-33552614 ACAATTTGATTGGGTTCCCCAGG No data
1165119948_1165119951 6 Left 1165119948 19:33552563-33552585 CCATATATTTATGTTATATAACT No data
Right 1165119951 19:33552592-33552614 ACAATTTGATTGGGTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165119951 Original CRISPR ACAATTTGATTGGGTTCCCC AGG Intergenic
No off target data available for this crispr