ID: 1165120760

View in Genome Browser
Species Human (GRCh38)
Location 19:33556963-33556985
Sequence CAGTGGCAGCAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 1, 1: 0, 2: 6, 3: 89, 4: 838}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165120760 Original CRISPR CAGTGGCAGCAGAGGGAAGG AGG (reversed) Intergenic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900336360 1:2165936-2165958 CAGTGGCCGCAGGGGGATGCTGG - Intronic
900397242 1:2458132-2458154 CTCTGACAGCACAGGGAAGGTGG + Intronic
900496661 1:2978875-2978897 CAGGTGCAGCTGAGGGAAAGGGG + Intergenic
900610267 1:3541748-3541770 CAGTGGCAGCAGAGAGTGGGCGG + Intronic
901737326 1:11320614-11320636 CATGGGCAGAGGAGGGAAGGTGG - Intergenic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
902409317 1:16203608-16203630 GAAAGGCAGCAGAGGGAAGTTGG - Intronic
902410337 1:16208274-16208296 CAGGGGCAGCAGCAGGGAGGAGG - Intronic
902511436 1:16969049-16969071 CAGTGGGAGCAGAGGTATAGAGG + Intronic
902667028 1:17946680-17946702 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
902729985 1:18362928-18362950 CAGAGGCAGAAGTGGGGAGGGGG - Intronic
902784247 1:18722715-18722737 CAGTGCCAGCAGGGAGCAGGAGG + Intronic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
903192336 1:21663728-21663750 TGGGGGCAGCAGAGGGAAGGTGG - Intronic
903446675 1:23426758-23426780 CAGTGGCCGTTGAGGGGAGGAGG + Intergenic
903475118 1:23614132-23614154 AAGTGGTAGCAGAGGCCAGGTGG + Intronic
903587126 1:24424652-24424674 CAGTGGCAGGAAAGGCAATGGGG + Intronic
903767224 1:25742567-25742589 CAGTGCCAGTAGGGGCAAGGAGG + Intronic
904197144 1:28794412-28794434 CAGTGGCAGGCTAGGGCAGGGGG - Intergenic
904199566 1:28811263-28811285 CAGTGCGAGCAGATAGAAGGGGG - Intergenic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
904603887 1:31688690-31688712 CTGGGGCAGCACAGGGACGGAGG + Intronic
904648316 1:31985332-31985354 ATGTGGCAGCAGAGGGAGCGGGG + Intergenic
904878804 1:33678540-33678562 CAGCTGCTGCAGGGGGAAGGGGG + Intronic
904972277 1:34428281-34428303 CAGAGGCAGCAGAGATGAGGAGG + Intergenic
905319378 1:37105119-37105141 CAGTAGCAGCAGGTGGCAGGTGG - Intergenic
905501790 1:38445387-38445409 CAGTGGCAGCAGTGTGGTGGAGG - Intergenic
905649625 1:39647564-39647586 CAGTGGCAGAATAGGGAGGTCGG - Intergenic
905688994 1:39928908-39928930 CAGTGGAAGCAGAGCCACGGGGG + Intergenic
906026799 1:42681337-42681359 GAGTGGAAGCAGGGAGAAGGTGG - Intergenic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
907248924 1:53125118-53125140 CTGTGGCAGCACACGGAAGACGG + Intronic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
907525151 1:55049696-55049718 CATGGCCAGCAGAGGGCAGGTGG - Intronic
907671056 1:56475286-56475308 CATTGGCAGCAGGGAGACGGGGG + Intergenic
907943394 1:59110258-59110280 CAGTGGGAGCAAAGGGACAGAGG - Intergenic
908070533 1:60455089-60455111 CAGTGGCAGCAGTTGCATGGAGG - Intergenic
908267633 1:62394880-62394902 CAGAACCACCAGAGGGAAGGTGG - Intergenic
908571868 1:65419897-65419919 GAGAGGCAGGAGAGGGAAGGAGG - Intergenic
909510611 1:76448061-76448083 CAGTGCAAGCAGAGAGGAGGGGG + Intronic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
910337911 1:86155334-86155356 CCGTGTCAGCTGAGGGCAGGCGG - Intronic
910366643 1:86472371-86472393 CAGTGCCTGCAGAGGAAATGAGG - Intronic
910874647 1:91867229-91867251 CAGTGGCAGGAAAAGAAAGGAGG + Intronic
911313630 1:96328718-96328740 CAGAGGCTGGAGAGGGGAGGGGG + Intergenic
911520187 1:98920215-98920237 CACTGGAAGTATAGGGAAGGTGG + Intronic
911643637 1:100315820-100315842 CAGTGCCAGCAGAGCACAGGAGG + Intergenic
911974193 1:104471057-104471079 CAGAGGCAGCATAGTAAAGGTGG - Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
912560518 1:110548271-110548293 GAGGGGCAGAAGTGGGAAGGTGG - Intergenic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
914430439 1:147615944-147615966 CAGTGACTGCAAAGGAAAGGAGG + Intronic
914923726 1:151865372-151865394 GAGTTGCAGCAGGAGGAAGGAGG - Intergenic
915003088 1:152611494-152611516 CATTGGCAGCTGAGGGAGGTAGG - Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915529133 1:156493422-156493444 CCCTGGCAGCGGAGGGAGGGCGG + Intronic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916493975 1:165328062-165328084 CAGTGGAAGGAGAGATAAGGAGG + Intronic
917556134 1:176090556-176090578 CAGCAGCAGCACAGGGCAGGGGG + Intronic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
918094660 1:181324920-181324942 CAGATGCAGGAGATGGAAGGAGG - Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918265732 1:182839757-182839779 CCGCGGCGGCTGAGGGAAGGGGG + Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
919420589 1:197365474-197365496 CAGAGGCATCATAGGCAAGGGGG - Intronic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920337480 1:205254854-205254876 CAGTGGCAGCAGGAGACAGGTGG - Intronic
920647063 1:207811612-207811634 AAGTGGAAGCAGAGGGCTGGAGG - Intergenic
920778160 1:208961215-208961237 CAGTGACAGCTGTGGGTAGGTGG - Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
922004156 1:221511872-221511894 CAATGGAAACAGAGGTAAGGGGG - Intergenic
922153200 1:223022357-223022379 CCTGGGCAGCAGAAGGAAGGTGG + Intergenic
922251842 1:223856495-223856517 GAGTGGGAGCAGAAGGGAGGCGG + Intergenic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922809845 1:228409336-228409358 CAGTGGCAGCGGTGGGCGGGGGG - Intronic
922890957 1:229061777-229061799 CTCTGGCAGCAAAGGGGAGGTGG + Intergenic
923141059 1:231162087-231162109 CAGCGGCAGCGGCGGGAGGGAGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923503890 1:234589319-234589341 CAGTGGCAGCACAGTAAAGAGGG + Intergenic
923745889 1:236700001-236700023 CAGAGGCAGCTGTGGGAAGTAGG - Intronic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924632993 1:245760011-245760033 TAGTGACAGGAGAGGGCAGGAGG + Intronic
1063550629 10:7029529-7029551 GAGTGGCAGCACATGAAAGGAGG + Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1064048822 10:12042854-12042876 GAGGGGGAGCTGAGGGAAGGCGG - Intronic
1064618689 10:17191979-17192001 CAGTGTCAGATGAGGCAAGGTGG + Intronic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1065268209 10:23999440-23999462 CAGTGGCAGCAGTGTGAGAGTGG - Intronic
1065452184 10:25870493-25870515 TAGGGTCAGGAGAGGGAAGGAGG + Intergenic
1065629705 10:27665951-27665973 CAGAGACTGGAGAGGGAAGGGGG + Intergenic
1066000893 10:31103295-31103317 TAGTAGCAGCAGATGCAAGGAGG + Intergenic
1067430555 10:46240791-46240813 CAGTGGCAGCAGTGGGCCAGGGG - Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068987479 10:63120673-63120695 CAGGGCCAGCAGATGGGAGGAGG + Intergenic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1069937122 10:71925238-71925260 CACTGGCAGAAGATGGAAGCAGG - Intergenic
1070268744 10:74931234-74931256 CAGGGACAGGAGAGGAAAGGAGG - Intronic
1070842269 10:79495403-79495425 CAGTGGGGGCAGAGGGGAAGCGG + Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072226537 10:93375252-93375274 CAGTGGCAGCTGAGAGAAACTGG + Intronic
1072245816 10:93542936-93542958 GATTTGCAGGAGAGGGAAGGAGG + Intergenic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1074132170 10:110589515-110589537 CAGTGGTTGCAGATGGATGGGGG - Intronic
1074714266 10:116203554-116203576 GAGAGGCAGCTGGGGGAAGGTGG + Intronic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075083448 10:119398832-119398854 CAGTGGCAGGACAGTGAAGCCGG - Intronic
1075121681 10:119669255-119669277 CAGAGGCAGCATAGGGAGAGAGG - Intronic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1075747051 10:124735274-124735296 CGGTGGCAGCAGAGCCAAGACGG + Intronic
1075980742 10:126737030-126737052 AAGGAGCAGCAGAGAGAAGGAGG - Intergenic
1076220136 10:128727299-128727321 CAGTGGCAGCAGAGAGTCAGAGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076431903 10:130409982-130410004 CTGTGGCAGGAAAGTGAAGGAGG - Intergenic
1076537185 10:131187190-131187212 CAGTGCCAGCAGAGGCACGTCGG + Intronic
1076628960 10:131841436-131841458 AGGTGACAGCAGAGGGGAGGGGG - Intergenic
1076719307 10:132386311-132386333 CAGAGGCAGCAGCTGGAAGGCGG + Intergenic
1077021869 11:420560-420582 CAGCGGCGCCAGCGGGAAGGCGG + Exonic
1077322817 11:1949875-1949897 CAGTGGCAGGGGCGGGAACGGGG + Intronic
1077386881 11:2273603-2273625 GAGTGACAACAGAGGGATGGGGG + Intergenic
1077413858 11:2415481-2415503 CATGGGCACCCGAGGGAAGGGGG + Intronic
1077499937 11:2904743-2904765 CAGGGGCTGCAGTGGGAAGGGGG + Intronic
1078529719 11:12127615-12127637 CTTTGGGAGCACAGGGAAGGAGG + Intronic
1079008809 11:16811813-16811835 CCAGGGCAGCAGAGGGGAGGTGG - Intronic
1079099284 11:17530893-17530915 CAGCGGCAGCAGCTGGAAGGAGG + Intronic
1079151000 11:17899004-17899026 CAGGAGCAGGAGAGAGAAGGAGG - Intronic
1079250448 11:18783175-18783197 CAGAGGCAGCAGATGGCAGTGGG + Intronic
1079435788 11:20447733-20447755 CAGTGGCAGCAAGCTGAAGGTGG - Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1080866312 11:36198571-36198593 CAGAGGCAGGAGTGGGATGGGGG - Intronic
1081000476 11:37664234-37664256 AGGAGGCAGCAGAGGCAAGGTGG + Intergenic
1081574462 11:44310492-44310514 CAGTGGAAGGAGAGAGGAGGAGG - Intergenic
1081654598 11:44849130-44849152 GGGTGGCAGCAGGGGGCAGGGGG + Intronic
1081660154 11:44883125-44883147 TCTTGGGAGCAGAGGGAAGGTGG - Intronic
1082039630 11:47674199-47674221 GAGTGGCAGGAGGGTGAAGGAGG + Intronic
1082142204 11:48622383-48622405 GAGTGCCAGCAAAGGGATGGTGG + Intergenic
1083661184 11:64252403-64252425 CAGGGGCAGGACAGGGAAAGGGG - Intronic
1083737879 11:64691990-64692012 CAGTGACAGCAGAGGGCTAGAGG + Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084401080 11:68943276-68943298 CATTGGCAGCTGAGGGCTGGGGG - Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084972185 11:72777930-72777952 CTGAGGCAGGAGAGGGGAGGGGG + Intronic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1085450696 11:76630337-76630359 CAGGGGCAGCTGCTGGAAGGAGG - Intergenic
1085744491 11:79103115-79103137 CATTGGAAGCAGAGGGACAGCGG - Intronic
1086022707 11:82251170-82251192 CACTGGCAGCGGAGAGAAAGGGG + Intergenic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1087564702 11:99839462-99839484 AAGTTGAGGCAGAGGGAAGGAGG + Intronic
1088077098 11:105863613-105863635 CAGGGGCAGGAGTGGGAGGGAGG - Intronic
1088876617 11:113941680-113941702 CAGTGGCAGGAGATGGGAGGAGG + Intronic
1088884156 11:113994154-113994176 CAGAGGCAAAGGAGGGAAGGTGG - Intergenic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089139241 11:116273085-116273107 CACAGGGAGCAAAGGGAAGGAGG + Intergenic
1089579329 11:119471521-119471543 CAGAGGCAGCAGGGGGCCGGGGG + Intergenic
1089653902 11:119933266-119933288 CAGTGGCAGAAGCTGGGAGGAGG - Intergenic
1090217649 11:124984098-124984120 CATTGGCAGCAGTGGCATGGTGG + Intronic
1090974599 11:131670853-131670875 CAGAGGGAGCAGAGGGGAAGGGG - Intronic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1202805835 11_KI270721v1_random:5188-5210 CAGTGGCAGGGGCGGGAACGGGG + Intergenic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091488986 12:916599-916621 GAGGGGCCGCAGAGGAAAGGAGG + Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091699099 12:2648363-2648385 CAGTGGCAGAAGAGGGCAAAAGG - Intronic
1091795619 12:3295969-3295991 GAGAGGCAGCAGTGGGTAGGAGG - Intergenic
1092126619 12:6079247-6079269 CTGTGGCAGAACAGGGAAGCTGG - Intronic
1092821513 12:12357418-12357440 CGGTGGCAGCAGAAGAACGGCGG - Exonic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1093017690 12:14171160-14171182 CAGTGACTGCCCAGGGAAGGGGG + Intergenic
1093322715 12:17734017-17734039 CAGTGGTAGCAGAGAAGAGGAGG - Intergenic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1096107180 12:49003135-49003157 TAGTGGAAGCAGAGGTAGGGAGG - Exonic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1096761590 12:53846082-53846104 CAGTGACTGCAGTGGGAGGGTGG - Intergenic
1096773252 12:53949750-53949772 CACAGGGAGCACAGGGAAGGGGG + Intergenic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097271864 12:57780435-57780457 CCCCAGCAGCAGAGGGAAGGTGG - Exonic
1099007127 12:77247418-77247440 AACTACCAGCAGAGGGAAGGAGG + Intergenic
1100221134 12:92505574-92505596 CACTGGCAGCTGGGGGAAGTGGG + Intergenic
1100449927 12:94696066-94696088 GAGCAGCAGCAGGGGGAAGGAGG + Intergenic
1100770960 12:97922453-97922475 TAGTGGAAGCAGAGGTCAGGAGG + Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1101287877 12:103334747-103334769 CCGTGGAAGCAAAGGGAAGTTGG - Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1102987832 12:117292931-117292953 CCTTGGCAGCACAGGGGAGGTGG + Intronic
1103796402 12:123506173-123506195 CAGAGGCCACAGAGGAAAGGAGG + Intronic
1103821034 12:123698931-123698953 CAGTGACAGTACTGGGAAGGAGG + Intronic
1103867142 12:124062313-124062335 TGGGGGCAGAAGAGGGAAGGAGG - Intronic
1103922482 12:124406156-124406178 CAGTGGCAGAATTGAGAAGGGGG - Intronic
1104352413 12:128056391-128056413 AAATGGCAGCAGAGTGAAGCAGG + Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104703002 12:130921440-130921462 AAGTGGGAGCAGAAGGAAGGGGG + Intergenic
1105829997 13:24155840-24155862 CAGAGGCTGCAGTGGGAAAGTGG - Intronic
1106143113 13:27027442-27027464 TAGTGGGAGCTGAGGGAGGGAGG + Intergenic
1106478320 13:30116665-30116687 CAGTGGCAGCTGGGGGATAGGGG + Intergenic
1107606583 13:42063574-42063596 CAGTGGCTGGAGAGGGATGCTGG + Intronic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107838066 13:44428157-44428179 CACTGGCAGGAGATGGAAGTGGG - Intergenic
1108117714 13:47147717-47147739 TATTGGCAGCAGTGGGAAGAGGG + Intergenic
1108214898 13:48174552-48174574 CTGTTCCAGCAGAGGGAAGTGGG - Intergenic
1108286757 13:48916335-48916357 AAGTGACAGCAGAGGTAATGGGG + Intergenic
1108839396 13:54593470-54593492 CATTGGCAGCAGTGGCATGGTGG - Intergenic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1110291560 13:73813622-73813644 CTCTGGCAGCAGAAGCAAGGAGG - Intronic
1110493508 13:76137056-76137078 CAGTGGCAGCAGTGAGAAATAGG + Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1110707110 13:78608747-78608769 TGGTGGCAGCAGACGGCAGGCGG - Intergenic
1110758865 13:79208011-79208033 AAGTGCCAGCTGAGGGTAGGAGG + Intergenic
1110980399 13:81890016-81890038 CAGTGCCAGCAGAGGGCAAGAGG - Intergenic
1111181824 13:84679058-84679080 CAATTGCAGGAGATGGAAGGTGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112387885 13:98957108-98957130 GCGTGGCTGCAGAGGGAAGGAGG - Intronic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1113432362 13:110261922-110261944 CAGTGGCTGCACAGGGCAGGTGG + Intronic
1113811393 13:113144504-113144526 CAGGGGCATCAGCGGGCAGGAGG + Intronic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1114373631 14:22118565-22118587 GAGTGGCATCAGAGAAAAGGAGG - Intergenic
1114416601 14:22549034-22549056 CAGTTGCAGCAGAGAGATGATGG + Intergenic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114764753 14:25358322-25358344 CAGTGTCAGAACAGGAAAGGTGG - Intergenic
1115289435 14:31753260-31753282 CAGTGGCAGAAGGTGGCAGGTGG + Intronic
1115779750 14:36756206-36756228 CGGGGGCAGCTGAGGGAAGGTGG + Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1117519040 14:56531842-56531864 CATAGGCAGCAGAGTGGAGGGGG - Intronic
1117542289 14:56760002-56760024 CAGTGTCGACAGAGTGAAGGTGG + Intergenic
1117675638 14:58152284-58152306 CAGTGCCAGCAGAGCCAGGGCGG - Intronic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118053744 14:62056905-62056927 CAGCGGCAGCAGCGAGCAGGGGG + Intronic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1119473221 14:74911947-74911969 CAGTGGCAGGGCAGGGAGGGCGG + Intronic
1119520356 14:75280101-75280123 CATTGGCAGGAGGGGCAAGGTGG + Exonic
1119665194 14:76480367-76480389 CTGGGGCAGCAGAGGGGTGGGGG + Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1120328966 14:83063620-83063642 CAAAGGCTGCAGAGAGAAGGAGG - Intergenic
1121021263 14:90581513-90581535 CAGTGGCAACACAGGGGAGCAGG + Intronic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121529084 14:94640119-94640141 TGGTTGGAGCAGAGGGAAGGAGG + Intergenic
1121662997 14:95649848-95649870 CTCTGGAAGCAGAGTGAAGGGGG + Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1121955122 14:98206486-98206508 CAGTGGCAACAGAGGGCCAGAGG - Intergenic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122289419 14:100672186-100672208 CTGTGGCACAAGAGGGCAGGAGG - Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122465013 14:101926780-101926802 AAGTGACAGCAGTGGGCAGGAGG - Exonic
1123047635 14:105526593-105526615 CAGTGGCGGCAGAGGCTGGGCGG + Exonic
1124037920 15:26073492-26073514 AAGTGGTGGCTGAGGGAAGGAGG + Intergenic
1124045499 15:26146337-26146359 TGGTGACAGCAGAAGGAAGGTGG - Intergenic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124492171 15:30164723-30164745 CAGCCTCAGCCGAGGGAAGGGGG - Intergenic
1124650413 15:31469706-31469728 CACTGGCTGCAGAAGGGAGGTGG - Intergenic
1124751365 15:32373594-32373616 CAGCCTCAGCCGAGGGAAGGGGG + Intergenic
1125820700 15:42627580-42627602 CAGTGGCGGTAGAGGGAAAGGGG - Intronic
1125999435 15:44195216-44195238 CGGTGGCGGCTGAGGGAAGGAGG - Exonic
1126443628 15:48718403-48718425 CACGGGCAGGAGAAGGAAGGTGG + Intronic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1126786999 15:52185510-52185532 CAGTGGCTGCCTTGGGAAGGAGG + Intronic
1127808964 15:62546711-62546733 CAGTGGCCACACAGCGAAGGCGG + Intronic
1127969469 15:63947081-63947103 GAGAGGTAGCAGAGGGAAAGCGG - Intronic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1128347036 15:66860862-66860884 CACTGGCAGCCTGGGGAAGGAGG + Intergenic
1128444220 15:67742505-67742527 AAGGGGCAGCTGGGGGAAGGAGG - Intronic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128758020 15:70196401-70196423 CAGTGGCAGGCCAGGGGAGGAGG - Intergenic
1128913995 15:71543317-71543339 CAGTGGCTGCACTGGGAAAGAGG + Intronic
1129377816 15:75145258-75145280 CAGAGCCTGCAGGGGGAAGGGGG + Intergenic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129894689 15:79094609-79094631 CAATGCCAGCAAGGGGAAGGAGG - Intergenic
1130087688 15:80791808-80791830 CAGAGGCGGCAGAGGGAAAGTGG + Intronic
1130128103 15:81111397-81111419 CAGTGGCAGCGGGGATAAGGAGG - Intronic
1130146638 15:81279609-81279631 AGGTGGCTGCACAGGGAAGGAGG - Exonic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1131129850 15:89891103-89891125 AAGTGGCAGCAGTGGGGAAGTGG + Intronic
1131135702 15:89933518-89933540 CAGGGGCAGGAGTGGGAGGGAGG + Intergenic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131647722 15:94363318-94363340 CAGTGGCAGTAGGTGGAATGAGG + Intronic
1131873122 15:96780586-96780608 CAGGGGCAGCAGGGAGCAGGGGG + Intergenic
1132030683 15:98436426-98436448 TAGTGGCTGCCGAGGGCAGGAGG + Intergenic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132546398 16:535288-535310 CAGTGGCCGCAGATGGAGCGGGG + Intronic
1132567578 16:630489-630511 CAGGGGCAGCAGAGCAGAGGAGG + Intronic
1132756696 16:1488708-1488730 AATTGGCAGCAGATGGAAGACGG - Intronic
1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG + Intergenic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133228555 16:4355117-4355139 AAGTGGCAGCACAGGTGAGGTGG + Exonic
1133436484 16:5784472-5784494 CAGGAGCAGCAGAGAGACGGGGG + Intergenic
1134042570 16:11079847-11079869 TGGAGGCAGCAAAGGGAAGGGGG - Intronic
1134090852 16:11390986-11391008 GAGTGTCAGCACAGGGAAGGGGG - Intronic
1135110337 16:19685994-19686016 GATTGGCAGCAGAGGGAGCGAGG + Intronic
1135532468 16:23266356-23266378 TATTGGCAGTAGAGTGAAGGAGG - Intergenic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1136222044 16:28835261-28835283 CAGTGGCTGCAGCAGGAAAGAGG - Exonic
1136568220 16:31082339-31082361 CGTTGGCAGCAGAGGGAAAAGGG - Intronic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG + Intronic
1137834123 16:51574311-51574333 CAGTGGCTGCAGTGGGATAGCGG - Intergenic
1138353159 16:56357498-56357520 TTCTGGCAGGAGAGGGAAGGAGG + Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139029345 16:62860323-62860345 CAATGCCAGCAGAGAGATGGTGG + Intergenic
1139172413 16:64647923-64647945 AAGTGGCTGCTGAGGAAAGGGGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139908484 16:70382018-70382040 CAAGGGCTGCAAAGGGAAGGTGG - Intronic
1140225069 16:73070609-73070631 CAGTGCCTGCCGAGGGAGGGCGG - Intergenic
1141172956 16:81702613-81702635 CTGTTGCAGCAAAGGAAAGGCGG + Exonic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141345012 16:83236805-83236827 GAGTGGCAGGGGTGGGAAGGAGG + Intronic
1141437496 16:84008728-84008750 CACTGGCAGCAGAGAGCAAGAGG - Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141673157 16:85503367-85503389 GAGCGGCAGCTGAGGGCAGGTGG - Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142109503 16:88323686-88323708 GAGTGGCAGAAGTGGGCAGGGGG + Intergenic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142272342 16:89096729-89096751 CAGAGTCGGCCGAGGGAAGGGGG - Intronic
1142272702 16:89099009-89099031 CAGTGGCAGCAGAGCCCAGAGGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142284359 16:89165700-89165722 AAGGGGCCGCAGAGGGGAGGAGG - Intergenic
1142788314 17:2243044-2243066 CAGTGGCAGGACGGGGGAGGTGG + Intronic
1143709972 17:8727393-8727415 CAGGGGCAGGAGACTGAAGGAGG - Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144761141 17:17708145-17708167 GGGTGGCAGCAGGAGGAAGGAGG - Intronic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1146200539 17:30853746-30853768 CAGTGGCAGGAGTGGGACAGAGG - Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147596765 17:41722889-41722911 CACTGGCAGAAGAGGGAGGGAGG + Exonic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1147607787 17:41784268-41784290 CAGAGGCTCCAGAGGGAATGGGG + Intronic
1147650184 17:42057601-42057623 CATTGGGAGGAGAGGCAAGGGGG + Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147938710 17:44029734-44029756 CAGTGGCAGCGGAAGCAAGGAGG - Intergenic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148107109 17:45124571-45124593 CAGGGCCAACAGAGGTAAGGAGG + Intronic
1148795065 17:50192947-50192969 CCGGGGCAGCAATGGGAAGGAGG + Intronic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1151969232 17:77449409-77449431 CAGAGGCAGAGGAGGGGAGGAGG + Intronic
1152231671 17:79117067-79117089 CGGAGGCGGCAGAGGGAAAGGGG + Intronic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152727210 17:81953262-81953284 CAGTGGCTGCAGAGGAAAACCGG + Exonic
1152913208 17:83017193-83017215 CAGTGGCGGGAGGAGGAAGGGGG + Intronic
1153051761 18:907495-907517 GGGTGGGAGCAGAGGTAAGGAGG - Intronic
1153387239 18:4511323-4511345 CAGTGGGAGAACTGGGAAGGAGG - Intergenic
1153641605 18:7162537-7162559 CCTTGGCAGCAGGAGGAAGGAGG - Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153807391 18:8721330-8721352 CAGGTGCAGCAGATGGGAGGGGG - Intronic
1153962587 18:10152247-10152269 CAGAGCCAGCAGTGGGCAGGTGG - Intergenic
1154000876 18:10481522-10481544 CAGGGGCAGGAGAGAGAATGAGG + Intronic
1154318373 18:13324521-13324543 CAGTGGCAGAACGGGGAAGAGGG + Intronic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155901218 18:31393493-31393515 CAGTAGCAGAAGAGAGAAGGGGG + Intronic
1156344412 18:36242716-36242738 TGGTGGCAGGAGAGAGAAGGGGG + Intronic
1156393993 18:36681486-36681508 CACTGGCAGCAGAGAGAGAGAGG + Exonic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1157103748 18:44753768-44753790 CAGTGACAGCAGGGTGAGGGAGG + Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157589411 18:48827398-48827420 CGTGGGCAGGAGAGGGAAGGTGG + Intronic
1157699426 18:49751586-49751608 GGGTGGCAGCAGTGGGGAGGAGG - Intergenic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158219313 18:55133830-55133852 GAGAGGCAGAAGAGTGAAGGAGG + Intergenic
1158264684 18:55649092-55649114 CAGCGGCAGCAGTTGGAGGGAGG - Intronic
1160089193 18:75810009-75810031 CAGTCAAAGCAGAGGAAAGGCGG - Intergenic
1160236955 18:77093291-77093313 GAGCTGCAGCAGAGGGAAGGCGG + Intronic
1160245885 18:77159060-77159082 CAGAGCCTTCAGAGGGAAGGCGG + Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160357198 18:78238705-78238727 CAGTGGGAGCCGCGGGCAGGCGG + Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160459397 18:79026540-79026562 CCGTGGCAGCAGAGAGCATGTGG + Intergenic
1160515850 18:79478813-79478835 CAGCGGCATCAGAGAGAAGCTGG + Intronic
1160527965 18:79548281-79548303 CAGGGCCAGCAGGTGGAAGGCGG - Intergenic
1160878741 19:1310088-1310110 CAATGGGATCACAGGGAAGGCGG - Intergenic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160934604 19:1587904-1587926 CAGGGGCAGAAGAGGACAGGAGG - Intronic
1160994333 19:1875718-1875740 CAGCGGCAGCAGCGAGCAGGGGG + Intergenic
1161502294 19:4623003-4623025 CACGGGCAGCAGAGGGAGCGAGG - Intergenic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161607347 19:5222427-5222449 CAGAGGCTGCAGAAAGAAGGTGG + Intronic
1161614336 19:5261543-5261565 CATCAGCAGCAGAGAGAAGGGGG - Intronic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164559024 19:29275903-29275925 AAGTGGCAGCGGAGGAAGGGAGG - Intergenic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1165015352 19:32876417-32876439 CACTTGCAGCATGGGGAAGGAGG + Intergenic
1165026985 19:32969456-32969478 GAATGGCAGCAGGAGGAAGGGGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165404924 19:35623736-35623758 CAGTTGCCTCTGAGGGAAGGTGG + Exonic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1165944403 19:39433058-39433080 GAGTGGAAGCAGAAGGCAGGGGG - Intergenic
1166176782 19:41078829-41078851 CACTGGCAAGAGATGGAAGGGGG + Intergenic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166562826 19:43744707-43744729 CACTGGGAGCAGGGGCAAGGTGG - Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1166864967 19:45830307-45830329 GAGAGGCAGCAGGGGGATGGGGG - Intronic
1166996668 19:46722801-46722823 CCGGGGCAGCAGCGGTAAGGGGG - Exonic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168527896 19:57103436-57103458 CAGTGGCGGCAGAGGAGATGGGG - Intergenic
1202683867 1_KI270712v1_random:31364-31386 CAGTGGCAGAGGGGGGGAGGGGG - Intergenic
925116439 2:1382385-1382407 CTATGGAAGCAGAGAGAAGGGGG + Intronic
925202414 2:1979288-1979310 CCGTGGCAGCAGAGAGAAGGAGG + Intronic
925448605 2:3950114-3950136 CAGCGGCACCAGAGGTGAGGGGG + Intergenic
926053771 2:9761706-9761728 CAGAGGCAGGAAAGGGAGGGCGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926638353 2:15207709-15207731 AGGTGGCAGGAGAGAGAAGGGGG - Intronic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927284678 2:21344531-21344553 CAGTGGCAGCAGATGTGTGGAGG + Intergenic
927654335 2:24932782-24932804 CAGAGGTGGCAGATGGAAGGAGG + Intergenic
927809539 2:26173633-26173655 CAGGGGCAGCGGGGGAAAGGGGG - Intronic
927843981 2:26461997-26462019 GAGAGGAGGCAGAGGGAAGGTGG - Intronic
928628757 2:33168983-33169005 CTGTGGCAGCAGAGTTAGGGGGG + Intronic
928669408 2:33585350-33585372 CCGTGGCAGAAGAGGCAAGATGG - Exonic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
931982399 2:67707952-67707974 CAGCAACAGCAGAGGGAAAGGGG - Intergenic
932141091 2:69278839-69278861 CAGTGGTGGCAGTTGGAAGGGGG + Intergenic
932344554 2:70987055-70987077 CACTGGCAGTAGAGTGGAGGGGG + Exonic
932417807 2:71584263-71584285 GAGTGGGAGCAGAGGCAAAGCGG + Intronic
932765269 2:74465197-74465219 CAGTGCCGGCAGAGGGAGTGCGG - Exonic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933765629 2:85706743-85706765 GAGTGGCAGGAGAGGGCAAGAGG - Intergenic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
933998231 2:87685640-87685662 GAGGGGCAGCTGAAGGAAGGAGG + Intergenic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934049197 2:88196185-88196207 CAGGGGCAGGAGCGGGGAGGAGG - Intergenic
934651329 2:96092735-96092757 CTGTGGCGGCCGGGGGAAGGTGG + Intergenic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
936044943 2:109180179-109180201 CAGTGGCAGCACAGGTAGAGAGG - Intronic
936295619 2:111265233-111265255 GAGGGGCAGCTGAAGGAAGGAGG - Intergenic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
937911661 2:127078534-127078556 GAGTGGCAGCAGGGGGCAGGTGG + Intronic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
937992342 2:127671681-127671703 CAGTGGCATAATAGGGATGGAGG - Intronic
938165118 2:129019355-129019377 GAGAGTCAGCAGAGAGAAGGGGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
939097639 2:137852733-137852755 CATTGGCAGTAGAGTGCAGGGGG - Intergenic
939152128 2:138485511-138485533 AAGTGGGAGCTGAGAGAAGGAGG + Intergenic
939684668 2:145184404-145184426 TATTGGCAGCAGGAGGAAGGTGG + Intergenic
940199567 2:151135392-151135414 GAGCGGGAGCAGAGGGAAAGTGG - Intergenic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
941687475 2:168461914-168461936 AGGTGGCAGCAGAGGGAAAATGG + Intronic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
942242007 2:173971589-173971611 CAGAAGCATCAGAGGGGAGGAGG - Intergenic
942372096 2:175296038-175296060 CTGAGGCTGCAGAGGGAAAGGGG - Intergenic
943068412 2:183113367-183113389 TGGTGGCAGGAGAGGGAAGTTGG + Intergenic
944556274 2:200890699-200890721 GGTTGGCAACAGAGGGAAGGTGG - Intronic
945297114 2:208181732-208181754 CAGTGGCAGCGCAGGGGAGGTGG - Intronic
945693066 2:213066316-213066338 CAACGGCAACAGAGGGAGGGAGG + Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
946061122 2:216942417-216942439 CAGGGGCAGCAGAAGGCCGGGGG - Intergenic
946250111 2:218406481-218406503 CAGAGGCCGCAGAGGGGCGGGGG - Intergenic
946679893 2:222202382-222202404 CAGTTGCAGAAGAAGGAAAGGGG + Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947519811 2:230836857-230836879 CAGTGGCAGCAAAGTGCAGGGGG - Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947634838 2:231674765-231674787 CAGTGGCAGCAGACAGAACACGG - Intergenic
947793983 2:232882941-232882963 AAGTGGCAGCAGGGAGCAGGAGG + Intronic
948006852 2:234616804-234616826 CAGTAGCAGCAGAAGCGAGGAGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948795973 2:240402268-240402290 CAATGGCAACGGAGGAAAGGGGG - Intergenic
949036414 2:241817534-241817556 TGGGGCCAGCAGAGGGAAGGCGG + Intergenic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1169388200 20:5168816-5168838 CAGAGGGAGCAGTGGGCAGGAGG - Intronic
1170190317 20:13638834-13638856 CAGAGGCAGCAGCGCGGAGGCGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1170961359 20:21028595-21028617 AAATGGCAGCAGTGGGAGGGTGG - Intergenic
1171302901 20:24079184-24079206 CAGCGGGAGAAGAGGCAAGGAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1172361624 20:34316624-34316646 CCGTAGGAGCAGAGAGAAGGAGG + Intergenic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173476846 20:43365633-43365655 CAATGTCAGTAGAGGCAAGGTGG - Intergenic
1173531261 20:43771575-43771597 CAGGGGCAGTGGAGGAAAGGGGG - Intergenic
1173834382 20:46115698-46115720 CTGTGGCAACACAGGGGAGGAGG + Intergenic
1173851262 20:46219908-46219930 CAGGGGCTGTACAGGGAAGGTGG + Intronic
1174063012 20:47845715-47845737 CAGAGGCAGCAGAGCTGAGGAGG + Intergenic
1174072712 20:47909959-47909981 CAGAGGCAGCAGAGCTAAGGAGG - Intergenic
1174358527 20:50014142-50014164 CAGTGGCAGTAGCTGGACGGTGG - Intergenic
1174725130 20:52853335-52853357 TCGTGGCAGCAGAGTGGAGGGGG - Intergenic
1175366667 20:58460823-58460845 TAGGGGCAGAAGTGGGAAGGGGG + Exonic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175598691 20:60255582-60255604 CAGTGGCAGCAGCTGGAATTAGG + Intergenic
1175833038 20:61977511-61977533 AAGTGGCAGAACGGGGAAGGGGG - Intronic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176100526 20:63362371-63362393 CAGTGGCTGCTCAGGGAAGCTGG - Intronic
1176129498 20:63490730-63490752 CAATGCCTGCAGAGGGGAGGGGG + Exonic
1178644282 21:34372595-34372617 CAATGGCAGCAGAGAGATGTGGG + Intergenic
1179150601 21:38805731-38805753 AAGCGGGAGGAGAGGGAAGGGGG - Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179622926 21:42630737-42630759 CAGTGCCAGCAGAGGTGCGGAGG + Intergenic
1179797620 21:43794548-43794570 CAGTAGCAGCAGAGGACACGCGG - Intronic
1179801912 21:43815203-43815225 GCGTGGCAGCAGGGGAAAGGGGG + Intergenic
1180076901 21:45467676-45467698 CAGTTCCACCACAGGGAAGGAGG - Intronic
1180157677 21:45986035-45986057 AAGTGGGAGCAGCAGGAAGGAGG - Intronic
1180182555 21:46124480-46124502 TGGTGCCAGCATAGGGAAGGAGG + Intronic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1180994795 22:19960038-19960060 GGGAGGCAGCAGAGGGGAGGAGG - Intronic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1182016664 22:27046084-27046106 GAGTGGCCTCAGAAGGAAGGAGG - Intergenic
1182092287 22:27604038-27604060 CAGTGCCAGCCCAGGGAGGGGGG - Intergenic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1183333378 22:37233235-37233257 GAGTGGCAGCATAGGGAGAGAGG - Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1183601051 22:38840842-38840864 CAGAGGCAGCAGACAGAGGGAGG + Intronic
1183825753 22:40385663-40385685 GAGTGGCAGCAGAGAGTAGTTGG + Intronic
1183859970 22:40662723-40662745 CAGTTGCAGCACTGGGTAGGTGG + Intergenic
1184097298 22:42323422-42323444 CATTAGCATCACAGGGAAGGGGG + Intronic
1184591016 22:45483364-45483386 TAGCAGCAGCAGTGGGAAGGTGG - Intergenic
1184797289 22:46739531-46739553 GAGCGGCAGCTGAGGGAGGGAGG - Intergenic
1185072934 22:48667151-48667173 CAGGGGCAGCACAGGGCAGCAGG + Intronic
1185076865 22:48687809-48687831 CTGGGGCAGCCCAGGGAAGGTGG - Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185227119 22:49659518-49659540 CAGTGGCTGCAGAGACGAGGGGG + Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949965680 3:9354111-9354133 TAATGGCAGAAGAAGGAAGGGGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950204484 3:11068228-11068250 GAGTGGGTGCAGAGGTAAGGAGG - Intergenic
950503266 3:13377599-13377621 CAGGGGCAGCAGGGTGGAGGAGG + Intronic
950980757 3:17302110-17302132 CAGAAGCAGGAGAGGCAAGGAGG - Intronic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
953768390 3:45761077-45761099 CAGCAGCAGCAAAGGGCAGGTGG - Intronic
953772303 3:45787189-45787211 CAGCGGCAGGGAAGGGAAGGTGG - Intronic
953904211 3:46860394-46860416 CAGTGACAGCAGTGGGCAGTGGG - Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
954390972 3:50267772-50267794 AAGTGTCAGCGGAGGGAAGGAGG + Intronic
954596471 3:51829698-51829720 CAGAGGCGGCAGAAGGTAGGTGG + Exonic
954652088 3:52171290-52171312 CAGTGGAAGCAGAGGCAGAGAGG - Intergenic
955411631 3:58659213-58659235 GAGAGGCAGCAGAGTGAAGGGGG - Intronic
955510977 3:59679935-59679957 CAGGGGCAGCAGGGGCAGGGAGG - Intergenic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
956039585 3:65132031-65132053 TAGAGCCAACAGAGGGAAGGAGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956837052 3:73104013-73104035 GAGAGGCAGCAAAGGGAAAGTGG - Intergenic
956956617 3:74348662-74348684 CTGTGGCTGCAGTGGGATGGGGG - Intronic
958128100 3:89383494-89383516 CAGTTCCAGCACAGGGCAGGTGG - Intronic
958819731 3:98959390-98959412 CAGTGGCAGCATGGGGAGTGGGG - Intergenic
960121709 3:113953891-113953913 CAGTGCCAGCACAGGAAGGGAGG - Exonic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
960297473 3:115961535-115961557 CATTGGCAGCACTGGGAAGAAGG - Intronic
960811518 3:121631680-121631702 CAGAGACAGCATGGGGAAGGAGG - Exonic
961185425 3:124910809-124910831 CAAAGGCAGCAGAGGTAAGGAGG - Intronic
961504022 3:127358271-127358293 CAGTGCCAGCAGAGGAACAGAGG - Intergenic
961524736 3:127489523-127489545 CAGTGGAAGCCCAGGGCAGGAGG + Intergenic
961781923 3:129325460-129325482 CAGGGGCAGCAGGGTGGAGGAGG + Intergenic
962282339 3:134061353-134061375 CATTGGCAGAAGAGAGAAGAAGG - Intergenic
962290267 3:134129956-134129978 CAATGACAGAACAGGGAAGGGGG - Intronic
962440665 3:135412742-135412764 CTGTGGCAGCCAAGGGCAGGTGG - Intergenic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962627182 3:137237444-137237466 CAGAGGCAGATGAGGGAAGTGGG + Intergenic
963108187 3:141664312-141664334 CATTGGCAGCCAAGAGAAGGAGG - Intergenic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963718774 3:148835590-148835612 CACTTGCATAAGAGGGAAGGAGG + Intronic
965786247 3:172338356-172338378 CAGAGGCAGGAAGGGGAAGGTGG + Intronic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
966424668 3:179768232-179768254 GTTTGGCTGCAGAGGGAAGGCGG + Intronic
968661691 4:1801282-1801304 CAGGGGCAGCTCTGGGAAGGGGG + Intronic
968762398 4:2449476-2449498 CGTTGGCAGTAAAGGGAAGGAGG - Intronic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
968907912 4:3463153-3463175 CAGTGGCCGCCGCGGGACGGTGG + Intergenic
969352583 4:6606315-6606337 CAGTGGCTCCTGAGGGAAAGTGG + Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
970334059 4:15014836-15014858 TAGTGGAAGCACAGGGAAGATGG + Intronic
970455461 4:16219325-16219347 CAGTGGGAGCACAGGTAAAGGGG - Intronic
970488472 4:16547681-16547703 TAGAGGCAGCAGTGGGAGGGAGG + Intronic
970907445 4:21232877-21232899 CAGGGACAGCAGAGAGAATGAGG + Intronic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
972102099 4:35432691-35432713 TGGTGGCAGGAGAGAGAAGGTGG - Intergenic
973334802 4:48945051-48945073 CAGTGGCAGGAAATGGGAGGTGG + Intergenic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
975252299 4:72194201-72194223 CAGGAGCAACAGAGAGAAGGAGG - Intergenic
975307312 4:72865200-72865222 CAGAGGCTGCATAGAGAAGGGGG - Intergenic
975947841 4:79729305-79729327 AAGTGGCAGCACAGGGGTGGAGG + Intergenic
976091104 4:81458634-81458656 TAGCTGCAGCACAGGGAAGGGGG + Intronic
976547925 4:86359403-86359425 GAGGGGTAGCAGAGGGAGGGAGG - Intronic
976607148 4:86994757-86994779 CAGCTGGAGCAGAGGGAAAGGGG + Intronic
977348209 4:95845130-95845152 GAATGGGAGCAGAGTGAAGGGGG + Intergenic
977647895 4:99435018-99435040 CAGTGGAAGCAGGGGTAAGTTGG - Exonic
978005409 4:103609747-103609769 GAGTGGCAGGAGAGGGGATGGGG - Intronic
978710186 4:111770681-111770703 CTGTGGCAGCACAGGGCTGGGGG + Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
978896519 4:113895103-113895125 CAGTGGTTGCAGATGGAAGTTGG - Intergenic
979501046 4:121440075-121440097 CAGTGGCAGCAGAAAGAAACGGG + Intergenic
979806146 4:124973656-124973678 CAGGGGAAGCATAGGGAATGAGG + Intergenic
980791976 4:137632161-137632183 CAGTGGCAGCACAGAGCAGGGGG - Intergenic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
981724107 4:147829937-147829959 GAGTGCCAGGAGAGAGAAGGTGG + Intronic
981782739 4:148445091-148445113 CAGTGGCCGTAGTGGGAGGGCGG - Intergenic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
982968319 4:161945172-161945194 CAGTGGAAGAAGAGAGCAGGAGG - Intronic
984673678 4:182522340-182522362 CAGTGGCTGCAAAGTGAAAGCGG - Intronic
984856438 4:184199840-184199862 GAGTGGGAGCAGACGGAAAGTGG - Intronic
985192659 4:187393139-187393161 CGGTGGCTGAAGAGGGAAGTCGG - Intergenic
985642116 5:1068552-1068574 CAAAGGCAGCCAAGGGAAGGCGG + Intronic
986054097 5:4118908-4118930 CAGTGGCAGCAGGCAGAGGGAGG - Intergenic
986197190 5:5548582-5548604 CAGTGGCAGGAAAGTGAATGGGG + Intergenic
986260629 5:6142945-6142967 CAGAGGCAGAGGAGGGAATGAGG - Intergenic
987001587 5:13665505-13665527 CAGTGGGAGAACTGGGAAGGAGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
989216337 5:38908094-38908116 CAGTGGCAGCACAGGGGTAGGGG - Intronic
990522787 5:56595775-56595797 CAGTGGTTGAAGAGTGAAGGAGG - Intronic
990624786 5:57598689-57598711 AAGAGGAAGCAGAGGCAAGGAGG - Intergenic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991171749 5:63634810-63634832 CAGGGGCAGCTGGGAGAAGGAGG - Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992009077 5:72509283-72509305 CATCAGCAGCAGAGGAAAGGAGG + Intergenic
992012329 5:72541306-72541328 CATCAGCAGCAGAGGAAAGGAGG + Intergenic
992738389 5:79746835-79746857 CAGTGTCAGGACAGGGATGGAGG - Intronic
992823135 5:80518629-80518651 ACATGGCAGCAGAGGGAAAGGGG + Intronic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
994135989 5:96287240-96287262 CAGTGGAAGGAAAGGGGAGGGGG - Intergenic
994946494 5:106399950-106399972 CATAGGCAGAAGAGGAAAGGAGG + Intergenic
995226708 5:109708794-109708816 CAATGGCAGGAGAGGAAAAGCGG + Intronic
995243177 5:109908355-109908377 GATAGGCAGCAGAGGGAAGATGG - Intergenic
997167370 5:131675684-131675706 CAGTGGCTGCCTAGGGATGGTGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997942223 5:138168512-138168534 CTCTGACAGCAGAGGGGAGGGGG + Intronic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998186368 5:139982836-139982858 CAGGGGCAGCAGAATGAATGGGG + Intronic
998275950 5:140753584-140753606 CAGTGGCAGCAGAGGGTTCATGG + Intergenic
998997328 5:147879952-147879974 AAGTGGCAGCAGAAAGGAGGTGG + Intronic
999093671 5:148958980-148959002 GAGTGGCAGCAGCGGGGTGGGGG - Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999248534 5:150167922-150167944 AAGCGGGAGCAGTGGGAAGGGGG + Intronic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1000575284 5:162968756-162968778 TGTTGGCAGGAGAGGGAAGGGGG - Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1001415160 5:171540511-171540533 CAGAGGCAGCACAGGGGAGTCGG - Intergenic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001494023 5:172175330-172175352 CAGGGGAAGCAGAGAGAAAGGGG + Intronic
1001571335 5:172732462-172732484 CAGATGCTGCAGAGGGAGGGAGG + Intergenic
1002212341 5:177606478-177606500 CAGTGGCAACAGCGAGAAGCGGG - Intronic
1002293286 5:178214048-178214070 GACTGACAGCAGAGAGAAGGCGG + Intronic
1002324080 5:178394130-178394152 CAGAGGCAGGACAGGCAAGGAGG + Intronic
1002405630 5:179027937-179027959 GAGGGGCAGTACAGGGAAGGAGG - Intronic
1002570512 5:180137049-180137071 AAGCGGCAGCAGAGGGCGGGAGG + Intronic
1003440658 6:6138371-6138393 CAAGGGCAGGAGAGGGAATGTGG + Intergenic
1003960132 6:11201201-11201223 CAGCGGCAGCAGAGGCCATGTGG + Intronic
1004495209 6:16156436-16156458 CAATGGCAGGAGAGTGAAGGTGG + Intergenic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005936878 6:30529778-30529800 CAGTGGCAGAAGTGGAGAGGTGG + Intergenic
1006361311 6:33588853-33588875 CTGTGCCAGCCGAGGGGAGGTGG + Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007924021 6:45636668-45636690 GACTGGAAGCACAGGGAAGGAGG + Intronic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1009492196 6:64304861-64304883 CAGTGAAAGCAGTGGTAAGGGGG + Intronic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010177905 6:73051188-73051210 CAGTGGCAGCGTGGGGCAGGGGG - Intronic
1010380907 6:75223959-75223981 CAGTGGCAGCAGATCCAAGTTGG + Intergenic
1010691044 6:78911081-78911103 TGCTGGCAGCAGAAGGAAGGCGG - Intronic
1010984778 6:82411449-82411471 CAATGGCAGGAGATGTAAGGTGG - Intergenic
1011631416 6:89329003-89329025 TTATGGCAGCAGAGGGCAGGGGG + Exonic
1011867933 6:91854415-91854437 GAGTGGCAGGAGAGAGAATGAGG - Intergenic
1012289694 6:97437502-97437524 CTGAGGCATCTGAGGGAAGGGGG - Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1012763672 6:103335622-103335644 CAGGAGCAACAGAGTGAAGGAGG + Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013119320 6:107127148-107127170 CAGAGGCAGGAAAGGGAAAGGGG + Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014693574 6:124591491-124591513 CATTGGAAGCAAAGGGAGGGAGG - Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1017105141 6:150880260-150880282 CAGAGGCTGGAGAGGGATGGGGG - Intronic
1017115039 6:150968136-150968158 CAATGACAGCAGAGGGACGGGGG - Intronic
1017265629 6:152442169-152442191 CAGGCGCAGCAGGGAGAAGGGGG - Exonic
1018141106 6:160837878-160837900 CAGTTGCACCTGCGGGAAGGAGG + Intergenic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1018700096 6:166419591-166419613 CAGGTGCAGCAGAGAGAATGGGG + Intronic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1018998751 6:168729708-168729730 CAGTGGCCTCTGAGGGCAGGAGG + Intergenic
1019059098 6:169242836-169242858 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059137 6:169242952-169242974 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019059177 6:169243075-169243097 AGGTGGGAGCAGTGGGAAGGTGG - Intronic
1019184042 6:170210550-170210572 CATTGCCAGCAGAGGGGAGACGG + Intergenic
1019427309 7:983694-983716 TAGGGACAGCAGAGGGGAGGAGG + Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019698894 7:2463077-2463099 CAGGGGCAGGGGAGGGAATGGGG + Intergenic
1020136794 7:5592363-5592385 CAGAGGCAGACGAGGGAAAGAGG - Intergenic
1021339169 7:19442022-19442044 CAGTTGAAGCATAGGGAAGTTGG + Intergenic
1021767878 7:23967675-23967697 GAGTGGCAGCAAAGGAAAGCTGG + Intergenic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1023022088 7:36019602-36019624 CACTGTCTGCAGAGAGAAGGGGG - Intergenic
1023130457 7:36997740-36997762 CAGTGGTAGGAGAGGAAAAGAGG + Intronic
1023216818 7:37871277-37871299 CAGTGGCTGCAGAAGGGTGGGGG + Intronic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023848870 7:44139608-44139630 GAGTGACTGCACAGGGAAGGTGG + Intronic
1023979887 7:45062937-45062959 GAAGGGCAGGAGAGGGAAGGGGG + Intronic
1024033155 7:45482411-45482433 GAGTGGCAACAGTGAGAAGGTGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1024270124 7:47635720-47635742 CAGGGCCAGGACAGGGAAGGAGG + Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1028567213 7:92246236-92246258 CAGCGGCCGGAGAGGGATGGGGG + Exonic
1028809637 7:95069428-95069450 AAATGGAAGGAGAGGGAAGGAGG + Intronic
1029424371 7:100486990-100487012 GAGTGGCAGGAGAGGGAGCGTGG - Exonic
1030324871 7:108208423-108208445 TAGAGGAAGCTGAGGGAAGGAGG - Intronic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032684903 7:134223420-134223442 CAGAGGCAGCAGGGGGTAGGTGG + Intronic
1032689177 7:134265677-134265699 CTGTCCCAGCAGAGAGAAGGAGG - Intergenic
1033273624 7:139955245-139955267 CAGTGACGGCAGAGGGTGGGAGG - Intronic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1033584255 7:142762539-142762561 CATGGGCAGGAGAGGGATGGGGG - Intronic
1033828317 7:145219699-145219721 AAGGAGCAGCAGAGAGAAGGGGG - Intergenic
1034437428 7:151069878-151069900 CAGTGGCAGGAGATGGGATGGGG - Intronic
1034696480 7:153058657-153058679 CCCTGGCAGCAGAGTGAAAGGGG - Intergenic
1035472216 7:159117694-159117716 GAGTGGCAGCTGAGGGTGGGTGG + Intronic
1035566594 8:645171-645193 CAGTGCCAGCCGAGGGAAAGGGG - Intronic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1035983692 8:4401995-4402017 CAGTGGTAGCAGCAGGAATGTGG - Intronic
1036098126 8:5747509-5747531 CAGTTGCAGAAGATGAAAGGAGG - Intergenic
1037061027 8:14509821-14509843 AAGTGGCAGGAGAGAGAAGAGGG + Intronic
1037360726 8:18070731-18070753 AAGTGACAGCAGAGGAAAAGAGG - Intronic
1037796295 8:21998051-21998073 CAGTGGCAACTGAGGGAGAGGGG - Intronic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038466790 8:27772151-27772173 CAAAGGCCGCAGATGGAAGGTGG + Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1038922504 8:32100123-32100145 GAGAGGAGGCAGAGGGAAGGAGG - Intronic
1039400071 8:37261844-37261866 CAGTGGCATCAGAGCCAAGCTGG + Intergenic
1039468076 8:37797601-37797623 GGGTGGGAGCAGGGGGAAGGGGG + Intronic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1039854741 8:41402517-41402539 GGGGGGCAGCAGAGGGAAAGGGG + Intergenic
1040091434 8:43402584-43402606 CAGTGGCAAGAGAGTGAGGGGGG + Intergenic
1040372118 8:46787636-46787658 CAGTGGCAGCAGAGTGCTAGTGG + Intergenic
1040400222 8:47043189-47043211 CATTGTCAGCAGAGGGATAGAGG - Intergenic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1042051614 8:64715646-64715668 CACTGGCAACAGAGGGAAAATGG + Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1042651399 8:71045888-71045910 CAGTAGCTGCAGAAGGAAAGAGG + Intergenic
1044177257 8:89142725-89142747 TAGTGGGAGCAGAGGGCATGGGG - Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044927322 8:97220753-97220775 AAGAGACAGCAGAGGGGAGGTGG - Intergenic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047750729 8:127878554-127878576 CAGTGGCAGGGAAGGGAAAGAGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048327505 8:133450698-133450720 AAGATGCAGCAGAGAGAAGGAGG - Intergenic
1048327807 8:133452432-133452454 CACAGGCATCAGAGGGAGGGAGG + Intergenic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048852303 8:138656779-138656801 CCCAGGCAGCAGAGGCAAGGTGG + Intronic
1048980908 8:139703138-139703160 CAGCAGCAGCAGCGGGGAGGCGG + Intergenic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1049444533 8:142623956-142623978 CAGGGGCAGCAGAGGAAACTGGG + Intergenic
1049479629 8:142815705-142815727 CAGAGGCAGCAGGGAGAAAGGGG - Intergenic
1049558172 8:143294007-143294029 CTGTGGCAGCAGAGGAGAAGCGG - Intronic
1050186351 9:2979119-2979141 CAGTGGTGGCTGAGGGATGGTGG - Intergenic
1051324828 9:15954325-15954347 CAGTGGAAGCAGTGCTAAGGGGG - Intronic
1051463286 9:17348427-17348449 CAATGTCAGCAGAGGAAAAGAGG - Intronic
1052437214 9:28444340-28444362 CAGTGCCAGCAGAGAACAGGAGG - Intronic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052968766 9:34363622-34363644 GAGCAGCAGCAGGGGGAAGGGGG - Intergenic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1053161318 9:35815128-35815150 AAGTGGCTGCAGAGGCAATGGGG - Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053674313 9:40407809-40407831 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054385421 9:64547876-64547898 CAGTGGGAGGAGAGGAAAAGGGG + Intergenic
1054510308 9:65968481-65968503 CAGTGGGAGGAGAGGAAAAGGGG - Intergenic
1054828609 9:69598566-69598588 GATAGGAAGCAGAGGGAAGGTGG + Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1056411055 9:86327601-86327623 TGGTGGCAGCAGAGGTAGGGTGG + Intronic
1056412546 9:86345332-86345354 CAGTGGTAACAGAGGATAGGTGG + Intronic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1056795412 9:89655571-89655593 CACTGGCAGCCAAGGGCAGGAGG - Intergenic
1057016587 9:91657682-91657704 CAGTCCCAGCAGAGGGGATGGGG - Intronic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1057767577 9:97935503-97935525 CAGTGTCAGCAGTGCCAAGGTGG + Intronic
1057799732 9:98183200-98183222 CAGTAGCAACAGAGGGTTGGAGG - Intronic
1058804351 9:108576848-108576870 CAAGTGCTGCAGAGGGAAGGTGG - Intergenic
1059091249 9:111360963-111360985 CATGGGCAACAGAAGGAAGGAGG + Exonic
1059398613 9:114054614-114054636 CAGTGGAAGAACTGGGAAGGAGG + Exonic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059503420 9:114776399-114776421 AAGTGGCTGCAGGGGGAAGTGGG + Intergenic
1059503426 9:114776431-114776453 AAGTGGCTGCAGAGGGAAGTGGG + Intergenic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1060102777 9:120855518-120855540 CAGTGGTAGGAGTGGCAAGGTGG + Intergenic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060220753 9:121762927-121762949 AACTGGCTGGAGAGGGAAGGTGG - Intronic
1060223891 9:121779937-121779959 GCCTGGAAGCAGAGGGAAGGCGG - Intronic
1060471388 9:123951447-123951469 TGGTGGGAGCAGAGGGAATGAGG + Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060978186 9:127777504-127777526 CTGGGGCAGCAGGGGGATGGGGG - Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061120218 9:128637302-128637324 CAGGGGCTGCAGCAGGAAGGTGG + Intronic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061271893 9:129548524-129548546 AAGGGGCAGACGAGGGAAGGAGG - Intergenic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1062052460 9:134454678-134454700 CTGAGGCAGGAGAGGGGAGGAGG - Intergenic
1062121995 9:134838864-134838886 CAGTGGCAGCAGCGTGGAGCTGG + Intronic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062614649 9:137390882-137390904 CAGTGGACGCTGAGGGCAGGGGG + Intronic
1062654074 9:137593103-137593125 CAGTGGCTGGAAAGGGATGGGGG - Intergenic
1185484409 X:471242-471264 CACTGGCAGCGGATGGAATGAGG + Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1186532851 X:10314690-10314712 GAGAGGCAGGAGAGGGAAGGTGG + Intergenic
1187052458 X:15708206-15708228 TGGTGGCAGGCGAGGGAAGGGGG - Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1188707311 X:33351296-33351318 CAGTGGCTGCCTAGGGAAGGTGG + Intergenic
1188707892 X:33357806-33357828 CAGTGGCAGGAGCAGCAAGGTGG - Intergenic
1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG + Intergenic
1188843745 X:35047712-35047734 CAGTGGCAGCTGAGAGAATGAGG - Intergenic
1189362237 X:40361872-40361894 CAGTGGCTGCAGGAGGAAGTGGG + Intergenic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1190081775 X:47362305-47362327 CAGTGGCTGCATCGGGGAGGTGG - Intergenic
1190736995 X:53262303-53262325 CAGTGCCAATAAAGGGAAGGAGG - Intronic
1191858206 X:65644593-65644615 CAGTGGCAGCTCAGGGCAGGGGG + Intronic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192193944 X:69016325-69016347 CGCTGGCTGGAGAGGGAAGGAGG - Intergenic
1192194571 X:69019613-69019635 CAGTGGCCTCAGAGGAAAAGTGG + Intergenic
1192469999 X:71390257-71390279 CAGTGACAGGAGATGAAAGGAGG - Intronic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1193543460 X:82799049-82799071 CATTGGCAGCTGAGGGCAGATGG - Intergenic
1193992355 X:88323609-88323631 TAGTATCAGAAGAGGGAAGGTGG - Intergenic
1194365669 X:93010964-93010986 CAGTAGCAGCAGTGGGAAAATGG + Intergenic
1194366434 X:93019408-93019430 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic
1194901715 X:99520238-99520260 CATAGGCAGCAGAGGGTAGCAGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1195541412 X:106067609-106067631 CAGTGGCAGCAGAAGTGTGGTGG + Intergenic
1195693016 X:107644516-107644538 GATTGGCAGCAGAAGGAATGAGG - Intronic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1195923132 X:110002483-110002505 CAGAGGCAGAAAAGGGAAGGAGG + Intergenic
1196951673 X:120931265-120931287 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196952357 X:120936126-120936148 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196953042 X:120940987-120941009 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196953727 X:120945847-120945869 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196954412 X:120950708-120950730 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196955095 X:120955568-120955590 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196955783 X:120960451-120960473 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196956464 X:120965312-120965334 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196957146 X:120970172-120970194 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196957828 X:120975032-120975054 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196958510 X:120979892-120979914 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1196959191 X:120984752-120984774 TAGCGGCAGCAGCGGGGAGGCGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1199926350 X:152469287-152469309 CAGAGGCTACAGAGTGAAGGGGG + Intergenic
1200052617 X:153443012-153443034 CAGTGGCAGCAGGGGAGGGGAGG - Intergenic
1200226074 X:154418581-154418603 CATTGGCTTCAGAAGGAAGGAGG + Intronic
1200673887 Y:6127214-6127236 CAGTAGCAGCAGTGGGAACATGG + Intergenic
1200674661 Y:6135670-6135692 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic