ID: 1165121086

View in Genome Browser
Species Human (GRCh38)
Location 19:33558911-33558933
Sequence CAGGGAGGGCGTTTGGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165121073_1165121086 6 Left 1165121073 19:33558882-33558904 CCGCACGGAATGCTTATAGATGG No data
Right 1165121086 19:33558911-33558933 CAGGGAGGGCGTTTGGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165121086 Original CRISPR CAGGGAGGGCGTTTGGGATA GGG Intergenic
No off target data available for this crispr