ID: 1165123495

View in Genome Browser
Species Human (GRCh38)
Location 19:33578550-33578572
Sequence CTGTCTGCACAGATATTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165123485_1165123495 27 Left 1165123485 19:33578500-33578522 CCTGAGGGAGGGGGGTATCCTGA No data
Right 1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG No data
1165123486_1165123495 9 Left 1165123486 19:33578518-33578540 CCTGAGCCTACTCCCTCTTTGTG No data
Right 1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG No data
1165123491_1165123495 -3 Left 1165123491 19:33578530-33578552 CCCTCTTTGTGGGGTGACACCTG No data
Right 1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG No data
1165123490_1165123495 3 Left 1165123490 19:33578524-33578546 CCTACTCCCTCTTTGTGGGGTGA No data
Right 1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG No data
1165123484_1165123495 30 Left 1165123484 19:33578497-33578519 CCGCCTGAGGGAGGGGGGTATCC No data
Right 1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG No data
1165123492_1165123495 -4 Left 1165123492 19:33578531-33578553 CCTCTTTGTGGGGTGACACCTGT No data
Right 1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165123495 Original CRISPR CTGTCTGCACAGATATTCCA GGG Intergenic
No off target data available for this crispr