ID: 1165131758

View in Genome Browser
Species Human (GRCh38)
Location 19:33636956-33636978
Sequence GGGCAACCAGCAGTGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165131758_1165131768 20 Left 1165131758 19:33636956-33636978 CCCCCAACCACTGCTGGTTGCCC 0: 1
1: 0
2: 2
3: 25
4: 345
Right 1165131768 19:33636999-33637021 ATGATACGCAAAACAAGGGATGG 0: 1
1: 1
2: 34
3: 429
4: 865
1165131758_1165131767 16 Left 1165131758 19:33636956-33636978 CCCCCAACCACTGCTGGTTGCCC 0: 1
1: 0
2: 2
3: 25
4: 345
Right 1165131767 19:33636995-33637017 CTTGATGATACGCAAAACAAGGG 0: 1
1: 11
2: 400
3: 768
4: 746
1165131758_1165131766 15 Left 1165131758 19:33636956-33636978 CCCCCAACCACTGCTGGTTGCCC 0: 1
1: 0
2: 2
3: 25
4: 345
Right 1165131766 19:33636994-33637016 TCTTGATGATACGCAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165131758 Original CRISPR GGGCAACCAGCAGTGGTTGG GGG (reversed) Intronic
901736193 1:11313636-11313658 GGGCAACAAGGAGAGGGTGGAGG - Intergenic
901957515 1:12797329-12797351 GGGCCTCCAGGAGTGGTTCGTGG - Intergenic
902699754 1:18163684-18163706 GTGCAGCCAGCATTGGTGGGTGG + Intronic
905216464 1:36411759-36411781 GGGTAACCAGTACTGGTTGAGGG + Intergenic
905461691 1:38126527-38126549 GGGGACCCAGCAGGGGTGGGCGG - Intergenic
905581566 1:39086385-39086407 GGGCAACGAGGAGTCCTTGGAGG + Intronic
905602040 1:39260643-39260665 GGGCAACCAGCCGCGTGTGGTGG - Intronic
905867183 1:41382653-41382675 CGGCACCCAGCTCTGGTTGGGGG - Exonic
905902775 1:41592711-41592733 AGGCAACCTGCAATTGTTGGTGG + Intronic
906061161 1:42949589-42949611 GGGCAACCAGGGGTGTCTGGAGG - Intronic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
906605140 1:47164049-47164071 TGGCAGCCAGCAGTGGCTGGAGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907510205 1:54952393-54952415 GGGTAACCAGCAGCCCTTGGTGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908487764 1:64611755-64611777 GGGTAACCAGCAGAGATTGGAGG - Intronic
909576320 1:77180694-77180716 GGACAACTAGAAGTGGGTGGGGG + Intronic
909898822 1:81108518-81108540 GGCACACCAGCAGTGATTGGAGG - Intergenic
910166975 1:84338135-84338157 GGGTAACAGGCAGAGGTTGGAGG - Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
910759925 1:90723860-90723882 GGGCCCCCAGCAGGGGTAGGAGG + Intergenic
913411954 1:118561954-118561976 GGGCAGCCACCAGAGGCTGGAGG + Intergenic
913967825 1:143391906-143391928 GCGCAACCAGCAGGGGGTGCTGG + Intergenic
914062205 1:144217496-144217518 GCGCAACCAGCAGGGGGTGCTGG + Intergenic
914116945 1:144748858-144748880 GCGCAACCAGCAGGGGGTGCTGG - Intergenic
915243667 1:154541558-154541580 GGGAGACCAGCATGGGTTGGGGG + Intronic
915527799 1:156486994-156487016 GGGATACCAGGGGTGGTTGGAGG - Intronic
916178208 1:162060527-162060549 TGGCAACCAGGGGTGGGTGGAGG - Intergenic
916985167 1:170183027-170183049 GGGCAACCAGCAGCCCTTGGGGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920196159 1:204228648-204228670 GGGCCACTAGAAGTCGTTGGGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922896709 1:229106385-229106407 GGGCACCCAGCAGTTCCTGGGGG + Intergenic
924371587 1:243356668-243356690 CGACAATCAGCAGTGGTTGTAGG - Intronic
924806440 1:247365430-247365452 GGGTAACAGGCAGAGGTTGGAGG + Intergenic
1065804283 10:29380674-29380696 GCGTAACCAGCAGGAGTTGGGGG - Intergenic
1067464737 10:46489379-46489401 GGAGAACCAGGAGTGTTTGGAGG - Intergenic
1067622457 10:47895274-47895296 GGAGAACCAGGAGTGCTTGGAGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069753200 10:70757982-70758004 GGGCATCCAGCAGCGGCAGGTGG + Exonic
1069982111 10:72260087-72260109 GGGCGACCAGCTCTGGATGGGGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074671651 10:115798389-115798411 GGGCAACAGGCAGTGGTATGGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075571211 10:123547585-123547607 GAGAAAGCAGGAGTGGTTGGGGG + Intergenic
1075679173 10:124320385-124320407 GGGCAGCCAGCATTTGCTGGAGG - Intergenic
1076168999 10:128304609-128304631 GGGCCACCAGCAGTGGATGGAGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077596728 11:3538352-3538374 GGGAAACAGGCAGAGGTTGGAGG - Intergenic
1078501395 11:11882134-11882156 GGGCAATGAGCAGTGATTGATGG - Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1084252643 11:67912325-67912347 GGGAAACAGGCAGAGGTTGGAGG - Intergenic
1084820216 11:71683707-71683729 GGGAAACAGGCAGAGGTTGGAGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085507264 11:77067489-77067511 GAGCACCCAGAAGGGGTTGGTGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087136590 11:94726937-94726959 GAGAAACCAGCAGGGGTTGCAGG + Intronic
1087181451 11:95146264-95146286 GGGCAAATTGCAATGGTTGGTGG - Intergenic
1087674205 11:101140273-101140295 AGGCAACCAGCAGCCCTTGGGGG - Intergenic
1088425093 11:109693628-109693650 TGGGCACCAGCAGTGGTGGGTGG - Intergenic
1089656276 11:119949094-119949116 AGGCAACAAGCAGTGGTATGGGG + Intergenic
1090042348 11:123301987-123302009 GGGCAACCAGCAGTAAAAGGAGG - Intergenic
1091591781 12:1846744-1846766 GGGCGACCTGCAGGGGTTTGGGG + Intronic
1092422891 12:8347125-8347147 GGGAAACAGGCAGAGGTTGGAGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094155544 12:27333445-27333467 GGGCGCCCAGCAGTGGGTGGAGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096481066 12:51941380-51941402 AGGAAACCAGCAGTCGATGGCGG + Intergenic
1096997537 12:55848179-55848201 GTGCAAGCTGCAGTGGTGGGTGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1099859196 12:88207013-88207035 GGGTAACAAACAGTGTTTGGAGG - Intergenic
1101910796 12:108858841-108858863 GTGCAACATGCAGAGGTTGGGGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103948571 12:124540200-124540222 GGCGACCCAGCAGTGGTGGGAGG + Intronic
1104087772 12:125492329-125492351 TGGCATGCAGCAGTGTTTGGAGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110125264 13:71934262-71934284 GGCCAAACAGTAGTGGTGGGAGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112652575 13:101415924-101415946 GGGCATCTAGCAGGTGTTGGGGG - Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114529412 14:23386485-23386507 GCGCAACCACCAGCGGGTGGTGG - Exonic
1116076068 14:40112628-40112650 GGGCAGCCAGCAGGGGTAGGGGG + Intergenic
1116263838 14:42662798-42662820 GGGCAACCTGGAGGGGCTGGTGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118322253 14:64760016-64760038 GGACAAGCAGCATTGGTTGCTGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120436894 14:84493801-84493823 GAGCAACCAGAAGTGCTCGGGGG - Intergenic
1121486874 14:94323119-94323141 GGGCAGCCAGCAGTGTTATGAGG - Intronic
1121643682 14:95502984-95503006 GGGAGACCAGCATTGTTTGGGGG - Intergenic
1122068344 14:99189235-99189257 CGGCAGCCAGCAGCGGCTGGAGG - Intronic
1122164094 14:99808119-99808141 GGGAAACCAGCAGTGATCAGAGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124796562 15:32786809-32786831 GGCCACCAGGCAGTGGTTGGAGG - Intronic
1126422293 15:48487504-48487526 GGACACCCAGCAATGGGTGGGGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128119164 15:65133337-65133359 GCGCGACCGGCAGTGGCTGGAGG - Exonic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128530412 15:68441371-68441393 GGGCAGCCACCAGTGGGTGCCGG + Intergenic
1129463322 15:75710707-75710729 GGGCATCCAGGAGGGGTGGGAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131170879 15:90177204-90177226 GAGCCAGCAGCAGAGGTTGGGGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132592333 16:731436-731458 GGGCAGCCTGCAGGGTTTGGAGG - Intronic
1132668011 16:1090734-1090756 GGGCAACCGGCAGTGGGCGTCGG - Intronic
1132769236 16:1551806-1551828 GGGCAACCAGCCCGGGTGGGAGG - Intronic
1133274109 16:4626183-4626205 GGGGAACCAGCACAGTTTGGGGG + Intronic
1133956319 16:10446940-10446962 GAGAAACCTCCAGTGGTTGGGGG - Intronic
1134866537 16:17612247-17612269 GGGCAACCAGCAGCCTTCGGGGG + Intergenic
1135821520 16:25690891-25690913 AGGCACCCAGCTGTGGCTGGGGG + Intergenic
1135963054 16:27013606-27013628 AAGCAACCTGCAGTGGTTAGAGG + Intergenic
1136236848 16:28919675-28919697 GGGCACCCAGCAGTGATTCTAGG - Intronic
1136569715 16:31089316-31089338 GAGCAAGCAGCAGTGGGTGCTGG - Intronic
1136580698 16:31149318-31149340 GGGCAAACTGAAGTGGGTGGAGG - Intronic
1142148314 16:88501843-88501865 TGGCAAACAGCAGTGGCAGGAGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142398926 16:89849108-89849130 GGGCTCCCAGCAGTGGGTGGTGG + Intronic
1143280672 17:5751993-5752015 GGGGAGCAAGCAGGGGTTGGTGG + Intergenic
1143388503 17:6546153-6546175 AGGAAACCAGTACTGGTTGGGGG + Intronic
1143954627 17:10658718-10658740 GGGCAACGCTCAGTGGCTGGTGG - Intergenic
1147420388 17:40319530-40319552 GGGTAAGCAGCAGGGGGTGGGGG - Intronic
1148213349 17:45821143-45821165 TGGCCTCCAGCAGGGGTTGGTGG - Intronic
1148894703 17:50833029-50833051 GGGCAGCCAGCATGGGCTGGGGG + Intergenic
1148894816 17:50833519-50833541 AGGCACCGAGCAGAGGTTGGGGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150473848 17:65459637-65459659 GGGCTTCCAGCAGAGGTGGGGGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152144602 17:78560832-78560854 GATCTACCAGCAGTGGGTGGCGG - Exonic
1152960979 18:80022-80044 GGGCCCCTAGCAGTGGTTGGAGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155844968 18:30694918-30694940 GTGCAAGCAGCAGTGGCTAGTGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157576432 18:48746827-48746849 GAGACACCAGCAGTGGTTGCAGG - Intronic
1157979280 18:52362408-52362430 CGACCACCAGCATTGGTTGGTGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158868607 18:61662195-61662217 AGGCCAACAGGAGTGGTTGGTGG - Intergenic
1158876626 18:61740179-61740201 TGGCAGCCATCAGTGGTTAGAGG + Intergenic
1160583598 18:79901031-79901053 GGACAAGCAGCAGAGGGTGGGGG - Intergenic
1161414020 19:4134579-4134601 GTGCAACCTGCAGGGGTTTGGGG + Intergenic
1161986151 19:7655604-7655626 GGGCCAGCAGCAGTGGTGGTGGG + Intergenic
1163229708 19:15992981-15993003 GGACAACCAGAAGTGCCTGGAGG - Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164472720 19:28549609-28549631 GGGCAACAAGCAGTGGTTTCAGG - Intergenic
1165131758 19:33636956-33636978 GGGCAACCAGCAGTGGTTGGGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1202701613 1_KI270712v1_random:169374-169396 GCGCAACCAGCAGGGGGTGCTGG + Intergenic
925455735 2:4015232-4015254 GGTTGACCAGCAGTGGTTGCAGG - Intergenic
925670309 2:6303814-6303836 GGACAGACTGCAGTGGTTGGGGG + Intergenic
927155407 2:20218341-20218363 AGGCCACCAGCAGAGGTGGGAGG + Intronic
927189421 2:20506861-20506883 GGCCACCCAGCAGAGGTTCGTGG + Intergenic
927432869 2:23041748-23041770 GGGCAGCCAGCTGTGGCTGCAGG - Intergenic
928176083 2:29035301-29035323 GGGCAACAAGCTGTAGGTGGAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929968451 2:46552808-46552830 GGTCAACCATGAGTGGTGGGAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934568513 2:95353675-95353697 GGGCAAGCAGAAGTGGGTGCAGG + Intronic
935437853 2:103056064-103056086 GAGCAACAAGCAGTGTTTTGGGG - Intergenic
935696649 2:105776451-105776473 AGTCACCCAGCTGTGGTTGGGGG + Intronic
936475843 2:112839067-112839089 CGGCAACCAGCAGGGTCTGGAGG + Intergenic
938768924 2:134483221-134483243 TGGCAACCTTCAGGGGTTGGAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940399790 2:153235124-153235146 GGGCAACTACCTGTTGTTGGTGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940692309 2:156934382-156934404 GGGTAACCAGCAGCCCTTGGTGG + Intergenic
940773109 2:157859409-157859431 GGGCAACCAGCAGCCCTTGGGGG + Intronic
941784744 2:169485034-169485056 AGGCAAACAGAGGTGGTTGGTGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
947317430 2:228876550-228876572 GGGGAGTCAGCAGTGGTTGCTGG - Intronic
947923020 2:233894614-233894636 AAGCAGCCAGCAGTGGGTGGGGG + Intergenic
948284603 2:236773926-236773948 GGGGAACCAGCTGTGGCTGGGGG + Intergenic
1168890270 20:1291172-1291194 AGGCAACCAGCATAGGTTGAGGG - Intronic
1170136492 20:13079893-13079915 GGGCAAACAGCTGTGGCAGGTGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172095541 20:32458398-32458420 GGGCAGCAAGCTGGGGTTGGAGG - Intronic
1172188119 20:33044140-33044162 AGGCAGCCACCAGTGGTAGGGGG - Intergenic
1172941368 20:38656845-38656867 GGGCTACCTGCAGTTGTTGGGGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173593999 20:44247360-44247382 GGGCCACCAGCTGCAGTTGGTGG - Exonic
1173660112 20:44727336-44727358 GGGCCACCAGCTGGGGATGGTGG - Exonic
1174204991 20:48831738-48831760 GGGGAAGCACCATTGGTTGGTGG + Intergenic
1175459114 20:59137728-59137750 TAGCAACCAGCACTGGGTGGAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177676618 21:24308980-24309002 GGCCATTGAGCAGTGGTTGGAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178385815 21:32149470-32149492 GGGCACCCAGCAGTGGCTGTAGG - Intergenic
1179158488 21:38872818-38872840 TAGCAACCAGCAGCAGTTGGAGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179952624 21:44718680-44718702 GGGCAACCAGAAGTCCTTGAAGG - Intergenic
1180108982 21:45638918-45638940 GAGAACCCAGCAGAGGTTGGAGG + Intergenic
1180135410 21:45859133-45859155 GGACAAGCAGCAGGAGTTGGTGG - Intronic
1180258673 21:46651313-46651335 GGGCCACCAGGACTGGCTGGGGG + Intronic
1181415569 22:22756307-22756329 GAGCTACCAGCAGTGCTGGGTGG - Intronic
1181530863 22:23516611-23516633 GGGGAACCTGCAGGTGTTGGAGG + Intergenic
1182796585 22:32995486-32995508 GCACAACCAGCAGTGGCTTGGGG - Intronic
1183325460 22:37188989-37189011 AGCCAACTAGCAGTGCTTGGGGG - Intronic
1184279218 22:43427473-43427495 GGGCAGGCAGCAGGGGTTGGGGG + Intronic
1184479540 22:44738505-44738527 GGGGAACCAGGTGTGATTGGAGG + Intronic
1184488796 22:44797112-44797134 GCTCAACCAGCATTTGTTGGGGG - Intronic
1185280599 22:49968293-49968315 GGGCAAGGAGCAGAGGGTGGAGG + Intergenic
949873295 3:8607489-8607511 GGGCGATCAGCAGTGGCTGCTGG + Intergenic
950708731 3:14800356-14800378 GGGCAAACAAGAGTGGTAGGAGG + Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951382470 3:22000517-22000539 GGGCAACCAACAGCCCTTGGGGG + Intronic
952423158 3:33149161-33149183 GGGGAACCATCAGGGGATGGTGG - Intergenic
952681306 3:36096733-36096755 GGGCAGCCTGCTGTGGATGGCGG - Intergenic
952774621 3:37032798-37032820 AGACAACCAGCAGGGGATGGGGG + Intronic
953427563 3:42807746-42807768 AGGCAACCAGCAGCCCTTGGGGG - Intronic
954137504 3:48588799-48588821 GGGCATACAGCAATGGTTAGGGG + Intronic
954911515 3:54114557-54114579 GGCCAGGCAGCAGTGGTGGGGGG + Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956774162 3:72551068-72551090 GTCCAACCAGCTGTGGGTGGAGG + Intergenic
959380181 3:105632076-105632098 GGGAACCCTGCAGTGGTGGGTGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961900329 3:130203680-130203702 GGGAAACAGGCAGAGGTTGGAGG - Intergenic
962154754 3:132934494-132934516 GTGCAAGCAGCAGTGGTAGGTGG - Intergenic
962192801 3:133329015-133329037 AGGCAGCCTGCAGGGGTTGGGGG - Intronic
962522795 3:136212624-136212646 GGGCCAGCAGCCATGGTTGGGGG + Intergenic
962967670 3:140369703-140369725 GGGCAACAAGCTGGGGGTGGAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
965509849 3:169556297-169556319 GGGCTCCCACCAGTGGATGGTGG + Intronic
967694367 3:192514621-192514643 GGGCATTCTGCAGTGTTTGGGGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970711756 4:18871955-18871977 GGGCAACTAGCAGCCCTTGGGGG - Intergenic
972565686 4:40267081-40267103 GGACAACCAGCAGCCCTTGGGGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975490899 4:74987264-74987286 GTCCAATCAGCTGTGGTTGGAGG + Intronic
976343902 4:83977732-83977754 GGGAAACAAGCAGTGTTTTGGGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978276174 4:106953242-106953264 GGGCAACCAGCATTGAGTGCTGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978656777 4:111074686-111074708 GGGCGACCAGCACTGGCTGCTGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980857874 4:138462245-138462267 GGGCATCCAGAAGGTGTTGGAGG - Intergenic
981509500 4:145540133-145540155 GGTCAACCTGCAGTGGAGGGAGG + Intronic
981667713 4:147248337-147248359 GAGCAAACAGAAGTGGATGGAGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985610648 5:886198-886220 GGGCAGCCAGCATTGGCAGGGGG - Intronic
985717640 5:1471628-1471650 GGGCAACCAGGAGTGGAGGGAGG + Intronic
985996610 5:3600519-3600541 GGGCAGCCGGCAGAAGTTGGTGG + Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988776107 5:34479341-34479363 GGGCAACCAGCAACGGTGTGGGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
991198245 5:63960640-63960662 GGGCAGCCAGCAGAGGATGAAGG + Exonic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995261211 5:110106461-110106483 AGGCAACCAGCAGCTCTTGGGGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
998994117 5:147851872-147851894 GGGCAACCAGCAGAGGAAGAAGG + Intergenic
999324850 5:150637582-150637604 GGGGAACCCGCAGGGGTTGGGGG + Intronic
1001706988 5:173748636-173748658 AGGCAATCCTCAGTGGTTGGGGG + Intergenic
1001739218 5:174035919-174035941 GGCTGACTAGCAGTGGTTGGAGG - Intergenic
1001902866 5:175445466-175445488 GGGCAACCAGGGGAGGCTGGGGG - Intergenic
1002202088 5:177534962-177534984 GGGAAACCAGCACTCATTGGTGG + Intronic
1002636995 5:180613481-180613503 GGGGGAGCAGCAGGGGTTGGGGG - Intronic
1003235095 6:4288483-4288505 GGGCAAACAGCCTGGGTTGGGGG - Intergenic
1003595524 6:7470910-7470932 GGGCAGCCCGCAGTAGGTGGAGG - Intergenic
1003596266 6:7476838-7476860 GGGCAGCCTGCAGTAGGTGGAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006076285 6:31534699-31534721 CGGCACCCAGCGGTGGATGGCGG - Intronic
1007975687 6:46098962-46098984 GGGGAACCAGCACTGGCTGCGGG + Intergenic
1008028247 6:46663328-46663350 GGGCAGACAGCAGTGGTCAGCGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008937150 6:57004420-57004442 GGGCAGCCAGCTGGGGTGGGGGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1011368691 6:86609200-86609222 GGGCAAACTTCAGTGGATGGAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013313090 6:108915788-108915810 GGGCAACAAGGAGCAGTTGGAGG + Intronic
1013364346 6:109424435-109424457 GGGCAAGCAACAGTGCCTGGAGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014685677 6:124497029-124497051 GGGCACCCCGGAGTGGTTAGTGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018762957 6:166906836-166906858 GGGCATGCAGCAGCGGTGGGTGG - Intronic
1020431273 7:8118795-8118817 GGGCAAGCTGCAGGGGTTAGGGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1022712662 7:32866203-32866225 GGGTAATAAGCAGAGGTTGGAGG - Intergenic
1022957891 7:35398398-35398420 GGGCCACCTGCAGAGGTGGGAGG - Intergenic
1023826903 7:44015630-44015652 GGGCGCCCTGCATTGGTTGGTGG - Intergenic
1024853144 7:53744543-53744565 GGGCTAGCAGCAGTGGTGGTGGG - Intergenic
1026189452 7:68111528-68111550 GGACCACCAGCAGTTGGTGGGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029538560 7:101170041-101170063 GGGCAACCCGTGGTGGGTGGAGG - Intergenic
1029738055 7:102475381-102475403 GGGCACCCTGCATTGGTTGGTGG - Intronic
1029755190 7:102569031-102569053 GGGCACCCTGCATTGGTTGGTGG - Intronic
1029773138 7:102668111-102668133 GGGCACCCTGCATTGGTTGGTGG - Intronic
1030190051 7:106801416-106801438 GGGCAACCAGCAGCCTTCGGGGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031030053 7:116724561-116724583 GAGCAGCCTGTAGTGGTTGGAGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032298069 7:130660537-130660559 GGACAACCAGCAATGGTAGCAGG - Intronic
1033311746 7:140266764-140266786 GGGCGAACAGCAGTGGGAGGGGG - Intergenic
1033616526 7:143021787-143021809 GGGTAATGAGCAGAGGTTGGAGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034644598 7:152633888-152633910 GGGCAACCTGGAATGGATGGTGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036247978 8:7136882-7136904 GGGAAACAGGCAGAGGTTGGAGG + Intergenic
1038614662 8:29081316-29081338 GGGTCACCACCAGTGGCTGGTGG - Intronic
1039493634 8:37965549-37965571 GGGCAACCAGCAGAGAGTGAAGG + Exonic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042343568 8:67705063-67705085 GGGCAACCTGGAGGGGCTGGAGG - Intronic
1044540044 8:93398617-93398639 AGGGAACCAGCATTTGTTGGTGG - Intergenic
1044881777 8:96730562-96730584 TGACAACCAGCAGTCTTTGGGGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050643298 9:7692329-7692351 GGGTAACAGGCAGTGGCTGGAGG + Intergenic
1051087292 9:13364446-13364468 GGGCATGCTGCAGTGGTTTGGGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053314551 9:37040699-37040721 GGGCAATCTGCATTTGTTGGGGG + Intergenic
1059443302 9:114323166-114323188 GGGCTTCCAGCAGAGGTAGGAGG - Exonic
1059444494 9:114329937-114329959 GGGCTTCCAGCAGAGGTAGGAGG - Exonic
1061984761 9:134124052-134124074 GGGCAGCCGGGAGGGGTTGGAGG + Intergenic
1062402281 9:136377965-136377987 GGCCACACAGCAGTGGCTGGGGG - Exonic
1062737186 9:138143968-138143990 GGGCCCCTAGCAGTGGTTGGAGG + Intergenic
1187607818 X:20905628-20905650 GGGGAGCCTGCAGGGGTTGGGGG + Intergenic
1188725519 X:33577875-33577897 TGCATACCAGCAGTGGTTGGGGG + Intergenic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1190227700 X:48559042-48559064 AGGGACCCAGCTGTGGTTGGAGG + Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193776834 X:85652808-85652830 GGGTAACTACCAGGGGTTGGGGG - Intergenic
1194919756 X:99750342-99750364 GGGTAATGAGCAGAGGTTGGTGG + Intergenic
1195157120 X:102134826-102134848 GGGAAACCGGCAGTTGATGGAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197331211 X:125155798-125155820 GGGCTGCCAGCAGTGCTTGCGGG - Intergenic
1197888195 X:131239821-131239843 TGGCAGCCACCAGTGGTTAGGGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic