ID: 1165134738

View in Genome Browser
Species Human (GRCh38)
Location 19:33660703-33660725
Sequence AGGCAGGTTAATGCAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165134738_1165134743 13 Left 1165134738 19:33660703-33660725 CCTTGATTTGCATTAACCTGCCT 0: 1
1: 0
2: 2
3: 20
4: 164
Right 1165134743 19:33660739-33660761 GTTTGCATGCAATTGAAAGTGGG 0: 2
1: 2
2: 45
3: 193
4: 393
1165134738_1165134742 12 Left 1165134738 19:33660703-33660725 CCTTGATTTGCATTAACCTGCCT 0: 1
1: 0
2: 2
3: 20
4: 164
Right 1165134742 19:33660738-33660760 AGTTTGCATGCAATTGAAAGTGG 0: 2
1: 1
2: 43
3: 161
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165134738 Original CRISPR AGGCAGGTTAATGCAAATCA AGG (reversed) Intronic
902871220 1:19314660-19314682 AGGCAGGTTAATTCACTTCCAGG + Intronic
904255135 1:29249927-29249949 AGGGAGGTTGAGGCCAATCATGG - Intronic
904469777 1:30729159-30729181 AGTCAGGTTAAAGGAAGTCAGGG - Intergenic
904977142 1:34465407-34465429 AGGCAGGTGCTTGCAAAACATGG + Intergenic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
906562775 1:46771414-46771436 AGGCAGGACAATTCAAAGCAGGG - Intronic
908232586 1:62120726-62120748 TGGCAGGTTTCTGCTAATCAAGG + Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
910526459 1:88184368-88184390 AGGAAGGCTACTGAAAATCATGG + Intergenic
911347555 1:96715484-96715506 AGGCAGGATAATTCAAAGCAGGG + Intergenic
916472565 1:165138291-165138313 GGGCAGCTAAGTGCAAATCAGGG + Intergenic
917912114 1:179660125-179660147 AGGCAGATGAATGAAAATCAGGG - Intronic
920909168 1:210198224-210198246 AGACTGGTAAATCCAAATCAAGG + Intergenic
922152777 1:223019634-223019656 AGGCAGGATAACTCAAAGCAGGG - Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1067440207 10:46304851-46304873 AGGCAGCTGAATGCCACTCACGG - Intronic
1067543747 10:47176827-47176849 AGACAGGTTATTGCACAGCAGGG + Intergenic
1068438469 10:57020306-57020328 AGGCAGGACAATTCAAAGCAGGG + Intergenic
1069377437 10:67807612-67807634 AGGAAGGTTAGTGAAAAACAAGG + Intronic
1073281153 10:102355108-102355130 AGGCAGGTATATGCAGATTAGGG - Intronic
1075046320 10:119149285-119149307 AGGTAGGTCAAAGCCAATCATGG - Intronic
1076996756 11:300857-300879 AGGCAGGACAATGCAAAGCAAGG + Intergenic
1077651049 11:3973066-3973088 AGGCAGGATTATGGAAATCAGGG - Intronic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1081368269 11:42264065-42264087 AGGCAGATTAATGCCAATTGTGG - Intergenic
1087959866 11:104334566-104334588 AGGAGGGATAATGCAAATAAAGG + Intergenic
1088468405 11:110166589-110166611 ATACAGGTTAATGGAAATCTAGG - Exonic
1090159931 11:124481997-124482019 CGGGAGGTTAATGGAAATTAAGG + Intergenic
1094449193 12:30566233-30566255 AGTCAGATTCATGCAAGTCATGG + Intergenic
1094589646 12:31808539-31808561 AGGCAGGACAATGCAAAGCCGGG - Intergenic
1094698790 12:32848057-32848079 AGGCATTTGAATACAAATCATGG + Intronic
1095823795 12:46509907-46509929 AGGCAGGAAAACTCAAATCAGGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1103976498 12:124706022-124706044 AGGCAGCTGAATGCGAAGCAGGG + Intergenic
1106510296 13:30407326-30407348 AGGCAGCTGAATGCAATGCAGGG - Intergenic
1107381271 13:39858837-39858859 AGTCAGGTGAATGAAACTCAAGG - Intergenic
1108840653 13:54610276-54610298 AGGCATGTTAATGTAAATGTGGG + Intergenic
1109828308 13:67753057-67753079 TTGATGGTTAATGCAAATCAGGG - Intergenic
1110348308 13:74475426-74475448 AGGCAGCTTTTTGCAACTCATGG + Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1112576857 13:100643912-100643934 AGGCAGTTTAATGAGAGTCACGG - Intronic
1113111982 13:106833338-106833360 AGCCAGAATACTGCAAATCATGG - Intergenic
1115452302 14:33561796-33561818 AAGCAGGTAAATGCTAATTAGGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116331820 14:43606145-43606167 GTGCATGTAAATGCAAATCATGG - Intergenic
1116751906 14:48896928-48896950 AGGCAGGTTAATGAAGAGCCTGG + Intergenic
1118370868 14:65136189-65136211 CAGCAGGTTTTTGCAAATCAGGG + Intergenic
1120814880 14:88845733-88845755 TGGAAGATTAATGCATATCAGGG + Intronic
1121901012 14:97693562-97693584 AGGCACATAAATGCACATCATGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1124822337 15:33058737-33058759 ATGCAGGTTATTACAAATTACGG - Intronic
1124998872 15:34751471-34751493 ACACAGGTAAATTCAAATCATGG + Exonic
1125140952 15:36407235-36407257 AGCCAGGTTAATGGATATGATGG - Intergenic
1126613135 15:50549716-50549738 AGTCAAGTTCATGAAAATCAAGG - Intergenic
1129366390 15:75058172-75058194 AAGGAGGTAAATGCAAATAAGGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1133440763 16:5819157-5819179 AGGCTGGGAAGTGCAAATCAAGG + Intergenic
1134204812 16:12228607-12228629 AGGCAGGGTTTTGCAAGTCATGG - Intronic
1134340715 16:13342753-13342775 AAGCAGGTGATTGCAAATAATGG - Intergenic
1135226143 16:20659927-20659949 AGGCAGGACAATGCAAAGCGGGG - Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139042265 16:63012190-63012212 AGGCAGGCTAATTAAATTCAAGG - Intergenic
1141053542 16:80795120-80795142 AGACAAGGTAATGAAAATCAAGG + Intronic
1143738174 17:8928977-8928999 AGGCAGGTAAAGGGAAATAAAGG + Intronic
1144931041 17:18858625-18858647 AGCCAGGTAAATTAAAATCAGGG - Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1150658688 17:67057193-67057215 AGGCAGAAGAGTGCAAATCATGG - Intergenic
1153787194 18:8545523-8545545 AGTCAGGGTAATGAAAGTCAAGG + Intergenic
1155851248 18:30777286-30777308 GAGCAGGTAAATGCAAAGCAAGG + Intergenic
1156500151 18:37552393-37552415 AGGCAGGTTTCTGCAGAGCAGGG - Intronic
1156732571 18:40212158-40212180 AGGCAAGATAATGCAAATGAAGG - Intergenic
1158864571 18:61625787-61625809 AGGCAGGATAATGCAAAGCGGGG - Intergenic
1159954572 18:74510251-74510273 AGGCAGGCTAAAGAACATCAGGG - Intronic
1164739017 19:30563172-30563194 GGGCAGGTTATTATAAATCATGG + Intronic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
925345421 2:3168697-3168719 AGGCAGGATGATGCAGCTCATGG - Intergenic
925746053 2:7044699-7044721 AGTGAGGTGAATGAAAATCAAGG - Intronic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
937874328 2:126809832-126809854 AGCCAGGTTAAAGCCCATCAAGG - Intergenic
939410462 2:141818323-141818345 AGGCAGGTGAATGTAAAGGAAGG - Intronic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
945114675 2:206399758-206399780 AGGCAGGATAACTCAAAGCAGGG + Intergenic
946132235 2:217615611-217615633 AGGCAAGTTCCTGGAAATCATGG + Intronic
948583008 2:239000690-239000712 GGGGAGGGGAATGCAAATCAGGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1175618187 20:60421109-60421131 AGCCAGGGTAATGCAGATGACGG + Intergenic
1177233545 21:18355400-18355422 AAGCAGGTTAATGGAATTCAAGG - Intronic
1179541352 21:42085161-42085183 AGGGAGGTAAATGCAGAGCAGGG + Intronic
952521377 3:34161497-34161519 TGGCAAGTGAATGCAAATGATGG + Intergenic
954393906 3:50282387-50282409 AGGCAGTTTCAAGTAAATCATGG + Intronic
956570168 3:70685600-70685622 AGGCACTGGAATGCAAATCATGG + Intergenic
957386295 3:79501073-79501095 AGGCAGGGTATGGCAAACCATGG + Intronic
959090798 3:101900539-101900561 AGTCAGGTTATTGCAAATGGAGG + Intergenic
960040823 3:113148453-113148475 AGGATGGTTAATGCAAAGCTTGG - Intergenic
960454219 3:117850570-117850592 AGGTAGGATAATGCAAAACAGGG - Intergenic
960823934 3:121762584-121762606 AGGCTGATTAATACAAATGAAGG + Intergenic
962242007 3:133757564-133757586 AAGCAGGTTCAGGCAAATCGCGG + Intronic
963336745 3:143984038-143984060 AGGCTGGTTAATGCAGTTTAAGG - Intronic
964314065 3:155424721-155424743 AGGCTGGTTAATGTAGATAATGG - Intronic
965612641 3:170561057-170561079 AGGCAGGTTGCTCCCAATCAGGG - Intronic
966047824 3:175574358-175574380 AGGCCTGTTTATGCAAATGAAGG + Intronic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
970522943 4:16903735-16903757 AGGCAGGTAAATGGAAATTAGGG - Intergenic
971588649 4:28438260-28438282 AGACAGGTTAATGAAGAACAGGG - Intergenic
975441252 4:74413547-74413569 AGGCAGGTCAAGGCAAGGCAAGG - Intergenic
975441256 4:74413567-74413589 AGGCAGGTCAAAGCAAGGCAAGG - Intergenic
975441259 4:74413587-74413609 AGGCAGGTCAAGGCAAGGCAAGG - Intergenic
976782842 4:88780197-88780219 ATACAGGTAAATGCAAATCTAGG - Intronic
977047040 4:92080369-92080391 AGGCAGAATAAAGCATATCAGGG + Intergenic
977059925 4:92244816-92244838 AGCCAGGTAAATGCAATTTATGG - Intergenic
977066406 4:92321668-92321690 AGGCAGTCTAATGAATATCAAGG + Intronic
978003876 4:103592680-103592702 AGTCAGATTAAAACAAATCAGGG + Intronic
978219091 4:106247559-106247581 AAGCAGGTGAATGCTAGTCAGGG - Intronic
978386045 4:108176161-108176183 AGGGAGATTAATGCAGAACAAGG + Intergenic
978646717 4:110942042-110942064 AGCCAGCTTAATCCAATTCAGGG + Intergenic
980137169 4:128869597-128869619 AGGCAGGTTTTTGCATTTCATGG + Intronic
980733942 4:136857931-136857953 GGGCAGGTTACTGGAAATGAGGG - Intergenic
982687440 4:158508052-158508074 CATCAGGTAAATGCAAATCAAGG + Intronic
983764263 4:171457835-171457857 AGATAGGTTAAAGCAAATAAAGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985276630 4:188243919-188243941 AAGCAGGTTTAAGCAAATGAAGG - Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
986646843 5:9925114-9925136 TGGCACATTACTGCAAATCATGG + Intergenic
987893463 5:23913970-23913992 AGGATGGTTATTGCAATTCAAGG + Intergenic
989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG + Intergenic
992155649 5:73952863-73952885 AGGCAGCTTAATGAAAGACAAGG + Intergenic
995533276 5:113111532-113111554 AGGCAGATTAATAAAAATAAGGG - Intronic
996333170 5:122354189-122354211 AGGAAGATTAATGTGAATCAAGG - Intronic
997050546 5:130374517-130374539 AGGCTGGAAACTGCAAATCAAGG - Intergenic
998503843 5:142656383-142656405 AGGCATGTAAATGGAAAACAAGG - Intronic
999874412 5:155786588-155786610 AGTCAGGTTAAGGCAAAATATGG + Intergenic
1000454009 5:161426391-161426413 AGGGTGGTACATGCAAATCAGGG + Intronic
1002570216 5:180135951-180135973 AGGCAGGGACCTGCAAATCAGGG - Intronic
1004752528 6:18577711-18577733 AGGCATGTCATTGCCAATCAAGG - Intergenic
1007258448 6:40545053-40545075 AGCCAGAGTATTGCAAATCAGGG + Intronic
1007514078 6:42397466-42397488 AGGCAGGTGAAAGCCATTCAGGG - Intronic
1009472066 6:64039367-64039389 AGGCATGGTATTGCAAAGCAAGG + Intronic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010892210 6:81327149-81327171 AGACTGGTGAATGGAAATCAGGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1019081787 6:169437162-169437184 TGGCAGGTCTAAGCAAATCATGG + Intergenic
1020264144 7:6549211-6549233 TGGCAGGTTCCTGCAAATCAGGG + Intronic
1022084337 7:27051767-27051789 AGGAATGTTAAAGCAAATTATGG + Intergenic
1022985425 7:35649620-35649642 AGGCAGGATAACTCAAAGCAGGG + Intronic
1023129899 7:36992247-36992269 AGTCCTGTGAATGCAAATCATGG - Intronic
1023739306 7:43264396-43264418 ATCCAGGTTATTGCAAATAACGG + Intronic
1023990439 7:45125413-45125435 AGGCAGGTTCCGGCAAATGAAGG + Intergenic
1025288756 7:57692873-57692895 ATACAGATTAATGCAAATAAAGG - Intergenic
1026076809 7:67179167-67179189 GGGCAGGCCAATGCAAATAAAGG + Intronic
1026143058 7:67722557-67722579 GGGCAGGTTGAGGCAAATAAGGG - Intergenic
1026700053 7:72633172-72633194 GGGCAGGCCAATGCAAATAAAGG - Intronic
1027393427 7:77727860-77727882 ATGCTGTTTAATGCAGATCAGGG + Intronic
1028716189 7:93972506-93972528 TGGAAGGTTGATTCAAATCAAGG + Intronic
1029292947 7:99516576-99516598 AGGCAGGTCTGTGCAAGTCAAGG + Intronic
1029855418 7:103510850-103510872 AGGCTGGATTATGCAATTCAAGG - Exonic
1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG + Intronic
1031559105 7:123216149-123216171 AGGCAGAGTAATGCAGATTATGG - Intergenic
1034392356 7:150796554-150796576 AGGCAGGATGACGCAAAACACGG - Exonic
1041144772 8:54862383-54862405 AATCAGGGTAATGCAAATTAGGG - Intergenic
1042389439 8:68216390-68216412 AGGGAGGTAAATGCAAAATAAGG + Intronic
1042586482 8:70344757-70344779 AGTCAGGATTATGTAAATCAAGG + Intronic
1044851322 8:96431731-96431753 TGGCAGGTGAAGGCAAAGCAAGG - Intergenic
1051751478 9:20346707-20346729 AGACAGTTTAATGCTATTCATGG - Intronic
1054740153 9:68798123-68798145 AGGAAGTTTAATTCAAATCTGGG - Intronic
1055037664 9:71835679-71835701 AGGAAGATTAATGTAAAGCAAGG - Intergenic
1055184388 9:73433102-73433124 AGGCATGTTAAAACAAAACAAGG - Intergenic
1056072124 9:82998312-82998334 AGGCTTGTTAATGCAAACCCAGG + Intronic
1058310618 9:103497056-103497078 GGTCAGGCCAATGCAAATCAAGG + Intergenic
1058333294 9:103792299-103792321 AGTCAGGGAAATGCAAATTAAGG - Intergenic
1186814479 X:13222768-13222790 CTGCAGGTTAATTCACATCAGGG + Intergenic
1188496763 X:30790318-30790340 AGGCAAGGCAAGGCAAATCAAGG - Intergenic
1188497761 X:30797136-30797158 AGGCAAGGCAAGGCAAATCAAGG - Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191882552 X:65857343-65857365 AGGCAGGTGTAAGCACATCAGGG + Intergenic
1195210312 X:102647987-102648009 AGGCAGGTTTATACATATCCAGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196249215 X:113439416-113439438 AAGCAGCTTAATGCATCTCAAGG + Intergenic
1198894864 X:141442471-141442493 AGCCAGGTAAATGAAAATGATGG - Intergenic