ID: 1165134853

View in Genome Browser
Species Human (GRCh38)
Location 19:33661439-33661461
Sequence CTTGTGGAGGTCACCTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165134842_1165134853 16 Left 1165134842 19:33661400-33661422 CCCAGTGGGATTTTCACCCGAGT 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG 0: 1
1: 0
2: 0
3: 12
4: 98
1165134845_1165134853 0 Left 1165134845 19:33661416-33661438 CCCGAGTCCTCTGTCTCTGGTCC 0: 1
1: 4
2: 11
3: 131
4: 427
Right 1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG 0: 1
1: 0
2: 0
3: 12
4: 98
1165134846_1165134853 -1 Left 1165134846 19:33661417-33661439 CCGAGTCCTCTGTCTCTGGTCCC 0: 1
1: 0
2: 31
3: 160
4: 593
Right 1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG 0: 1
1: 0
2: 0
3: 12
4: 98
1165134847_1165134853 -7 Left 1165134847 19:33661423-33661445 CCTCTGTCTCTGGTCCCTTGTGG 0: 1
1: 0
2: 2
3: 24
4: 283
Right 1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG 0: 1
1: 0
2: 0
3: 12
4: 98
1165134843_1165134853 15 Left 1165134843 19:33661401-33661423 CCAGTGGGATTTTCACCCGAGTC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG 0: 1
1: 0
2: 0
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165134853 Original CRISPR CTTGTGGAGGTCACCTTTAT GGG Intronic
902984638 1:20148181-20148203 CTTGTTGAGGTCACCTACAGGGG - Exonic
906194600 1:43921873-43921895 CTTGAGGTGGTGACCTTGATGGG - Intronic
906621957 1:47289114-47289136 CTTGTGAAGGTTAACTTTGTGGG - Intronic
914931128 1:151934449-151934471 CTTGTGGAGGTCAGAATAATGGG - Intergenic
920503245 1:206498769-206498791 CATGGGGAGCTCACCTCTATGGG + Intergenic
920647436 1:207813912-207813934 CTTGTGCTGGTCACTTTTTTTGG - Intergenic
924810254 1:247394665-247394687 CTCTTGGAGGTCTCTTTTATAGG + Intergenic
1063417679 10:5887753-5887775 CTTGTTCAGGTCACCTTCAGGGG - Intronic
1064168614 10:13008215-13008237 CTTGTGGATGTTACCCCTATTGG - Intronic
1071919442 10:90332633-90332655 CTTCTGCAGATCACCTTTATGGG - Intergenic
1074436307 10:113437203-113437225 CCAGTGGAGGGCACCTTTGTTGG + Intergenic
1075560513 10:123464835-123464857 CTTGAGGAGTTCACCTTTTAAGG - Intergenic
1078541191 11:12214479-12214501 CTTCTGGTGGTCACTTTTAGGGG + Intronic
1078920587 11:15826673-15826695 CATGGGGAGGTCCCCCTTATGGG + Intergenic
1080144472 11:28964250-28964272 CTCTTGGAGGTCACCTTCAAAGG + Intergenic
1080451914 11:32384868-32384890 CTTGTGGAAGTCACCAACATAGG + Intergenic
1082280775 11:50268795-50268817 CTTGGGGAGGGTACCTTTCTGGG + Intergenic
1088095897 11:106101265-106101287 CCTCTGCAGGTCACCTTTAGGGG + Intergenic
1089592968 11:119556550-119556572 CTTGGGGAGGGCACTTTAATGGG + Intergenic
1092233419 12:6790878-6790900 CTTGTGGTGGACATTTTTATCGG + Intronic
1092837870 12:12508696-12508718 CTTTTGGAGGTGTCATTTATGGG - Intronic
1092974470 12:13730942-13730964 ATTGTGGTGGTCAGCTGTATAGG - Intronic
1096091402 12:48904237-48904259 CTTCTGGAAGTCCCCTTTCTAGG + Exonic
1096181028 12:49550399-49550421 CTTGTGGAGGTCCCCTCTCCAGG - Intronic
1098209062 12:68143405-68143427 CCTCTGAAGGTCACCTTAATTGG + Intergenic
1103606151 12:122087438-122087460 CTGGGGGAGGTGACCTTTCTGGG + Intronic
1104221179 12:126786462-126786484 CTGTTTGAGGTCACCTTTCTGGG + Intergenic
1104455338 12:128906946-128906968 CTTGTGGAGCTCACCTGTACAGG - Intronic
1105995116 13:25663785-25663807 TTTGTGGAGGTCTCCTCAATAGG + Intronic
1108412424 13:50163237-50163259 ATTGTGGAGGTCACATTTGTAGG + Intronic
1109318812 13:60784353-60784375 CTTTTGAAGGACACCTTTCTAGG + Intergenic
1109332707 13:60949781-60949803 CAGATTGAGGTCACCTTTATGGG - Intergenic
1121436487 14:93923987-93924009 CTTCTGGAGCTCACCTGGATGGG + Intronic
1121463305 14:94098500-94098522 CTTGTGAATGTGACCTTAATTGG - Intronic
1123068787 14:105631095-105631117 CTTGTGGAGAGCACATTTAGTGG - Intergenic
1123072941 14:105651053-105651075 CTTGTGGAGAGCACATTTAGTGG - Intergenic
1123092865 14:105749822-105749844 CTTGTGGAGAGCACATTTAGTGG - Intergenic
1123098343 14:105776922-105776944 CTTGTGGAGAGCACATTTAGTGG - Intergenic
1125711988 15:41794587-41794609 TTTGTGGAGAACAACTTTATTGG + Intronic
1128405941 15:67338969-67338991 CTTGAGGAAGTGACCTTTACTGG - Intronic
1130272580 15:82459709-82459731 CTTGTGTAAGTCACTTTTCTTGG + Intergenic
1130464932 15:84187062-84187084 CTTGTGTAAGTCACTTTTCTTGG + Intergenic
1130487756 15:84407742-84407764 CTTGTGTAAGTCACTTTTCTTGG - Intergenic
1130499333 15:84486475-84486497 CTTGTGTAAGTCACTTTTCTTGG - Intergenic
1130587222 15:85191676-85191698 CTTGTGTAAGTCACTTTTCTTGG + Intergenic
1133025035 16:2985437-2985459 TTTGTAGAGGTCACCTTTGCTGG + Intergenic
1135829483 16:25760846-25760868 CTTCTAGAGGTCACTGTTATGGG - Intronic
1135869752 16:26138387-26138409 ACTGTGGAGGTCACCTCTGTTGG - Intergenic
1137220584 16:46445849-46445871 CTGGTGGAGGTCAAATTTAGAGG - Intergenic
1141480089 16:84300561-84300583 CTTGTGAATGTGACCTTTTTTGG + Intronic
1141597417 16:85105967-85105989 CTTGGGTAAGTCACCTTTCTTGG + Intronic
1141833572 16:86523422-86523444 CTTGGGGAGGTTACCTTTACTGG + Intergenic
1142933955 17:3311593-3311615 CTTGTGGGGGCCACCTTCATAGG + Intergenic
1145060770 17:19731844-19731866 CTCGAGGAGCTCACCTTGATGGG - Intergenic
1148464257 17:47855610-47855632 TTTGTGGAGGTCCCCTGTACTGG + Intronic
1150902242 17:69293431-69293453 CTTGTGAAGGTTAATTTTATGGG + Intronic
1153932075 18:9887360-9887382 CTTGGGGAGGTCACCCTCCTTGG - Exonic
1153932126 18:9887540-9887562 CTTGGGGATGTCACCCTTCTTGG - Exonic
1154402584 18:14055332-14055354 TTTGTGGAAGTCCCCTTTAAAGG - Intergenic
1156494933 18:37519426-37519448 CTTCTGCAGGTCATCTTTCTTGG + Intronic
1161451937 19:4351048-4351070 CTTGTGGAGGTGACCTCTCTGGG - Intronic
1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG + Intronic
925710953 2:6739765-6739787 CTTGTGGAGGTCACCGCCAGAGG - Intergenic
929744866 2:44646359-44646381 GTTCTGAAGGTCACCTTAATAGG + Intronic
929823915 2:45295353-45295375 CTTGTGGAAATCTCCTCTATTGG - Intergenic
930365630 2:50435915-50435937 CATGTGGAGGTTACCTATATAGG - Intronic
932408210 2:71528372-71528394 TTTGTGGAGGTCAGCTTTGCGGG + Exonic
938386886 2:130872971-130872993 CCTGTGGAGCACACCTTTAGAGG + Intronic
939700006 2:145379176-145379198 CTTGTTGAACTCACCTTTACTGG - Intergenic
944035352 2:195288734-195288756 TTTATGGAGGACACTTTTATGGG - Intergenic
946889006 2:224254896-224254918 CTTCTAGAGGTCACCAATATTGG + Intergenic
947081300 2:226400142-226400164 CTTGTGGAGGTATGCTTCATTGG - Intergenic
947281319 2:228458936-228458958 CTTGTTGAGGTTCCCTTTGTAGG + Intergenic
1169529089 20:6465097-6465119 ATTATTGAGGTCACCTATATGGG - Intergenic
1179574891 21:42301774-42301796 CTTGTGGGGCTGACCTTTTTGGG + Intergenic
949946696 3:9195325-9195347 CTTGTGGTGGTCACGTTTTTAGG - Intronic
955097315 3:55812252-55812274 GTTGTCGAGGTCCCCTCTATGGG - Intronic
956979771 3:74622318-74622340 CTTGTGAATGTCACCTTATTTGG + Intergenic
959585227 3:108019558-108019580 CTTGTGGTGGTGACCTTATTTGG - Intergenic
960297767 3:115964879-115964901 TTTGTGGAGGTCTTCTTTAATGG - Intronic
962228127 3:133633462-133633484 CTTGAGGTGCTCACCTTTAGAGG - Intronic
963580588 3:147122248-147122270 CTTGTGGAGCTGACCTTCTTTGG + Intergenic
968898144 4:3417084-3417106 CTCGGGGAGGTCACCTTTTTTGG - Exonic
986112021 5:4728678-4728700 CTTGTGGAATTCTTCTTTATGGG + Intergenic
988260302 5:28877941-28877963 ATTTTGGATGTCACCTTTTTGGG - Intergenic
991060796 5:62373562-62373584 ATTGATGATGTCACCTTTATAGG - Intronic
997181062 5:131829680-131829702 CTTGTGAAGGTGACCTTATTTGG + Intronic
998218347 5:140254552-140254574 CTTGTTGAAGTCACCTTGAATGG - Intronic
1000647309 5:163774149-163774171 CTTTTGGAGGTCACATTTTCAGG - Intergenic
1007370095 6:41421181-41421203 CAAGTGGAGGGCACCTTTCTGGG - Intergenic
1008154217 6:47994110-47994132 CTTCTGGTGGTGACTTTTATTGG + Intronic
1012458502 6:99433177-99433199 CTTGTGAAGACCACCTTTTTAGG - Exonic
1014100700 6:117508737-117508759 AGTGTGGAGGTCACCTTTCAAGG - Intronic
1030505636 7:110418417-110418439 CTTTGGGAGCTCACCTTTGTAGG - Intergenic
1032999423 7:137487047-137487069 CTGGTGCAGTTCACATTTATGGG + Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035289531 7:157828862-157828884 CCCTTGGAGGTCACTTTTATAGG - Intronic
1039138869 8:34360017-34360039 CTTGAGGAGGTTCCCTTTGTAGG + Intergenic
1042685574 8:71435705-71435727 ATTGTGTAGATCCCCTTTATAGG - Intronic
1043476649 8:80611717-80611739 CATGAGGAGGTCACCTGTTTGGG + Intergenic
1047340483 8:123976055-123976077 TTTGTGGAGGTCTCCTTTGCTGG + Exonic
1049626567 8:143625656-143625678 CTGGTGAAGGTGACCTTTTTGGG + Intergenic
1051339625 9:16099598-16099620 CTTGTGGAAGGCACCTTTGTAGG + Intergenic
1051543424 9:18247459-18247481 CTTGTGGAGTTTACCTTGAAGGG + Intergenic
1057209166 9:93190305-93190327 CCTGTGCAGGTCACCGTCATGGG + Intronic
1057846206 9:98526679-98526701 CTTGTGTTGGTCACCATTCTAGG - Intronic
1190971474 X:55353149-55353171 CTTGTTGATGTCATCTCTATTGG + Intergenic
1197374521 X:125665352-125665374 CTTATGGGGGTTACCTTTGTAGG - Intergenic
1198626961 X:138586977-138586999 CCTGTGGAGGTTCCCTTTGTAGG + Intergenic
1202370304 Y:24191626-24191648 CTTGTGTAAGTCACCTTTCTTGG - Intergenic
1202500480 Y:25478491-25478513 CTTGTGTAAGTCACCTTTCTTGG + Intergenic