ID: 1165135666

View in Genome Browser
Species Human (GRCh38)
Location 19:33666891-33666913
Sequence CCAGTTTCATTATGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18880
Summary {0: 1, 1: 4, 2: 105, 3: 1705, 4: 17065}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165135663_1165135666 12 Left 1165135663 19:33666856-33666878 CCATGCCTGGCTAATTTTAGTAT 0: 54
1: 20041
2: 47574
3: 93945
4: 120617
Right 1165135666 19:33666891-33666913 CCAGTTTCATTATGTTGCCCAGG 0: 1
1: 4
2: 105
3: 1705
4: 17065
1165135664_1165135666 7 Left 1165135664 19:33666861-33666883 CCTGGCTAATTTTAGTATTTTTA 0: 214
1: 75138
2: 132874
3: 97209
4: 67284
Right 1165135666 19:33666891-33666913 CCAGTTTCATTATGTTGCCCAGG 0: 1
1: 4
2: 105
3: 1705
4: 17065

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165135666 Original CRISPR CCAGTTTCATTATGTTGCCC AGG Intronic
Too many off-targets to display for this crispr