ID: 1165136486

View in Genome Browser
Species Human (GRCh38)
Location 19:33673100-33673122
Sequence GCCCAGGGCTGTGTGGTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 348}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165136479_1165136486 0 Left 1165136479 19:33673077-33673099 CCAGATGTGGAACCTCTGACCCA 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1165136486 19:33673100-33673122 GCCCAGGGCTGTGTGGTCCGTGG 0: 1
1: 0
2: 5
3: 42
4: 348
1165136477_1165136486 17 Left 1165136477 19:33673060-33673082 CCAGAAGGAGTAGGAGTCCAGAT 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1165136486 19:33673100-33673122 GCCCAGGGCTGTGTGGTCCGTGG 0: 1
1: 0
2: 5
3: 42
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165136486 Original CRISPR GCCCAGGGCTGTGTGGTCCG TGG Intronic
900124364 1:1062925-1062947 GCCAGGGGCTGTGGGGTCCCAGG - Intergenic
901240947 1:7692859-7692881 GCCCTGGGCTGTGAGTTCCTGGG - Intronic
901705170 1:11067935-11067957 GCCCTGCGTGGTGTGGTCCGTGG - Intronic
901858102 1:12057144-12057166 GACCAGGGCTGTCTGGTTCTAGG + Intergenic
902374494 1:16023907-16023929 GCCATCGGGTGTGTGGTCCGAGG + Exonic
902481970 1:16716924-16716946 GGACAGGGCTGTGTGGGTCGGGG - Intergenic
902510600 1:16965064-16965086 TCCCAGCACTGTGGGGTCCGAGG - Intronic
903329476 1:22589889-22589911 GGCCAGGGCTGTGTGGTTTTGGG - Intronic
903662336 1:24985764-24985786 GCCCAGCACTGTGTGGTATGCGG + Intergenic
903750245 1:25616934-25616956 GGCCAGGGCTGCGCGCTCCGCGG + Intergenic
903986955 1:27235126-27235148 GCGGAGGGCAGAGTGGTCCGGGG + Intronic
904593576 1:31628819-31628841 GCCCAGGGCTATCTGGCCCAGGG + Intronic
904806141 1:33133737-33133759 GCCCAGTGTTGTGTGGGCCAAGG - Intergenic
905274296 1:36807120-36807142 GCCCAGGGCTGTAGGGTCCTGGG + Intronic
905703797 1:40039831-40039853 GCCCAGGGCTGGGTGGGCTCAGG - Intergenic
906140579 1:43531500-43531522 GCCCGGGGCTGGGGGGTCTGAGG - Intronic
907623102 1:56001842-56001864 GCCTAGGGCTGTGGGGACCAAGG - Intergenic
908241849 1:62194971-62194993 GCCCAGGCGCGTGGGGTCCGGGG + Intronic
908241883 1:62195051-62195073 GTCCAGGGGCGTGGGGTCCGGGG + Intronic
910944958 1:92580755-92580777 GCCCAGGGCTTTGATGTCTGGGG + Intronic
912277466 1:108273979-108274001 GCCCAGGGCAGTGTGCTTCAGGG + Intergenic
912290762 1:108420379-108420401 GCCCAGGGCAGTGTGCTTCAGGG - Intronic
914195979 1:145448385-145448407 GCCCAGGGCTTTGGGGTTCTGGG + Intergenic
915543198 1:156581777-156581799 GCCCAGGGCCCTGTGGTACCAGG - Exonic
917626504 1:176851705-176851727 GCCCAAGGCTGCCTGGTCCAAGG - Intergenic
918300393 1:183198740-183198762 GCCTAGGGCTGTGTGGGAGGAGG - Intronic
919743675 1:200995327-200995349 GCCCAGGGCTGTGGGGATCTGGG + Intronic
922037045 1:221858963-221858985 GCCAAGGGCTGTGTCATCCCTGG + Intergenic
922597565 1:226825737-226825759 GTCCATGGCTCTGTGGTGCGGGG - Intergenic
922821538 1:228488371-228488393 GGCGAGGGCTGGGTGGCCCGGGG - Intronic
923678598 1:236100992-236101014 GCCCAGGGCTGTGGGAAGCGCGG - Intergenic
1062926785 10:1322037-1322059 GTCCAGGGCTGGGTGGTCAGAGG - Intronic
1066188767 10:33036767-33036789 GGCCAGGGCTGTGTGCTCAGTGG + Intergenic
1067199549 10:44155572-44155594 GCCCCGAGCTGTGTGGGCCTAGG + Intergenic
1069653567 10:70070107-70070129 ACTCAGGGCTGTGAGGTCCCTGG - Intronic
1069878450 10:71577330-71577352 GCACAGTGCTGTGTGGGCCATGG + Intronic
1069892709 10:71661993-71662015 GCCCTGGGCTGCGTGGGCCCAGG + Intronic
1071290564 10:84185841-84185863 GCCCAGGGCTCTGGGGACAGTGG + Intergenic
1071290572 10:84185865-84185887 GCCCAGGGCTCTGGGGACAGTGG + Intergenic
1073145281 10:101276749-101276771 CCCCAGGGCTGTGGGATCCAGGG - Intergenic
1073240646 10:102055820-102055842 GACCGGGACCGTGTGGTCCGAGG + Intronic
1073890762 10:108097581-108097603 GGCCTGGGCTGTGTGTTCCATGG - Intergenic
1074032396 10:109701824-109701846 ACCCAGGGGTGTGTTGTCCCTGG + Intergenic
1075216920 10:120544465-120544487 GACCAGGGCTCTGTGTTGCGGGG - Intronic
1075643880 10:124084969-124084991 GCCCCGGGGAGTGTGGGCCGAGG - Intronic
1076326394 10:129626628-129626650 GCCCAGGGCCGTGCTCTCCGTGG + Intronic
1076692027 10:132228711-132228733 GCGCAGGGCTCTGTGCTCAGTGG - Intronic
1076873858 10:133206500-133206522 GGCCTGGGCAGTGTGGTCTGGGG - Intronic
1078840902 11:15074848-15074870 GCACAGAGCTGTCTGGTCCTAGG - Intronic
1081453353 11:43195087-43195109 CCCCAGGGCTGTGTAGTACAGGG - Intergenic
1081804942 11:45885509-45885531 GCCCAGGGCCGCGGGGGCCGTGG + Intergenic
1082989881 11:59198078-59198100 GCGCATGCCTGTGTGGTCCCTGG - Intronic
1083319700 11:61838218-61838240 GCTTTGGGGTGTGTGGTCCGGGG + Intronic
1083477310 11:62922787-62922809 GCCCAGGGCTCTGGAGTCTGGGG + Intergenic
1083658113 11:64239870-64239892 GCCCAGGGCTGAGTGGTTTGGGG + Intergenic
1083860749 11:65418697-65418719 GCCCAGCTCTGTGGGGTCCCAGG - Intergenic
1084063395 11:66689927-66689949 CCCCAGGGATGTGTCCTCCGCGG - Exonic
1084268943 11:68019017-68019039 TCCCCGGGCTGTGTGGCCCTGGG + Intronic
1084428949 11:69100858-69100880 GCCCAGGGTTGGGGGGTCCATGG + Intergenic
1085458951 11:76681617-76681639 GCCCAGGGCTGAGGGGCCAGAGG + Intergenic
1085772852 11:79340306-79340328 GCCCAGGGAGGTGGGGTCAGGGG + Intronic
1087443013 11:98208794-98208816 GGCCAGAGCTATGTGCTCCGTGG - Intergenic
1089581109 11:119482536-119482558 GCAGTGGGCTGTGTGGTCCAGGG + Intergenic
1090355908 11:126140256-126140278 GCCCAGGGCTGTGTGGAGTCTGG + Intergenic
1091774996 12:3178793-3178815 GCCCTTGGCTGTGTGGTTTGAGG + Intronic
1091825784 12:3511667-3511689 GCTCTGGGCTGTGTGGGCCTGGG + Intronic
1092966453 12:13648266-13648288 GCCCAGGGCTGAGTGCTGTGAGG + Intronic
1093766871 12:22973723-22973745 GCCCACCGCTGTGTGGGCAGGGG + Intergenic
1094486285 12:30928019-30928041 GCCCAGAGCTGTTTGGTTTGTGG + Intronic
1095873031 12:47051171-47051193 GCACAGGGCAGTGGGGTCCTGGG + Intergenic
1096080032 12:48827059-48827081 GCCAGGGGCTGGGTGGTGCGTGG - Exonic
1096520146 12:52180460-52180482 GCCCAGAGCTGGCTGGTCCATGG - Intronic
1096547906 12:52353896-52353918 TCCCAGGGTGGTGTGGTCTGCGG + Intergenic
1103562644 12:121800422-121800444 GCCCAGAGCTGGGTGGGCAGCGG + Intronic
1104310977 12:127654055-127654077 GCACATGGCTGTGTGGTTTGTGG - Intergenic
1104981080 12:132573383-132573405 GCCCAGGGGTGCCTGGTCCTCGG - Intronic
1105019429 12:132806001-132806023 CCGCAGTGCTGTGTGGTCCCAGG + Intronic
1106075782 13:26459718-26459740 GCCAAGGGCTCTGTGGTCCCAGG - Intergenic
1106410497 13:29508012-29508034 GCCCAGGTCTGTGTGGTGTAAGG + Intergenic
1106422564 13:29595736-29595758 GGCCGGGGCTGCCTGGTCCGGGG - Intergenic
1106786671 13:33114281-33114303 GCCCCAGGCTTTGTGGTCCTGGG + Intronic
1112338870 13:98536725-98536747 GCCCAGTGCTCTGGGGTCCCGGG + Intronic
1113175492 13:107558944-107558966 GCTCAGTGCTGTGGGGTCAGTGG + Intronic
1113677449 13:112216291-112216313 GCCCAGGGGATTGTGGGCCGGGG + Intergenic
1113769533 13:112899257-112899279 CCCCTGGGCTTTGTGGTCCTGGG - Intronic
1113779310 13:112967049-112967071 GCCTAGGGCCGTGTGGGCTGAGG + Intronic
1113971542 13:114195102-114195124 GCCCAGGGCTGTGGGGCCACTGG - Intergenic
1115733286 14:36295734-36295756 GCCCAGGGCTTTGGGCTCCGTGG - Intergenic
1117546597 14:56798416-56798438 TCCCAGGGCGCTGTGGGCCGCGG - Intergenic
1118225651 14:63896647-63896669 GCCCAAGGCCGAGTGGTCAGTGG + Intronic
1118725913 14:68628845-68628867 GCCCGAGGCTGTGCGGTCGGGGG - Intronic
1119215988 14:72869418-72869440 GCCCAGTGCACTGTGGTCTGGGG + Intronic
1121124839 14:91399357-91399379 ATCCAGGGCTGAGGGGTCCGTGG - Intronic
1122577604 14:102751926-102751948 GCCCAGAGCTGTGTGGCCCTGGG + Intergenic
1122919002 14:104871929-104871951 GCCCTGGACAGCGTGGTCCGTGG - Intronic
1122931381 14:104934165-104934187 GCACAAGGCTGTGTGGTTTGTGG + Exonic
1123042118 14:105494543-105494565 GACCGGGGCTCTGTGGTCCCAGG + Intronic
1125674549 15:41495147-41495169 GCCCAGGGCTGTGTTTTCCGAGG - Intronic
1128270899 15:66308535-66308557 GCCCTGGGCTGGGTGCTCTGGGG - Intronic
1129150442 15:73684673-73684695 GCCCTGGGCTGTGGGGCCCGCGG + Intronic
1129832924 15:78682345-78682367 GCCCAGGGCAGTGAGGACAGTGG - Intronic
1130045892 15:80444218-80444240 GCGTAGGGCTGTGGGGTCCCAGG + Intronic
1130149971 15:81304008-81304030 TCCCAGGGCTGTGTTGTCTCAGG + Intronic
1130996895 15:88909028-88909050 GCCCAGGGATGGGTGGAGCGGGG - Intronic
1132154186 15:99484113-99484135 GCTGAGGGCTGTCTAGTCCGGGG + Intergenic
1132178459 15:99733539-99733561 GCCCCGGGCCCTGTGGTCCCGGG - Intronic
1132504008 16:297789-297811 CCCCATGGCTGTGTGGTTCCAGG + Exonic
1132580716 16:683534-683556 GCCCAGGGAGGTGGGGTCCTGGG + Exonic
1132656814 16:1044892-1044914 GCCCAGGGCTGGGTGGGGCCGGG + Intergenic
1132688698 16:1172808-1172830 GCCCAGGGCTGTGGGCTGGGAGG + Intronic
1136288085 16:29255596-29255618 GCCCTGGGGTGTGTGTTCTGGGG + Intergenic
1136566429 16:31073393-31073415 GCCCGGCGCGGTGTGGTCCCGGG - Intronic
1138249359 16:55490308-55490330 CCCCAGGGCTGCGTGGACCATGG - Intronic
1138497459 16:57416924-57416946 GCACAGGGGTGTGGGGTCCCCGG - Intergenic
1138991221 16:62392882-62392904 GCCCACTGCTGTATGGTCTGGGG + Intergenic
1139475425 16:67200366-67200388 GCACAGGGATGTGTGGGCTGGGG + Intronic
1140471404 16:75217350-75217372 GCCTTGGGCTCTGTGGTCAGCGG - Intergenic
1141567493 16:84912900-84912922 TCCCAGGGCTCTGGGGGCCGAGG - Intronic
1141597247 16:85104870-85104892 GCCCGGGGCTTTGTGGTGCTGGG + Intronic
1141799014 16:86294770-86294792 GCACACGCCTGTGTGGTCCGAGG - Intergenic
1142283371 16:89160818-89160840 GCCCAGGGCGGGCTGGTGCGGGG - Intergenic
1142377033 16:89711699-89711721 GGCCAGGGCTGCGTGGGGCGGGG - Intronic
1142400478 16:89855853-89855875 GCCCGGGGCTGTGTGGCCCTGGG + Intronic
1142575742 17:906229-906251 TCCCAGAGCTGTGTGGTCCAGGG - Intronic
1142940814 17:3378609-3378631 GGCCAGGGCTGCGTGCTCGGTGG - Intergenic
1143845981 17:9772894-9772916 GCCCAGGGCTGCGTGCTTGGAGG + Exonic
1144760858 17:17706516-17706538 GCCCAGGGCTGGATGGCCAGTGG + Intronic
1144794581 17:17882463-17882485 GCCCAGGGTTGAGTGGTGCCTGG - Intronic
1145940922 17:28743200-28743222 GCCCGGGGCTGGGCGGTCCCCGG + Exonic
1146668909 17:34723357-34723379 TCCCAGGGCTCTGTGGTCCCTGG - Intergenic
1147557243 17:41487220-41487242 GCCCAGGGCTGTGGGTTTCTGGG - Intronic
1147612010 17:41807375-41807397 CCCCACTGCTGTGTGGTCCTGGG - Intronic
1148848116 17:50540960-50540982 GCCCAGGGGTCTGTGGTGGGGGG - Exonic
1149169340 17:53791668-53791690 GACCAGGGCTGTGCGCTCGGTGG + Intergenic
1149593958 17:57852383-57852405 GCCCAAGGCTGTGAGGGCCTGGG + Intergenic
1149624010 17:58066882-58066904 GCCCAGGGCAGGGTGGTCTCCGG + Intergenic
1151415182 17:73957354-73957376 GTCTAGGGCAGTGTGGTCCAGGG + Intergenic
1151715428 17:75828754-75828776 GCCCAGGGCAGGGTGGTGCGGGG - Intronic
1152111412 17:78359514-78359536 GCCCCGGGCGGTGTGGACGGAGG + Intronic
1152122078 17:78425000-78425022 GCCCTGGGCTGACTGCTCCGTGG + Intronic
1152139548 17:78528491-78528513 CCCCAGGGCTGTGGGGTCTTGGG + Intronic
1152285189 17:79408453-79408475 GCCCAGGGCTCTGTGGCTCACGG + Intronic
1152699607 17:81812444-81812466 CCCCAGGGCTATGTGGCCCAGGG + Intronic
1152897481 17:82921050-82921072 CCCCAGGGCTGTGGTGTCCCGGG + Intronic
1153681698 18:7507340-7507362 GCCCTGGGCTCTGTTGTCCATGG + Intergenic
1154309451 18:13255739-13255761 GGCCAGGGCTGTGGGGTGCTTGG + Intronic
1154357662 18:13633902-13633924 GGCCAGGGCTGTGTGCTCCACGG - Intronic
1157566590 18:48682794-48682816 GCCCAGGGCTGTCGGGACCCAGG - Intronic
1159444753 18:68528072-68528094 GCCCAGGGCTGTGTGTGCAAAGG + Intergenic
1160329403 18:77978062-77978084 GCCCGGGCCTGGGTGGTCCCTGG - Intergenic
1160785793 19:899757-899779 GCCCAGCGCTGTGGGCTCCTGGG - Intronic
1161031263 19:2058751-2058773 GCCCTGTGCTGGGTGGTCGGGGG - Intergenic
1161162454 19:2768804-2768826 GCCGGGGGCTGTGTGGCCCTGGG + Intronic
1161221460 19:3119997-3120019 GCCCTCGTCTGTGTGGTCAGTGG + Intronic
1161223944 19:3133634-3133656 GCCAATGGCTGTGTGGCCCTGGG + Intergenic
1161378007 19:3950100-3950122 TCCCAGGGCTGGGTGGTCCCAGG - Intergenic
1161579259 19:5071734-5071756 CCTCAGGGCTGGGTGGTCAGGGG - Intronic
1161594046 19:5142246-5142268 GCCCAGGCCAGTGTGTGCCGGGG - Intronic
1161977726 19:7615604-7615626 GCCCCGGGCTGCGGGGTCCGGGG + Exonic
1162301979 19:9849459-9849481 ACCCAGGGCAGTGTGGTGGGAGG + Exonic
1162780012 19:13002106-13002128 GCCCAGGGGTGTGGGGCCCAGGG - Intronic
1162831717 19:13288735-13288757 AACCAGGGCTGTGTTGTCCAGGG - Intronic
1162958742 19:14113967-14113989 GCCCCGGGCTGTGCGGCCTGGGG - Intronic
1163258123 19:16170156-16170178 GCCCAGGGCTGAGTGTTCTTGGG - Intronic
1163338110 19:16686832-16686854 GCTCAGGGCTGTGTCTTCCCTGG + Intronic
1163721143 19:18898821-18898843 GCACAGGGCTGTGAGGTCAAGGG - Intergenic
1165136486 19:33673100-33673122 GCCCAGGGCTGTGTGGTCCGTGG + Intronic
1165287077 19:34851347-34851369 GCCCAGGGCTGGAAGGTCCGTGG + Intergenic
1166108924 19:40611173-40611195 GCCCAGGCCTGTGTGGCCGAGGG + Exonic
1166328070 19:42063230-42063252 GACCTGGGCTGTGGGGTCAGGGG - Intronic
1166366099 19:42279292-42279314 GCCCAGGGCTGAGCAGTCCTGGG + Intronic
1166735165 19:45079642-45079664 GCCCAGGGCGGTGTGGGGAGTGG + Intronic
1166758991 19:45212962-45212984 TCCCAGGGGTGTGTGGTCCCAGG + Exonic
1166997377 19:46726140-46726162 GCCCAGGCCTGAGAGGTCAGTGG + Intronic
1167043612 19:47037508-47037530 GCCCAGGTCTGTCTGTTCCGGGG + Intronic
1167135131 19:47611094-47611116 ACCCAGGGCTGTGTGACCCTGGG - Intronic
1168186508 19:54703630-54703652 GCCCAGGGCTATGTTTTCTGAGG + Intergenic
1168630349 19:57951030-57951052 GGCCAGGGCTGCATGCTCCGTGG - Intergenic
925003349 2:423645-423667 GCCAAGGACTGTGTGGCCCCGGG + Intergenic
925868262 2:8247549-8247571 GCCCAGGGCAGGGTGGGCTGGGG - Intergenic
926660262 2:15457916-15457938 GCCCAGGTCTGTGTTTACCGAGG - Intronic
928086746 2:28350809-28350831 GCCCAGGGCTGTGTGGGAGGAGG - Intergenic
928088361 2:28359496-28359518 GCCCAGGCCATTGTGGTCAGAGG + Intergenic
928167437 2:28981387-28981409 GCCCAGGACTGTGTGGCTGGTGG + Exonic
929906052 2:46047488-46047510 TCGCAGTGCTGTGTGGTCAGTGG + Intronic
929932593 2:46270610-46270632 GCCAGGGGCTGTGTGGGCTGGGG - Intergenic
930222545 2:48759864-48759886 CCCCAGGGCTGTGTGGGAGGTGG - Intronic
932667506 2:73708815-73708837 ACCTAGGGCTGAGTGGTCCGGGG - Intergenic
934936837 2:98471865-98471887 TGCCAGGGGTGTGTGGTCTGGGG + Intronic
936076023 2:109402365-109402387 GCCCAGGATTCTGTGGTCAGTGG + Intronic
937202993 2:120217754-120217776 GCCCTCGGCAGTGTGGTCCAAGG - Intergenic
937325839 2:120989202-120989224 GCCCCGGGCTGGGTAGTCTGGGG - Exonic
937357206 2:121205502-121205524 ACCCAGGGCTGTGTGGACCACGG - Intergenic
937855534 2:126669966-126669988 GCCCAGGGCTGTGGGAACAGAGG + Intronic
937895600 2:126974778-126974800 GACCAGGGCTGTGGAGTCTGTGG - Intergenic
938071355 2:128310147-128310169 GCCCTGGGCTGTGTGTTGGGTGG - Intronic
938277345 2:130038039-130038061 GCCCAGGGCTGTGGCGGCGGCGG - Intergenic
938292522 2:130157630-130157652 CCCCAGGGCTGTGTGGGCGCTGG - Intronic
938343260 2:130549261-130549283 GCCATGGGCTGTGTGCTCCCGGG - Intronic
938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG + Intronic
938438039 2:131299341-131299363 GCCCAGGGCTGTGGCGGCGGCGG + Intronic
938762525 2:134438763-134438785 GCCCAGGGCTGTATGGGTCCTGG + Intronic
940694429 2:156960107-156960129 GGCCAGGGCCGTGTGCTCCATGG - Intergenic
941372782 2:164687538-164687560 CCCCAGGGCACTGTGGTCAGGGG - Intronic
942164839 2:173231815-173231837 GTCCACTGCTGTGTGGTCCCTGG + Intronic
943330292 2:186550814-186550836 GAACTGGGCTGTGTGGTCAGTGG - Intergenic
945600429 2:211856293-211856315 GCCCAGAGCTGTGAAGTCTGGGG + Intronic
946253558 2:218428098-218428120 GGCCAGGGCTGTGAGGCCCAGGG + Intronic
946371676 2:219285165-219285187 GCCCAGGGCTGATAGGTCCCTGG + Exonic
946448170 2:219757554-219757576 GCAGAGGGCTGTGGGGTCCAGGG - Intergenic
947718424 2:232353085-232353107 GACCAGGACTGTGTGGTCAGAGG - Intergenic
947724624 2:232389011-232389033 GACCAGGACTGTGTGGTCACAGG - Intergenic
947729854 2:232421633-232421655 GACCAGGACTGTGTGGTCAGAGG - Intergenic
947791612 2:232872171-232872193 GCCCTGGGCTCTGTGGGCTGGGG + Intronic
947918463 2:233849767-233849789 TCCCAGGACTGTGCGGTGCGAGG + Exonic
948832541 2:240605226-240605248 GTCCAGGGCTGTGGGGTCCCTGG + Intronic
949031368 2:241798960-241798982 GCCCAGACCTGTGTGGCCCAAGG + Intronic
1169812022 20:9618147-9618169 GCCCAGCGCTGTATGTTCCTTGG - Intronic
1172149728 20:32781153-32781175 GCCCAGGGCTCTGTTGTCTTAGG + Intronic
1172208882 20:33183690-33183712 GCCCAGGGCTGAGTGGTCTGGGG - Intergenic
1172768009 20:37361390-37361412 GCCCCTGGCTGTGTGGTCACAGG - Intronic
1173250736 20:41363023-41363045 GCCCAGGGCTGTTTGGTGAGCGG - Exonic
1175893074 20:62323830-62323852 GCCGAGGGCTGTGTCCTGCGAGG - Exonic
1175943427 20:62548158-62548180 GCCCAGGGCCGTGCTGCCCGTGG - Intergenic
1176033737 20:63026318-63026340 GCCCTGTGTTGGGTGGTCCGAGG - Intergenic
1176100222 20:63361334-63361356 GCGCCGGGCTGTGGGCTCCGTGG + Exonic
1179794416 21:43774573-43774595 GGCCCGGGCTGTGTGGTCTTAGG - Intronic
1179960030 21:44762904-44762926 GCCCAGGGCAGTGAGGCCAGCGG - Intergenic
1180165488 21:46023607-46023629 GACCAGGGCAGTGTGGGCTGCGG + Intergenic
1180853453 22:19032745-19032767 GGCCAGGCCTGTGGAGTCCGTGG - Intergenic
1180972925 22:19824941-19824963 GCACAGGGCTGTGCAGCCCGAGG - Intronic
1181286033 22:21753378-21753400 GCCCAGGGCTGTGTGGTCTTGGG + Intergenic
1182273186 22:29168734-29168756 GCCCAGGGCCTTGTGGGCAGAGG - Intergenic
1183293697 22:37018108-37018130 TCCCAGTGCTGGGTGGTCCCTGG - Intronic
1183544540 22:38448592-38448614 CCCCAGAGCTGTGGGGTCTGTGG - Intronic
1184431791 22:44445363-44445385 GCCCGGGGCTGGGTGGTGCTGGG - Intergenic
1184648373 22:45908236-45908258 GCCCGGGGCTGGGTGGTGTGGGG + Intergenic
1184692085 22:46122041-46122063 GCTCAGGGCTGGGAGCTCCGAGG + Intergenic
1184706156 22:46214894-46214916 GTCCAGGGATGTGTGATCTGAGG + Intronic
1184716911 22:46287689-46287711 GCCCAGGCCTCTGTGGTTCCAGG - Intronic
1184860171 22:47169071-47169093 GTCCACTGCTGTGTGGTCCATGG + Intronic
1185270224 22:49926565-49926587 GCCCAGGGCAGAGGGGACCGAGG - Intronic
1185320040 22:50196409-50196431 GCCCGGCGCTGTGTGGCCCCCGG + Intronic
1185326715 22:50229174-50229196 GCCCTGGGCTGTGTGGGCCCTGG - Intronic
949897935 3:8784026-8784048 GCCCATGGTTGTGTGGGCAGTGG - Intronic
950138396 3:10599254-10599276 GCCCAGGGGTGTGGGGTAGGCGG - Intronic
950422300 3:12906277-12906299 GCTCAGTGCTGTGAGGGCCGTGG + Intronic
950449865 3:13059422-13059444 GGCCTGTGCTGTGTGGTCAGGGG - Intronic
951913006 3:27770779-27770801 GGCAAGGGGTCTGTGGTCCGTGG - Intergenic
953263783 3:41366152-41366174 GCCCAGGGCTGTCTGCTATGGGG - Intronic
954031741 3:47824877-47824899 GCCCAGGGCTGTGGTGAGCGAGG + Intronic
954330147 3:49885525-49885547 GCACAGAGCTGTGGGCTCCGAGG + Intergenic
954871080 3:53767857-53767879 GCCCAGTGGTGTGTGGTGGGAGG + Intronic
954873766 3:53787261-53787283 GCCCAGGGCTGTGGGGAAGGTGG - Intronic
956414522 3:69013102-69013124 GCCAAGGGCTGAGGGGTCAGTGG + Intronic
958804681 3:98795523-98795545 GCCTATGGCTGTGTGGTATGAGG - Exonic
959389858 3:105759885-105759907 GGCCAGGGCTGTGTGCTCTATGG - Intronic
959663525 3:108896148-108896170 GCCAGGGGCTGTGGGGTCCGGGG + Intergenic
959873897 3:111359921-111359943 GCACAGAGCAGTGTGGTCCTGGG - Intronic
960704970 3:120473076-120473098 GGACAGGGCTTTGTGGTCCTTGG + Intergenic
960777481 3:121274620-121274642 AGCCAGGGCTCTGTGGTCAGAGG + Intronic
961397780 3:126609089-126609111 ACCCAGGGCTGTGTGCTGAGAGG + Intronic
961477975 3:127160459-127160481 GCCCAGGGCTGGGTGTTCCTTGG + Intergenic
961520904 3:127466890-127466912 GGCCAGGCCTGTGTGGGCCCTGG - Intergenic
961693024 3:128684120-128684142 GCCCAAGGCTCTGAGGTCCGTGG - Intergenic
962200801 3:133399877-133399899 GCCCAGGGCTGTGTGCAGAGAGG - Intergenic
962603238 3:137011210-137011232 GCCCAGGGCTGCCTGGTTGGGGG + Intergenic
967881574 3:194305500-194305522 GCTCCAGGCTGTGTGATCCGTGG - Intergenic
968549513 4:1214864-1214886 GCCCAGGGCCGTCTGTTCTGAGG + Intronic
968611967 4:1561287-1561309 GTCCAGGGCTCTGTGCTCCCCGG - Intergenic
968648947 4:1752906-1752928 GCCCAGGCTTGTCTGGTCCCAGG + Intergenic
968832345 4:2939477-2939499 GGCCAGGGCTGTGGGCTCAGTGG - Intronic
968894059 4:3388575-3388597 GCCCAGGGCTGGGGGGTGGGTGG - Intronic
969304706 4:6318916-6318938 GCCCAGGGATATGGGGTCCCTGG + Intergenic
969315900 4:6381190-6381212 GCCCAGGGCTGTGGGGCCTCGGG - Intronic
972106333 4:35493906-35493928 GGCCAGGGCTGTGTGCTCCATGG + Intergenic
972738150 4:41865482-41865504 GCCCGGGGGTGTGTGGACTGCGG - Intergenic
976591008 4:86849961-86849983 GCCCTGGGCACTGTGGTCAGAGG - Intergenic
976700575 4:87965815-87965837 CCCCAGGGCTGTGGGCTTCGGGG - Intergenic
979090714 4:116478611-116478633 CACCAGGGCTGTGTGCTCCACGG - Intergenic
983491718 4:168397779-168397801 GGCCAGGGCTGCGTGCTCCATGG + Intronic
985488115 5:163152-163174 GCCCAGGGCTGTGTGCTCTGTGG + Exonic
985576516 5:675740-675762 CCCCAGGGATGAGTGGTCCTGGG + Intronic
985587053 5:745848-745870 GCTCAGGAGTGTGTGGTCCCAGG - Intronic
985590482 5:761927-761949 GCCCAGGGCTGTGAGTTGAGTGG - Intronic
985601622 5:838031-838053 GCTCAGGAGTGTGTGGTCCCAGG - Intronic
985643463 5:1074332-1074354 GCCCAGGGCTGTGCTGGCAGAGG + Intronic
985662404 5:1163797-1163819 GCCCAGTGCTGTGGGGTCAGGGG + Intergenic
985985362 5:3511065-3511087 GCCCAGAGCTCTGTGGTGGGAGG - Intergenic
986698212 5:10376759-10376781 GCCGAGAGCAGTGTGGTGCGTGG - Intronic
986745121 5:10736960-10736982 GTGCAGGGCTCTGTGGCCCGTGG + Intronic
987245171 5:16041533-16041555 CCCCAGGGCTGTGGGGGCAGAGG - Intergenic
989632921 5:43505378-43505400 GCACAGGGCTCTGTGGGCCCAGG - Intronic
990520356 5:56573436-56573458 GCACAGGGCAGTGGGGTCCTGGG + Intronic
995183949 5:109252695-109252717 GCCCAGGGCTGTGGGGTGAAGGG - Intergenic
997835777 5:137192286-137192308 TCCCAGGGCTGTGTGCTGCATGG + Intronic
998104489 5:139459758-139459780 GCCCAGGCCTGGGTGGACAGAGG + Intronic
999141742 5:149367045-149367067 GCCCAGGGCTGGGAGGCCGGGGG - Intronic
999426783 5:151494462-151494484 GCCAAGGGCTGAGTGGTGTGAGG - Intergenic
1000025841 5:157358510-157358532 TCCCAGGCCTGTGTGTTCCCAGG + Intronic
1001101741 5:168819926-168819948 GCCCAGGGCAGTGGAGTCCAGGG + Intronic
1001955172 5:175843881-175843903 GCCCAGAGCTCTGTGCTCCTGGG - Intronic
1002163612 5:177331760-177331782 GCCCACCCCAGTGTGGTCCGGGG + Exonic
1002343614 5:178532964-178532986 GCCCTGAGCTGTGGGGTCCCTGG + Intronic
1002468140 5:179418007-179418029 GCCCAGGGCTTTGTGGGCCTCGG - Intergenic
1002784518 6:391661-391683 GCCGAGGCCTGTGGGGGCCGGGG - Intergenic
1002861132 6:1080503-1080525 GGCCTCGGCAGTGTGGTCCGTGG - Intergenic
1003789034 6:9521826-9521848 GCCCAGGCCTGTGTAGTAAGAGG + Intergenic
1006410826 6:33872364-33872386 GCCCACTGCTCTGTGCTCCGTGG - Intergenic
1006766432 6:36510540-36510562 GGTCAGGGCTGTGTGCTCCATGG - Intronic
1007216938 6:40247748-40247770 GCCAAGGGCAGTGGGGTCTGAGG - Intergenic
1007589185 6:43011310-43011332 TCCCAGGGCTGTGTGGGCTGTGG - Exonic
1007694161 6:43721326-43721348 GCCCAGAGCTGGGTGGTCCAGGG + Intergenic
1012100701 6:95083474-95083496 GGCCAGGGCTGTGTCTTCCATGG + Intergenic
1012122237 6:95383847-95383869 GGCCAGGGTTGTGTGCTCCAGGG + Intergenic
1017104873 6:150878124-150878146 GCACAGGGATCTGTGGTCCAAGG - Intronic
1018677648 6:166236683-166236705 GCCCAGGGCTCCGAGGTGCGAGG + Intergenic
1018793817 6:167170845-167170867 TCTCAGGGCTGTGAGGACCGCGG + Intronic
1018802669 6:167236033-167236055 GCCCAGGGCAGAGTGGATCGTGG + Intergenic
1018822519 6:167384236-167384258 TCTCAGGGCTGTGAGGACCGCGG - Intronic
1018976817 6:168572942-168572964 GACCAGGGCTGCGTGCTCCTTGG + Intronic
1018976851 6:168573066-168573088 GACCAGGGCTGCGTGCTCCTTGG + Intronic
1018976884 6:168573190-168573212 GACCAGGGCTGCGTGCTCCTTGG + Intronic
1018976917 6:168573314-168573336 GACCAGGGCTGCGTGCTCCTTGG + Intronic
1018976946 6:168573438-168573460 GACCAGGGCTGCGTGCTCCCTGG + Intronic
1019166262 6:170099534-170099556 GCCAAGGGCAGTGTGGTGCCTGG - Intergenic
1019773325 7:2897219-2897241 GCCCAGGCCTGTGCGTTCAGCGG - Intergenic
1020014869 7:4825047-4825069 ACCCAGGCCTGTGTGGACGGAGG + Intronic
1020115003 7:5471279-5471301 GCCCCGGCCCGTGTGTTCCGAGG - Intronic
1020959575 7:14786490-14786512 GGCCAGGGCTGTGTATTCCCTGG + Intronic
1022394366 7:29972520-29972542 GCCCAGGGGTATGTGGGCCAAGG + Intronic
1023861449 7:44219769-44219791 GCCCAGGACTGTGCTGCCCGGGG + Intronic
1024024417 7:45399182-45399204 GGCCAGGGCTGTGTGCTCCATGG + Intergenic
1025635743 7:63317894-63317916 TCCCAGGGCTGTGGGGCCCCTGG - Intergenic
1025646953 7:63430286-63430308 TCCCAGGGCTGTGGGGCCCCTGG + Intergenic
1028997559 7:97117794-97117816 GCCCAGGGATTTGAGGTCCGGGG - Exonic
1029364175 7:100106675-100106697 GCCCATGGCTGGGAGGTCCTGGG - Exonic
1029545938 7:101210626-101210648 TCCCAGGCCTATGTGATCCGGGG - Exonic
1032840074 7:135706332-135706354 CCGCAGGGATGTGTGTTCCGTGG - Intronic
1034489424 7:151385449-151385471 GCCCAGGGCAGTGTGGGGCTGGG - Intronic
1035028666 7:155843682-155843704 GGCCAGGGCTGTGGGGTTCCTGG + Intergenic
1035083695 7:156238306-156238328 GCCCAGGGCTTTCTGCTCCCGGG - Intergenic
1035168282 7:157004124-157004146 GCGCCGGGCTGGGTGGGCCGCGG + Intronic
1035253553 7:157612633-157612655 GCCCCGTGCTGTGGGGTCAGAGG - Intronic
1035370826 7:158377860-158377882 GCCCTGTGCTGTGTGGACTGTGG - Intronic
1036809519 8:11857862-11857884 GCCCAGGGCTGTGGTGTTCCTGG + Intronic
1037309823 8:17543446-17543468 GCCCAGGGCAATGAGGTCCATGG - Exonic
1039357481 8:36836877-36836899 GCCCAAGGCTGTTTGGTGCCAGG + Exonic
1040416934 8:47203474-47203496 GCCCAGGGCTGAGGGGACCTAGG + Intergenic
1040492979 8:47942001-47942023 GCACAGGGCTGGGTGGGGCGTGG - Intronic
1041864078 8:62548522-62548544 GCCCAGGACTCTGTGGTGCCTGG - Intronic
1041955926 8:63558389-63558411 GGCCAGGGCTGCGTGCTCCATGG + Intergenic
1045320800 8:101080344-101080366 GCCCAGGGCAGAGAGGTCAGGGG + Intergenic
1047795060 8:128246963-128246985 GGCCAGAGCTGTGTGTTCTGGGG - Intergenic
1049023365 8:139972615-139972637 GGCCAGGGCTGTGGTGTCTGGGG - Intronic
1049206358 8:141365475-141365497 GCACGGGGCTGTGTGGCCTGGGG - Intronic
1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG + Intergenic
1049310881 8:141933264-141933286 GCCCAGGGATCTGTGGTCAAAGG - Intergenic
1049373815 8:142279809-142279831 CCCCAGGGCAGTGTGGTCCGGGG + Intronic
1049433059 8:142574185-142574207 GCCCAGGGCTGTGCGGAGAGGGG + Intergenic
1049446774 8:142634896-142634918 GCCCAGGTCTGTGTGGAAGGGGG + Intergenic
1049552365 8:143266579-143266601 GCTCAGGGCTGTGTGGGTGGAGG - Intronic
1049558403 8:143295279-143295301 TCCCAGGACTGGGTGGGCCGAGG + Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1052191231 9:25665337-25665359 GCCCAGGGCAGTCTGGCCTGGGG - Intergenic
1054816849 9:69483820-69483842 GCCAGGGGCTGTGGGGTCTGGGG - Intronic
1056685255 9:88753844-88753866 GGCCAGGGCTGTGTTCCCCGGGG - Intergenic
1056955548 9:91078056-91078078 GCCCAGGGCTATGGGGTGGGAGG + Intergenic
1058456654 9:105143805-105143827 GCCCAGTGCTGTGTGTGCCATGG - Intergenic
1059429464 9:114241251-114241273 GCCCAGGGCTGTGTGTCACGGGG - Intronic
1060766093 9:126295985-126296007 GGCCAGAGCTGTGTGGACCCTGG + Intergenic
1060884291 9:127139638-127139660 GCCCAGGCCTGTCTTGTCAGAGG - Intronic
1061195204 9:129103563-129103585 TCCCAGGGCTGTCTGGCCCATGG + Intronic
1061261840 9:129484444-129484466 TCTCAGGGCTGTGTGATCCCGGG + Intergenic
1061681759 9:132245978-132246000 GCCCAGGGCTGCCTGGCCTGGGG - Intergenic
1061925255 9:133803060-133803082 GCCCAAGGCTGGGTGGTTCCAGG - Intronic
1062176174 9:135164322-135164344 GCCCATTGCTCTGTGGTCCATGG + Intergenic
1062440258 9:136566521-136566543 CCCCAGGGCTCTGTGCTCCTTGG - Intergenic
1062446858 9:136598819-136598841 GCCCGGGGCAGTGTGGGCAGCGG + Intergenic
1062449798 9:136610660-136610682 GCCCCAGGCTGTGTGGCCCGAGG + Intergenic
1062474343 9:136719913-136719935 GCAGGGGGCTGTGTGGTCTGGGG + Intronic
1062532452 9:137007875-137007897 GCCCAGCTCTGGGTGGTCAGTGG + Exonic
1062540806 9:137040890-137040912 GCCCAGGGAGGTGTGGGGCGTGG + Exonic
1062549353 9:137078765-137078787 CCCCGAGGCTGTGTGGTCCTGGG + Intronic
1062561681 9:137144898-137144920 CCCCAGGGGTGTGGGGACCGGGG + Intronic
1062561788 9:137145183-137145205 CCCCAGGGGTGTGGGGACCGGGG + Intronic
1062686348 9:137815440-137815462 CCCCAGGGCTGTGTGAGCTGAGG - Intronic
1062700098 9:137895213-137895235 GATCAGGACTGTGTGGTACGAGG - Intronic
1186141745 X:6581770-6581792 GCTCAGAGCTCTGTGGTGCGTGG + Intergenic
1187151196 X:16683118-16683140 GGCCAGGGCTGAGTGTTCCAGGG + Exonic
1187493791 X:19777212-19777234 GGCCAGGGCTGTGTGCTACAGGG + Intronic
1189201617 X:39201101-39201123 GCTCAGGGCTGTGAGATCCCTGG + Intergenic
1190369380 X:49726777-49726799 GGCCGGGGCTGTGTGCTCCTTGG + Intergenic
1193871620 X:86805354-86805376 ACACAGGGCTGTGTGGCCCTGGG + Intronic
1197609688 X:128623844-128623866 GGCCAGGGCTGTGTGCTCCATGG - Intergenic
1201054881 Y:9978737-9978759 GTCCAGGGCTGTGTTGTCTGTGG - Intergenic