ID: 1165136522

View in Genome Browser
Species Human (GRCh38)
Location 19:33673307-33673329
Sequence TGGAAATGTCAATGAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165136518_1165136522 24 Left 1165136518 19:33673260-33673282 CCAGATGGAAAACTAGTAGCTGT 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1165136522 19:33673307-33673329 TGGAAATGTCAATGAGTAACTGG 0: 1
1: 0
2: 1
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165136522 Original CRISPR TGGAAATGTCAATGAGTAAC TGG Intronic
902551020 1:17219705-17219727 TGGAAATGTCAATGCAAAGCTGG + Intronic
902673252 1:17990509-17990531 TGGAAATGGCATTGAGTAGAAGG - Intergenic
902735416 1:18397591-18397613 TGGACATTTCAATGAGGAATGGG + Intergenic
903829657 1:26167030-26167052 CAGAAATGTCAGTGGGTAACTGG - Intergenic
904829465 1:33297446-33297468 TGAAAATGTCAATGCTGAACGGG - Intronic
907162858 1:52384135-52384157 TTGAAATGCAAATGAGTCACAGG + Intronic
907966930 1:59340780-59340802 GGGTAATGTAAATGAGTAATAGG + Intronic
908635396 1:66158378-66158400 TAGACATGTAAATGAGTGACAGG + Intronic
909132467 1:71755031-71755053 TGAAAATGTCAGTGAATAATTGG - Intronic
911490633 1:98561991-98562013 TGGAAATGGCAGTGAAGAACAGG - Intergenic
915296177 1:154923436-154923458 TGGAAATGTCCAAAAGTCACTGG - Intergenic
917857706 1:179114643-179114665 TGCAAATGTCTCTGAGAAACTGG + Intronic
918045630 1:180939338-180939360 TGGAGATGTCCAGGAGAAACTGG - Intronic
918175367 1:182039746-182039768 TGTAAATGGCAATCAGTAAATGG + Intergenic
918987715 1:191654762-191654784 TGGTAGTGTCAATAGGTAACAGG - Intergenic
924695281 1:246393317-246393339 TGGTTCTGTCACTGAGTAACTGG - Intronic
1063281434 10:4633544-4633566 TGGAAATGGGACTGAGAAACAGG + Intergenic
1065734803 10:28741799-28741821 TGGGAATGTCAATTAGTACAGGG + Intergenic
1068786988 10:60987510-60987532 TGGATATGTCAATGGGAAATAGG - Intronic
1069064527 10:63928677-63928699 TCAAAATGGCATTGAGTAACTGG + Intergenic
1069235639 10:66068320-66068342 TTGAAATGTAAATGGATAACTGG - Intronic
1069381046 10:67843434-67843456 TGGAAAAGTCACAGAGTCACAGG + Intergenic
1069543525 10:69313211-69313233 TGAAAATGTCAATGCCTTACAGG + Intronic
1070578114 10:77695665-77695687 AGGAAAGCTCAATGAGTAAAGGG + Intergenic
1071155746 10:82686918-82686940 TGTAAATGTCAGTGAATAACGGG + Intronic
1071748782 10:88451462-88451484 TGGAAATGTCAAAGAGAGAAGGG + Intronic
1075183418 10:120232900-120232922 TGGAAATGTGAATGAATAACTGG + Intergenic
1075921129 10:126214518-126214540 TGGAAATGTATATGAGAGACTGG + Intronic
1077150210 11:1069759-1069781 TGGATATGTGAGTGAGTGACTGG - Intergenic
1078538140 11:12191830-12191852 TGGAAATGTGAGAGAGTAATGGG + Intronic
1082872915 11:57960233-57960255 TGGAAAGATCCATGAGAAACTGG - Intergenic
1088496400 11:110435452-110435474 AGGAAATGGCAATGACTACCTGG - Intronic
1093687405 12:22072290-22072312 TGGAAATATTCATGAGTACCCGG + Intronic
1095402863 12:41835109-41835131 TGTAAATGTCAATGAGATAAAGG - Intergenic
1100132008 12:91506722-91506744 TGGAACTCTCAAAGAGTAAATGG + Intergenic
1100401493 12:94233798-94233820 TGGAAATGGGAAAGAGTAAAAGG - Intronic
1102112612 12:110376097-110376119 TGTAGCTGTCAATGAGTATCAGG - Exonic
1103194513 12:119030874-119030896 TGTAAATGTCAATGAATATAAGG - Intronic
1106759770 13:32857315-32857337 AGGAAATGACAATGAGTGAGAGG + Intergenic
1107417943 13:40218890-40218912 TGGATATGTCAATGAGTCTTTGG - Intergenic
1107896382 13:44968046-44968068 TGGAAATGACATTGGGTAAGTGG + Intronic
1108050622 13:46433860-46433882 TGAAAATGTCAATTAGTAATGGG - Intronic
1109327462 13:60885570-60885592 TGGAGATGTCAGAGAGCAACAGG + Intergenic
1109543199 13:63807479-63807501 TGAAAATGTCAATTAGTAATTGG - Intergenic
1110618896 13:77572610-77572632 GGGCAATGTCAATGATTACCAGG - Intronic
1111072459 13:83187020-83187042 TGGAAATGACTTTGGGTAACAGG + Intergenic
1111625368 13:90777761-90777783 GGTAACTGTCAATGAGTAAAGGG - Intergenic
1112631545 13:101166777-101166799 TGGAATTGTCAATGATTTATTGG - Intronic
1113385917 13:109847946-109847968 TGGAAATGTCACTGGGTTCCGGG - Intergenic
1116601990 14:46937633-46937655 TGGAAATGTCAATTAATTTCAGG - Intronic
1118438991 14:65795957-65795979 TGGAACTGCCAATGAGTACCTGG - Intergenic
1119600469 14:75972649-75972671 AGGAAATGCAAATGAGTAAGAGG + Intronic
1120350481 14:83351535-83351557 TGGCAAAATCAATGAGAAACTGG + Intergenic
1122186073 14:99997242-99997264 TGGAATTCTCAATGAGAAGCTGG - Intronic
1124830865 15:33148177-33148199 TGGAATTTTAAATGAGCAACAGG - Intronic
1124996165 15:34724726-34724748 TGGAACTGTCACAGAGAAACTGG + Intergenic
1126481050 15:49120666-49120688 TGGATTTGTTACTGAGTAACTGG - Intronic
1127493878 15:59491441-59491463 TGGAAATGTGGATGATTAATGGG + Intronic
1130371331 15:83287168-83287190 TGGAAATGTTAAGTAGAAACAGG + Intergenic
1132249829 15:100327275-100327297 AGGTAATGTCAATGAGTATTTGG - Intronic
1134161509 16:11893828-11893850 TGGAAATGTTCAAAAGTAACTGG + Intronic
1135084116 16:19461168-19461190 TGGAAATGTAAAATATTAACGGG + Intronic
1138045208 16:53715409-53715431 AGCAAATGTCAATAAGTACCAGG + Intronic
1138219490 16:55238797-55238819 TGGGAGTGTAAATGAGTAAATGG - Intergenic
1139301879 16:65952100-65952122 TGGGAATGTAAATCAGCAACTGG - Intergenic
1139302005 16:65953306-65953328 TGGGAATGTAAATCAGCAACTGG - Intergenic
1140964407 16:79950928-79950950 TAGAGATGTCTCTGAGTAACTGG + Intergenic
1144070152 17:11664115-11664137 TGCAAATGACAAAGAGTAAATGG + Intronic
1146760620 17:35474595-35474617 TGGAAATGTCAAAGGCTAATTGG + Exonic
1148214360 17:45826326-45826348 TGGAAATGTCACAGTGTCACTGG + Intronic
1151043117 17:70887285-70887307 ATGAAATTTCAATGAATAACTGG + Intergenic
1151056021 17:71032410-71032432 TGGAATTGTCAATTAGTTATTGG + Intergenic
1151076146 17:71274901-71274923 CAAAAATGTCAATGATTAACAGG - Intergenic
1155002142 18:21697932-21697954 GGGAACTGTCAATGATTTACTGG - Intronic
1155278918 18:24218128-24218150 TGTAAATGTCATTTAGTAATTGG - Intronic
1155808597 18:30204608-30204630 TGGACATGGCAATGAATAAAGGG - Intergenic
1156605724 18:38664847-38664869 TGGAGATGTCACTAAGTCACAGG + Intergenic
1156825324 18:41424235-41424257 AGGAAATGTTAAAGACTAACAGG + Intergenic
1157152386 18:45231049-45231071 TGGAAATGTCAAGGAATAGAAGG + Intronic
1158567248 18:58565155-58565177 AGGAAATGTTCATGGGTAACTGG - Intronic
1158691182 18:59662433-59662455 AGGAAATGACAAAGTGTAACTGG - Intronic
1158957725 18:62556640-62556662 TGGAAAGGTCAATTGGGAACAGG - Intronic
1159746780 18:72245635-72245657 TGGAACTGTCAAGAAGTAATTGG - Intergenic
1164874590 19:31674773-31674795 TGGAACTGTCACGGAGCAACTGG + Intergenic
1165136522 19:33673307-33673329 TGGAAATGTCAATGAGTAACTGG + Intronic
1166182308 19:41117483-41117505 TGGAAATTTCAATAGGTAATTGG - Intronic
1166279404 19:41781042-41781064 TGGAAATATTTATGAGTACCCGG + Intergenic
925264321 2:2554715-2554737 TTGAAAAGTCAAAAAGTAACAGG + Intergenic
925727919 2:6892468-6892490 TGAAAATGGCAATGAGTCAAAGG - Intronic
926260687 2:11257641-11257663 TGGAAATGTGAATCTGGAACTGG + Intronic
926562415 2:14432567-14432589 TGAAAATGTCAATAAGCAATGGG + Intergenic
933433619 2:82215883-82215905 TGGAATTGTCAGTGAGTGAGTGG + Intergenic
934619851 2:95797410-95797432 TGAAGATGTGAATGAGTAAGGGG - Intergenic
934641037 2:96027147-96027169 TGAAGATGTGAATGAGTAAGGGG + Intronic
935796519 2:106646849-106646871 TGTAAATGTCAGTGAGTCAGAGG + Intergenic
936266998 2:111018395-111018417 TGGGGATGTCAGTGAGTGACTGG + Intronic
937514263 2:122635575-122635597 TAGAAATATCAATGAGTTAGAGG + Intergenic
939968957 2:148639038-148639060 TGGACATTGCAATGAGTACCAGG + Intergenic
941395876 2:164972112-164972134 TGGAAATGTCATTCAGTAGCAGG - Intergenic
941494439 2:166182385-166182407 CAGAAATGCCAATGAGTCACAGG - Intergenic
942111378 2:172685913-172685935 TGGAAATGTGAATGCAAAACAGG - Intergenic
943156428 2:184185142-184185164 TGAAAATGTCACTAAGTAAGTGG - Intergenic
944424837 2:199569607-199569629 TTGAAAGCTCAATGAGTAATCGG + Intergenic
945658746 2:212658536-212658558 CAGAAATGCCAATGAGTCACAGG + Intergenic
946222674 2:218241889-218241911 TGGAAATGACAATCGGAAACTGG + Intronic
946994675 2:225377904-225377926 TGCAAAAGTCAACGAGGAACAGG + Intergenic
1169963215 20:11186259-11186281 TGGAAGTCTCCATGAGAAACGGG + Intergenic
1171850277 20:30303096-30303118 TGGAGAGGTCAATGAGTAGATGG + Intergenic
1174856903 20:54054601-54054623 TGAAGATGTCAATGAATAACAGG + Intronic
1177246163 21:18527148-18527170 GGGAAATGGCAATGAGAAACAGG - Intergenic
1179384032 21:40925077-40925099 TGGAAATGTCATTGAGTGCCAGG + Intergenic
1181389822 22:22572138-22572160 GGGAGATGTCCATGAGTACCTGG - Intergenic
1182225178 22:28792231-28792253 TGAAAATGTCCATGAATACCAGG + Intergenic
1185165452 22:49259566-49259588 TGGAATTGTGCATGATTAACTGG - Intergenic
1185193491 22:49453425-49453447 TGGATATGTGAATGAGTGAATGG + Intronic
949636868 3:5992031-5992053 TGGAAAAATAAATGAGTAAACGG + Intergenic
949803196 3:7925961-7925983 AGGAAAAGTCAAGGAGTAAGTGG + Intergenic
950233835 3:11300561-11300583 TAGAAATGTCCAGGAGGAACTGG + Intronic
952626194 3:35407050-35407072 TAGATATGTCAAAGAGTACCTGG + Intergenic
952725556 3:36580921-36580943 TGGAAATAGCAATGAGGATCTGG - Intergenic
952808256 3:37377918-37377940 TGGAAATATTCATGAGTACCTGG - Intergenic
954608267 3:51930323-51930345 AGGAAATGGGAATGAGTACCTGG + Intergenic
954996475 3:54886295-54886317 TGGAGATGTCATTTAGTAGCTGG - Intronic
955290250 3:57685322-57685344 TGAATATGTTAATGAGTAATAGG - Intronic
956043970 3:65175543-65175565 TAGAAAGGTCAAAGAGTAAATGG - Intergenic
956105634 3:65815152-65815174 TGGAAATCTCAATGATTCAAGGG + Intronic
957299237 3:78369541-78369563 TGGAAATGTCAGTCATTAATAGG + Intergenic
957637210 3:82801805-82801827 TGGATAGTTCAATGGGTAACTGG - Intergenic
958032275 3:88126160-88126182 TGGAAATGTGAATCTGGAACTGG + Exonic
960011356 3:112837095-112837117 TGGAAAAGTAAATTAGCAACTGG - Intronic
960871310 3:122252595-122252617 TGGAAATGGCGAGGAGTAAATGG + Intronic
962195526 3:133359562-133359584 TGGAAAGGTCCATGAGGAACTGG + Intronic
962368798 3:134804005-134804027 TGGGAAAGGCAATGTGTAACAGG - Intronic
964463462 3:156963401-156963423 TGTAAATGTCTATGAGCAGCCGG - Intronic
967489344 3:190071802-190071824 TTGAAAGGACAATGAGGAACTGG + Intronic
968341148 3:197956950-197956972 TGAAAATGTCAACAAGAAACTGG + Intronic
970846540 4:20545230-20545252 TGCAAATGTCATTCAGAAACTGG - Intronic
971275897 4:25196345-25196367 TGGAAATCTGAATCAGTTACAGG - Intronic
972915212 4:43868709-43868731 TGGAAATGTCAGTGTTTAACAGG + Intergenic
975943766 4:79679924-79679946 TGGAAAGGTCATTGACTAATGGG - Intergenic
976847713 4:89509303-89509325 TGGTAATGTCAATATGTTACAGG + Intergenic
979506819 4:121507945-121507967 TGGATGTGTCAGTGAGTAAGTGG + Intergenic
979955189 4:126944319-126944341 TGGAAAAGTCACTGATTAACAGG + Intergenic
980576853 4:134694104-134694126 TAAAAATGTCATTTAGTAACTGG + Intergenic
982924511 4:161319293-161319315 TGGATATGTCAGTGAGTAAGTGG - Intergenic
983281887 4:165691366-165691388 TTGAAATGTAAATGAGAAATAGG - Intergenic
983301859 4:165935897-165935919 TGGAAATATAAAAGAGGAACAGG - Intronic
984042579 4:174753989-174754011 GGGAAATGTCAAGGAGAAACTGG - Intronic
985068838 4:186148525-186148547 AGGACATTTCAATGATTAACAGG + Intronic
986612877 5:9587455-9587477 TGGACATGTGAATGAATACCTGG + Intergenic
988586200 5:32509591-32509613 TGAAAATGTAAATAAGCAACAGG - Intergenic
989226158 5:39031626-39031648 TGAAAATTTCAAAGAGAAACTGG + Intronic
989279919 5:39628936-39628958 TGGAATTGAGAATGAATAACAGG + Intergenic
992172958 5:74122252-74122274 TGGAAATGGAAATGAATCACAGG + Intergenic
992711622 5:79463830-79463852 TGGAAAGGTAAATGTGGAACTGG + Intronic
992827585 5:80566286-80566308 AGAAAATGGCAATGAGTATCAGG + Intronic
994509346 5:100684249-100684271 TGGAAAAGTCATTGAATAGCTGG - Intergenic
995590243 5:113692536-113692558 TGGAACTGACAATAAGTATCAGG + Intergenic
1000777319 5:165436474-165436496 TGAAAATATAAATCAGTAACAGG - Intergenic
1004880132 6:19999442-19999464 TGGTAATGACTATGAGTAAAAGG - Intergenic
1005096185 6:22119221-22119243 AGGAAGTTTGAATGAGTAACAGG - Intergenic
1007199559 6:40095207-40095229 TGGAAATGGCAGTGAGTAAGGGG - Intergenic
1007270352 6:40631350-40631372 TGTAAATGTTACTGATTAACTGG + Intergenic
1007555820 6:42765290-42765312 TAGGAATGTGAATGCGTAACAGG + Intronic
1008509899 6:52266553-52266575 TGGAAAAGTCCAAGAGTCACAGG + Intronic
1008895157 6:56544620-56544642 TGGGAATGTGAATGAGAAAATGG + Intronic
1009553397 6:65129713-65129735 TGGTAATGTAAATAAGTCACTGG + Intronic
1009842077 6:69090487-69090509 TGAAAAAGTGAATGAGTAAATGG - Intronic
1010472842 6:76250488-76250510 GGGAAATGTCAAAGAGTCAGTGG - Intergenic
1011759114 6:90540845-90540867 TCCAAATGTCAAAGAGGAACAGG - Intronic
1012518885 6:100096500-100096522 TGGAAATGCCAATGACTCATAGG + Intergenic
1014824246 6:126030725-126030747 AGGAACTGTCAGTGAGTAAAAGG + Intronic
1018284942 6:162227238-162227260 TGCAATAGTCAATGAGTAAAGGG - Intronic
1019990834 7:4689617-4689639 TGGAAATAGCCATGAGAAACTGG - Intronic
1021193353 7:17647363-17647385 TGGATATGTCAATCAGTTGCTGG - Intergenic
1021996338 7:26181381-26181403 TGGAAATGCCAGTGATTCACTGG - Intronic
1022127933 7:27376023-27376045 TGGAAACGTCAGTGAGGAAAAGG - Intergenic
1024875156 7:54013695-54013717 TGGAAAGTTCAATGAGTGATAGG + Intergenic
1031513733 7:122677827-122677849 TGGAAGGGCCAATGAGTAAATGG + Intronic
1032230705 7:130071060-130071082 TGGAAATGTCAATGAGACAGTGG - Intronic
1033384219 7:140855606-140855628 TTAAAATATCAATTAGTAACAGG + Intronic
1033999449 7:147393991-147394013 TGAAAATGTCACTTAATAACTGG + Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036662978 8:10720266-10720288 TTGAAATATCAGTGAGTAAATGG + Intergenic
1038744118 8:30241680-30241702 TGTAAATATCAATGTGGAACAGG + Intergenic
1039665612 8:39523480-39523502 TGGAAAAGTCAATAAATAAATGG - Intergenic
1041084810 8:54247009-54247031 TGGATATGGCAATGAGTTATTGG + Intergenic
1041309985 8:56506696-56506718 TGGAAATGTCACTGACTGAGTGG - Intergenic
1041313438 8:56538900-56538922 TGGAAATGGCAAAGAGTGACAGG + Intergenic
1041509853 8:58644085-58644107 AGGAAACATCAATGAGTTACAGG + Intronic
1042236644 8:66619795-66619817 GGGAAATGTCAACAAGGAACAGG + Intergenic
1042337428 8:67643219-67643241 TGGAAATTCCATTGAGAAACTGG - Intronic
1042447648 8:68905645-68905667 TGGAAATATCATTGAGAAAAAGG - Intergenic
1043759474 8:84049396-84049418 TTGAAATGTCAATAATTAACAGG + Intergenic
1044031617 8:87244615-87244637 TTTAAATGTCTATGAGTAAGTGG - Intronic
1044137508 8:88605671-88605693 TGACCATGTCACTGAGTAACTGG - Intergenic
1044778513 8:95719691-95719713 TGCAATTTGCAATGAGTAACTGG + Intergenic
1045025970 8:98086967-98086989 AGGAAATGTGAATGTGTAATTGG + Intronic
1046061627 8:109146511-109146533 TGGAAGTGTCAATAAATAACAGG + Intergenic
1047351439 8:124078431-124078453 TGCAGATGTGAATGAGTAAGGGG - Intronic
1047814058 8:128443317-128443339 TGGAAATGTCAATCAAAAAGGGG - Intergenic
1050559397 9:6819307-6819329 AAGAAATGCCAATGAGTAAATGG - Intronic
1050618471 9:7428408-7428430 TGGAAATGTTAATCAGTGTCTGG + Intergenic
1050990500 9:12145437-12145459 TTGAAATTTGAATGAGTAGCAGG - Intergenic
1053102997 9:35386942-35386964 TGGAACTGTAATTGAGTAATTGG - Intronic
1053330392 9:37200741-37200763 TGGAAGTGTAATTGAGGAACAGG + Intronic
1053475949 9:38382177-38382199 TGGACATGTTCATGAGGAACGGG - Intergenic
1053788059 9:41666387-41666409 TGGAGAGGTCAATGAGTAGACGG + Intergenic
1054157075 9:61648381-61648403 TGGACAGGTCAATGAGTAGACGG - Intergenic
1054176336 9:61877726-61877748 TGGAGAGGTCAATGAGTAGACGG + Intergenic
1054476850 9:65579386-65579408 TGGACAGGTCAATGAGTAGACGG - Intergenic
1054661203 9:67703082-67703104 TGGAGAGGTCAATGAGTAGACGG - Intergenic
1055243217 9:74209537-74209559 TAGAAATGTTAACAAGTAACAGG + Intergenic
1055997400 9:82175093-82175115 GGGAAATTTTAATGAGCAACAGG - Intergenic
1056905983 9:90648194-90648216 AGGAAATGTCAATGAGGAAAAGG - Intergenic
1058284549 9:103160156-103160178 CGGGAATGTCAATGGGTTACAGG + Intergenic
1058312290 9:103518904-103518926 TGGAAAGGTTATTGAGGAACAGG + Intergenic
1058737913 9:107912040-107912062 TTAAATTATCAATGAGTAACAGG + Intergenic
1061695239 9:132368640-132368662 TGGAAATGTGTCTGTGTAACTGG + Intergenic
1062302969 9:135885957-135885979 TGCACTTGTCCATGAGTAACTGG + Intronic
1186078314 X:5904004-5904026 TGGAAATGAAAATGGGTAAAAGG - Intronic
1186127786 X:6432539-6432561 TGTAAGAGTCACTGAGTAACTGG + Intergenic
1186415220 X:9377466-9377488 TCTAAATGTCCATCAGTAACAGG - Intergenic
1186423120 X:9442745-9442767 TGGAAAAGCCTATGAGTCACAGG - Intergenic
1186791355 X:13002629-13002651 TATAAATGTAAATGATTAACAGG - Intergenic
1187258830 X:17666619-17666641 TGAAAATATGAATGAGCAACTGG + Intronic
1188057890 X:25562996-25563018 TGGAAATGTCAAGGAGGGAATGG + Intergenic
1188747080 X:33858687-33858709 TGTAAATGTTAATCAGTACCTGG - Intergenic
1197070370 X:122289491-122289513 TGGAAATGTCATTGAATATAAGG + Intergenic
1201731510 Y:17209714-17209736 TGGAAATGTAAATGGATATCTGG - Intergenic