ID: 1165136924

View in Genome Browser
Species Human (GRCh38)
Location 19:33675360-33675382
Sequence CTGTAGCCATTGAACCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165136923_1165136924 -4 Left 1165136923 19:33675341-33675363 CCTGTAGCTTGGACTATGTCTGT 0: 1
1: 0
2: 2
3: 26
4: 269
Right 1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 120
1165136918_1165136924 25 Left 1165136918 19:33675312-33675334 CCTCCCTTCTACTGGACATAATG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 120
1165136921_1165136924 21 Left 1165136921 19:33675316-33675338 CCTTCTACTGGACATAATGAGGA 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 120
1165136917_1165136924 26 Left 1165136917 19:33675311-33675333 CCCTCCCTTCTACTGGACATAAT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 120
1165136919_1165136924 22 Left 1165136919 19:33675315-33675337 CCCTTCTACTGGACATAATGAGG 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165136924 Original CRISPR CTGTAGCCATTGAACCATGA AGG Intronic
900881708 1:5386362-5386384 GTGTAGCCATTGCCCCAAGATGG + Intergenic
902281136 1:15375336-15375358 CTTCAGCCATGGAACCAAGACGG - Intronic
903750791 1:25619038-25619060 CTGTAGGGATTGTACCAGGAGGG + Intronic
906250523 1:44307561-44307583 CTGAAGCCATGTATCCATGAGGG + Intronic
907642163 1:56201857-56201879 CAGTAGCCATTGAAGGCTGAAGG - Intergenic
908266381 1:62383429-62383451 CTGTACCCATTAAACAATAATGG - Intergenic
909194512 1:72600739-72600761 CTGTAACAGATGAACCATGAAGG + Intergenic
913094983 1:115507740-115507762 CTGCATCCATGGCACCATGATGG - Intergenic
916146783 1:161746921-161746943 CTTTATCCATTAATCCATGATGG + Intergenic
917742293 1:177972509-177972531 CTGTAGCCATTTGGGCATGAGGG - Intronic
918382140 1:183966882-183966904 CTCTAGCCATTGCCCCATGTGGG - Intronic
920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG + Intronic
921522722 1:216176513-216176535 CTGTAGCAAATGAACCATTTGGG - Intronic
1065486540 10:26241366-26241388 CTGAAGCCATTGAAGAGTGAAGG + Intronic
1069102276 10:64336750-64336772 CTGCAGCCATCGCAACATGATGG - Intergenic
1078788386 11:14519635-14519657 CTGCAGCGATAGAACCATTACGG + Intronic
1079168989 11:18074095-18074117 GGGTAGCCATTGATCCATGAAGG - Intronic
1082820401 11:57541037-57541059 CTGGAGCCGCTGAACCAGGAAGG + Intergenic
1084843457 11:71878437-71878459 CTTTACCTATTCAACCATGAGGG + Intronic
1093310156 12:17571577-17571599 ATGTACCAATTGAAGCATGAAGG + Intergenic
1093751910 12:22808965-22808987 CTGCTGCAATTGAAGCATGAAGG - Intergenic
1097566579 12:61277631-61277653 CTGTAGAAAATGAACCATAATGG + Intergenic
1098948435 12:76614078-76614100 TTCTAGCCAGTGAACCAGGAAGG - Intergenic
1100416766 12:94385912-94385934 CTGTAGGCATTGTAACATAATGG - Intronic
1100892404 12:99140533-99140555 CAGTAGGCAATGAATCATGATGG - Intronic
1103452456 12:121038900-121038922 CTGCAGCCACTGAGCCACGAAGG + Exonic
1105753785 13:23446105-23446127 CTTTAGGCATTGAACCTTCAGGG + Intergenic
1106525054 13:30533186-30533208 CTGGAGCCAATGTACCATGCAGG + Intronic
1107095789 13:36533652-36533674 CTGTAGCAAGGGAATCATGACGG + Intergenic
1108960154 13:56216959-56216981 GTGTAGCCCTTGAAGCAGGAAGG - Intergenic
1111713183 13:91843911-91843933 CTGAAGCCACTGAACCTTGAAGG - Intronic
1112631492 13:101165877-101165899 CTGTACCCATTGAACAACAATGG + Intronic
1115143576 14:30201056-30201078 CTCTAACCAATGAAGCATGAAGG + Intergenic
1117719030 14:58610421-58610443 CTTTATCCATTCAACCATGGTGG - Intergenic
1119020173 14:71104076-71104098 CTGTACACATTGAAACTTGATGG + Intronic
1119889500 14:78172331-78172353 CAGAAGCCCTTGAACGATGAAGG - Intergenic
1121743360 14:96269170-96269192 CTGTGGCCATTGCAACATCAGGG - Intergenic
1122846335 14:104501518-104501540 GGGAGGCCATTGAACCATGAGGG + Intronic
1127035717 15:54915096-54915118 GAGTAGGCATGGAACCATGATGG + Intergenic
1129225896 15:74170298-74170320 CTGTAGCCATCCCACCAAGAGGG - Intergenic
1131377732 15:91939507-91939529 CTGCAGCCAGCGAACCATGGGGG - Intronic
1135808919 16:25569721-25569743 ATGCAGCCAGAGAACCATGACGG - Intergenic
1138951167 16:61915189-61915211 CTGTAGCCATGCAAACAGGAAGG - Intronic
1139479600 16:67222685-67222707 CTGTATCCATTTAACTATTAAGG - Intronic
1143606759 17:7991264-7991286 CTGTACCCATTAAACAACGACGG - Intergenic
1146410076 17:32575678-32575700 CAGGAGCCATTGAAACATAATGG - Intronic
1146732863 17:35210314-35210336 CTGTAGTTAGTGAGCCATGATGG + Intergenic
1148723986 17:49775604-49775626 CTCGAGGCATTGAACCATCAGGG - Intronic
1150920497 17:69477333-69477355 CTGTGACCAATGAACAATGATGG - Intronic
1152601594 17:81265003-81265025 CTGCTGCCCTGGAACCATGAGGG - Intronic
1153323868 18:3798441-3798463 CTGTAGCCTTTGATCCCTGTAGG - Intronic
1157491506 18:48126965-48126987 CTCTTGCCCTTGAACCTTGAAGG - Intronic
1159014271 18:63088701-63088723 CTGCAGCCACTGAGCCCTGAAGG - Intergenic
1160145637 18:76361861-76361883 ATGGAGCCAGTGAACAATGAGGG + Exonic
1163796690 19:19342090-19342112 CTGCAGCCCTTGCACCCTGAGGG - Intronic
1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG + Intronic
924989064 2:295586-295608 CTGCAGCAAGTGAACCATGCAGG - Intergenic
934565860 2:95340601-95340623 TCGTAGCCAATGAAACATGAGGG + Intronic
936879528 2:117233070-117233092 CTGTAGCAATTGTACCATTCAGG + Intergenic
937216330 2:120315871-120315893 CTGTGGCCCTTGTAACATGATGG + Intergenic
937354258 2:121188092-121188114 CTAGAGCCATTGACCCATGCGGG + Intergenic
938157385 2:128952821-128952843 CTGTAGCCATTGACTCAGGGTGG + Intergenic
938487572 2:131727471-131727493 GTGTAGTCATTGAAAAATGAAGG - Intronic
947039073 2:225894583-225894605 CTGTATCCTTTGAAGCAGGATGG - Intergenic
948499410 2:238380884-238380906 CTGTAGCCATAAAACAAAGATGG + Intronic
1170365694 20:15596351-15596373 CTGGGGCCAGTGAACAATGAGGG + Intronic
1171400280 20:24868721-24868743 CTGTAACCAATGAAGCAGGAGGG - Intergenic
1173642262 20:44612002-44612024 CTGTATCCATTCAATCATGTTGG + Intronic
1174650629 20:52121956-52121978 CTCTAGAAATGGAACCATGAAGG + Intronic
1175463913 20:59176539-59176561 CTGCAGCCATAGAATCATGTTGG + Intergenic
1178099048 21:29246332-29246354 CTGCATGCAATGAACCATGATGG - Intronic
1179377836 21:40867403-40867425 CTGTAGCTATTGTACCACTAAGG - Intergenic
949292009 3:2477842-2477864 CTGTGGCCATTCAAGCAAGAAGG + Intronic
956262847 3:67364039-67364061 CTGTAGCCAAAGGACCAGGAAGG + Intronic
961911726 3:130324262-130324284 CTCTAGCCATTTACCCAAGAGGG + Intergenic
963078600 3:141370699-141370721 CCATGGCCAGTGAACCATGAAGG + Intronic
963242112 3:143016433-143016455 CTGCAGTCATTCAACCAAGATGG - Intronic
965509773 3:169555556-169555578 CTGTAGGCCTAAAACCATGAAGG + Intronic
969784555 4:9444518-9444540 CTTTACCTATTCAACCATGAGGG + Exonic
973131761 4:46656242-46656264 CCTTAATCATTGAACCATGAAGG - Intergenic
974977737 4:68912619-68912641 CTGTAGCTACTGAAACATGATGG + Intergenic
974987536 4:69046972-69046994 CTGTAGCTACTGAAACAGGATGG - Intronic
975136771 4:70882507-70882529 ATGCAGCCATTTATCCATGAGGG + Intergenic
979877084 4:125906181-125906203 ATTTAGCAATTGAAGCATGAGGG - Intergenic
980085912 4:128389819-128389841 CAGTAGCCAATAAACCATGAGGG - Intergenic
980273713 4:130620684-130620706 GTGAAGTTATTGAACCATGAAGG - Intergenic
984186353 4:176548211-176548233 CTGTTGACATTGAAGCAAGATGG - Intergenic
984385788 4:179055952-179055974 TTGAAGTGATTGAACCATGAGGG + Intergenic
988170345 5:27646168-27646190 CTGTATCCATTTGACCATCATGG + Intergenic
988832059 5:34997576-34997598 CTGTAGAGATTGAGCCAGGAAGG - Intergenic
990745231 5:58952189-58952211 CTTTAACCATTCATCCATGATGG - Intergenic
990848132 5:60168040-60168062 CTGTGGCCATTGCAGCATTAAGG + Intronic
1002091254 5:176807799-176807821 CTGGAGTCATAGACCCATGATGG + Intergenic
1002475920 5:179466093-179466115 CCGCAGCCACTGAAGCATGAGGG + Intergenic
1003062426 6:2874190-2874212 CTGTAGTCATTTAACTAAGAAGG + Intergenic
1003417887 6:5929171-5929193 CTCTAGCCATTGAACCTGCATGG - Intergenic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1008244526 6:49153729-49153751 CTGGAACAAGTGAACCATGATGG - Intergenic
1008947097 6:57110561-57110583 ATGCAACCATTTAACCATGAAGG - Intronic
1008951552 6:57165803-57165825 CTGTAGACATTGTAACATAATGG + Intronic
1010366184 6:75054590-75054612 CTTTATCCATTCATCCATGAAGG + Intergenic
1010523186 6:76867012-76867034 CTGTATCCATTGACCTATGTAGG - Intergenic
1010933624 6:81834348-81834370 CTTTAGCCAATGAACTAGGAGGG - Intergenic
1015899871 6:138053352-138053374 CTGAAGCCATAAACCCATGAAGG + Intergenic
1016375889 6:143420090-143420112 CTTTAGCATTTGAATCATGATGG + Intergenic
1022359360 7:29643706-29643728 CTCTAGCCATTGATCAATGTAGG + Intergenic
1023674585 7:42616676-42616698 ATGTGACCATTCAACCATGAAGG + Intergenic
1024818390 7:53297678-53297700 ATGTAGCAATTGAACCTAGATGG - Intergenic
1031814319 7:126414434-126414456 CTGAAGCAATTGAAACATTATGG - Intergenic
1032423115 7:131799114-131799136 CTGTAGCCAATGTCCCCTGATGG - Intergenic
1036522231 8:9502220-9502242 CTTTAGCCATTCATCCGTGATGG + Intergenic
1039203101 8:35118461-35118483 CTGTAACAATTGACCCACGATGG - Intergenic
1041208256 8:55520734-55520756 CTGTAGCCGTAGAAAAATGAAGG - Intronic
1046728223 8:117697248-117697270 CTGTGGGAATAGAACCATGAAGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1054998876 9:71425756-71425778 GTCTAGCCATTGACCCATAAGGG + Intronic
1055820986 9:80263609-80263631 CTGTATCCATTCATCCATCAAGG - Intergenic
1059158584 9:112012294-112012316 CTGTACCCATTGAAATATGGAGG - Intergenic
1061304203 9:129723148-129723170 CTCCGGCCATTTAACCATGAAGG + Intergenic
1194308501 X:92276329-92276351 CTTTAGCCATTAAGCCAAGAAGG + Intronic
1194972276 X:100357272-100357294 CTACAGCCATTGAGCCATTAGGG - Intronic
1195908256 X:109865889-109865911 CAGCACCCATTGGACCATGAGGG + Intergenic
1197234154 X:124040230-124040252 CTGTAGCTGTTGAAGCATGGAGG + Intronic
1197414108 X:126153260-126153282 GTATAGACATTGTACCATGATGG + Intergenic
1198410994 X:136368002-136368024 CTGTATCCATTCCACCATCAGGG + Intronic